Discovery has worked with hundreds of researchers on thousands of projects to help uncover valuable insights that accelerate research and development programs across several disease indications, including cancer, infectious disease, autoimmune disease, women’s health, cardiovascular disease, inflammatory diseases and many others.
Year | Authors | Title | Journal | PubMed ID | Snippet | Link |
---|---|---|---|---|---|---|
2023 | Bellet-Ezquerra, M;Pardo, P;Fasani, R;Villacampa, G;Portu, M;Serna, G;Joval, L;Petit, A;Ortega, A;Jimenez, J;Zamora, E;Gil, M;Gomez, L;Viaplana, C;Gallego, F;Cámara, V;Manich, C;Simon, S;Nuciforo, P; | 62P KI67 in ER+HER2-negative pure invasive lobular breast carcinoma (ILC). What’s the best Ki67 threshold to differentiate prognosis? | ESMO Open | a, Novartis, Daiichi Sankyo; Non-Financial Interests, Invited Speaker: SOLTI. P.G. Nuciforo: Financial Interests, Personal, Invited Speaker: Novartis; Financial Interests, Personal, Advisory Board: MSD Oncology, Bayer; Financial Interests, Personal, | Full Paper | |
2023 | Cieniewicz, B;Bhatta, A;Torabi, D;Baichoo, P;Saxton, M;Arballo, A;Nguyen, L;Thomas, S;Kethar, H;Kukutla, P;Shoaga, O;Yu, B;Yang, Z;Fate, M;Oliveira, E;Ning, H;Corey, L;Corey, D; | Chimeric TIM-4 receptor-modified T cells targeting phosphatidylserine mediates both cytotoxic anti-tumor responses and phagocytic uptake of tumor-associated antigen for T cell cross-presentation | Molecular therapy : the journal of the American Society of Gene Therapy | 37194236 | Healthy donor T cells were positively selected from fresh leukopak provided by AllCells (Alameda, CA) by using anti-CD4 and CD8 antibodies through the Prodigy TCT program. All related reagents and instruments were purchased from Miltenyi. After selec | Full Paper |
2023 | Overbeck, TR;Reiffert, A;Schmitz, K;Rittmeyer, A;Körber, W;Hugo, S;Schnalke, J;Lukat, L;Hugo, T;Hinterthaner, M;Reuter-Jessen, K;Schildhaus, HU; | NTRK Gene Fusions in Non-Small-Cell Lung Cancer: Real-World Screening Data of 1068 Unselected Patients | Cancers | 37296928 | r or speaker from: Amgen, AstraZeneca, Bayer, Daiichi-Sankyo, Diaceutics, Incyte, Janssen-Cilag, Eli Lilly, Merck Sharp and Dohme, Novartis Pharma, Pfizer, PharmaMar, Roche Pharma, Servier, Stemline, Targos GmbH, and ZytoVision. A.R. received grants | Full Paper |
2023 | Wagner, R;McKindles, K;Bullerjahn, G; | Effects of water movement and temperature on Rhizophydium infection of Planktothrix in a shallow hypereutrophic lake | Frontiers in Microbiology | sent to HudsonAlpha Discovery Life Sciences (Hudson, AL, United States) for sequencing. Amplicon sequencing and QC was performed by HudsonAlpha Discovery Life Save;- Discovery Life Sciences (Hudson, AL, United States) for sequencing. Amplicon se | Full Paper | |
2023 | de Vries, EGE;Rüschoff, J;Lolkema, M;Tabernero, J;Gianni, L;Voest, E;de Groot, DJA;Castellano, D;Erb, G;Naab, J;Donica, M;Deurloo, R;van der Heijden, MS;Viale, G; | Phase II study (KAMELEON) of single-agent T-DM1 in patients with HER2-positive advanced urothelial bladder cancer or pancreatic cancer/cholangiocarcinoma | Cancer medicine | 37119523 | Department of Medical Oncology, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands.++Targos Molecular Pathology GmbH, Kassel, Germany.++Department of Medical Oncology, Erasmus MC Cancer Institute, Rotterdam, The | Full Paper |
2023 | Wang, S;Huang, Z;Liu, Y;Sun, H;Zhou, Y;Shi, J; | Sustainably released nanoparticle-based rhynchophylline limits pulmonary fibrosis by inhibiting the TEK-PI3K/AKT signaling pathway | Translational lung cancer research | 37057119 | /tlcr-22-675/rc). Methods Solution groups For better apply to the clinic, 0.9% saline solution was used as the solvent. Because of the extremely low concentration for cell, 1 mg of Rhy (CAS 76-66-4; Allcells, Shanghai, China) was directly dissolved | Full Paper |
2023 | Naik, NN;Vadloori, B;Poosala, S;Srivastava, P;Coecke, S;Smith, A;Akhtar, A;Roper, C;Radhakrishnan, S;Bhyravbhatla, B;Damle, M;Pulla, VK;Hackethal, J;Horland, R;Li, AP;Pati, F;Singh, MS;Occhetta, P;Bisht, R;Dandekar, P;Bhagavatula, K;Pajkrt, D;Johnson, M;Weber, T;Huang, J;Hysenaj, L;Mallar, B;Ramray, B;Dixit, S;Joshi, S;Kulkarni, M; | Advances in Animal Models and Cutting-Edge Research in Alternatives: Proceedings of the Third International Conference on 3Rs Research and Progress, Vishakhapatnam, 2022 | Alternatives to laboratory animals : ATLA | 37282515 | Dr Li highlighted the discovery focus of Discovery Life Sciences LLC, namely the liver and intestine. He further described the properties of their two major novel human in Save | Full Paper |
2023 | Guler, S;DiPoto, MC;Crespo, A;Caldwell, R;Doerfel, B;Grossmann, N;Ho, K;Huck, B;Jones, CC;Lan, R;Musil, D;Potnick, J;Schilke, H;Sherer, B;Simon, S;Sirrenberg, C;Zhang, Z;Liu-Bujalski, L; | Selective Wee1 Inhibitors Led to Antitumor Activity In Vitro and Correlated with Myelosuppression | ACS medicinal chemistry letters | 37197456 | We acknowledge Bettina Hoelke, Brian Dill, Ioannis Gounaris, and Emer Clarke (ReachBio) for their technical support and discussions | Full Paper |
2023 | Tang, PZ;Ding, B;Reyes, C;Papp, D;Potter, J; | Target-seq: single workflow for detection of genome integration site, DNA translocation and off-target events | BioTechniques | 37161298 | Peripheral blood mononuclear cells (PBMCs) were purified from leukopak (ALLCELLS, CA, USA) using CTS™ Rotea™ Counterflow Centrifugation System (Thermo Fisher Scientific, MA, USA) and were then activated for 3 days to enrich the T cells (at 1 × 106 ce | Full Paper |
2023 | Singh, P; | MSC and HSPC Coculture: Mimicking Ex Vivo Bone Marrow Niche | Methods in molecular biology (Clifton, N.J.) | 36255702 | CD34+ cells with micromagnetic beads-conjugated CD34 antibody and placing with the labeled cells into a magnetic field according to the specific manual instruction. Always use fresh BM samples (within 30 h of withdrawal) for CD34+ cell isolation. Hum | Full Paper |
2023 | Simmons, KT;Chan, J;Hussain, S;Rose, EL;Markham, K;Byun, TS;Panicker, S;Parry, GC;Storek, M; | Anti-C1s humanized monoclonal antibody SAR445088: A classical pathway complement inhibitor specific for the active form of C1s | Clinical immunology (Orlando, Fla.) | 37149117 | First, 1 mL of type O- hRBCs (Allcells, Alameda, CA) was washed in 4.5 mL GVB++ by centrifuging at 600 g for 5 min. The wash step was repeated three times and the cells were resuspended to a final volume of 5 mL in GVB++ after the third wash | Full Paper |
2023 | Sikkema, L;Ramírez-Suástegui, C;Strobl, DC;Gillett, TE;Zappia, L;Madissoon, E;Markov, NS;Zaragosi, LE;Ji, Y;Ansari, M;Arguel, MJ;Apperloo, L;Banchero, M;Bécavin, C;Berg, M;Chichelnitskiy, E;Chung, MI;Collin, A;Gay, ACA;Gote-Schniering, J;Hooshiar Kashani, B;Inecik, K;Jain, M;Kapellos, TS;Kole, TM;Leroy, S;Mayr, CH;Oliver, AJ;von Papen, M;Peter, L;Taylor, CJ;Walzthoeni, T;Xu, C;Bui, LT;De Donno, C;Dony, L;Faiz, A;Guo, M;Gutierrez, AJ;Heumos, L;Huang, N;Ibarra, IL;Jackson, ND;Kadur Lakshminarasimha Murthy, P;Lotfollahi, M;Tabib, T;Talavera-López, C;Travaglini, KJ;Wilbrey-Clark, A;Worlock, KB;Yoshida, M;Lung Biological Network Consortium, ;van den Berge, M;Bossé, Y;Desai, TJ;Eickelberg, O;Kaminski, N;Krasnow, MA;Lafyatis, R;Nikolic, MZ;Powell, JE;Rajagopal, J;Rojas, M;Rozenblatt-Rosen, O;Seibold, MA;Sheppard, D;Shepherd, DP;Sin, DD;Timens, W;Tsankov, AM;Whitsett, J;Xu, Y;Banovich, NE;Barbry, P;Duong, TE;Falk, CS;Meyer, KB;Kropski, JA;Pe'er, D;Schiller, HB;Tata, PR;Schultze, JL;Teichmann, SA;Misharin, AV;Nawijn, MC;Luecken, MD;Theis, FJ; | An integrated cell atlas of the lung in health and disease | Nature medicine | 37291214 | 19-ms2/?ds=full&meta=SampleName, https://figshare.com/articles/dataset/Single-cell_RNA-Seq_of_human_primary_lung_and_bronchial_epithelium_cells/11981034/1, https://covid19.lambrechtslab.org/downloads/Allcells.counts.rds, https://s3.amazonaws.com/dp-l | Full Paper |
2023 | Sternberg, CN;Petrylak, DP;Bellmunt, J;Nishiyama, H;Necchi, A;Gurney, H;Lee, JL;van der Heijden, MS;Rosenbaum, E;Penel, N;Pang, ST;Li, JR;García Del Muro, X;Joly, F;Pápai, Z;Bao, W;Ellinghaus, P;Lu, C;Sierecki, M;Coppieters, S;Nakajima, K;Ishida, TC;Quinn, DI; | FORT-1: Phase II/III Study of Rogaratinib Versus Chemotherapy in Patients With Locally Advanced or Metastatic Urothelial Carcinoma Selected Based on FGFR1/3 mRNA Expression | Journal of clinical oncology : official journal of the American Society of Clinical Oncology | 36240478 | ted prevalence of PIK3CA and/or RAS resistance mutations, we reconfirmed absence or presence in all enrolled patients using a targeted Illumina MiSeq panel (Illumina, Inc, San Diego, CA) performed by TARGOS Molecular Pathology GmbH (Kassel, Germany). | Full Paper |
2023 | Ho, C;Fromm, J;Fang, M;Till, B;Shadman, M;Cowan, A;Lynch, R;Wu, V;Voutsinas, J;Rasmussen, H;Blue, K;Ujjani, C;Shustov, A;Cassaday, R;Gopal, A;Smith, S; | Long-term efficacy and safety of pembrolizumab with R-CHOP as first-line therapy for DLBCL. | Journal of Clinical Oncology | Additionally, prognostic factors including tumor PD-L1 expression (Qualtek/Merck) were re-analyzed. Results: 30 patients were treated (13/30 with IPI 3-5). Median follow Save | Full Paper | |
2023 | Zhang, Y;Zhao, Z;Huang, LA;Liu, Y;Yao, J;Sun, C;Li, Y;Zhang, Z;Ye, Y;Yuan, F;Nguyen, TK;Garlapati, NR;Wu, A;Egranov, SD;Caudle, AS;Sahin, AA;Lim, B;Beretta, L;Calin, GA;Yu, D;Hung, MC;Curran, MA;Rezvani, K;Gan, B;Tan, Z;Han, L;Lin, C;Yang, L; | Molecular mechanisms of snoRNA-IL-15 crosstalk in adipocyte lipolysis and NK cell rejuvenation | Cell metabolism | 37329887 | Healthy and obese human serum Coriell Biorepository See Table S1 Human breast cancer tumor tissues and paired plasma samples Discovery Life Sciences See Table S2 Primary human pre-adipocytes Zen-Bio See Table S3 | Full Paper |
2023 | Libreros, S;Nshimiyimana, R;Lee, B;Serhan, CN; | Infectious Neutrophil deployment is regulated by Resolvin D4 | Blood | 37295018 | Fresh BM aspirates from deidentified individuals were purchased from AllCells, Inc (Alameda, CA) with Mass General Brigham investigational review board protocol no. 1999P0001279. For information on donor demographics, see Supplemental Table-1. Human | Full Paper |
2023 | Dunbar, AJ;Kim, D;Lu, M;Farina, M;Bowman, RL;Yang, JL;Park, Y;Karzai, A;Xiao, W;Zaroogian, Z;O'Connor, K;Mowla, S;Gobbo, F;Verachi, P;Martelli, F;Sarli, G;Xia, L;Elmansy, N;Kleppe, M;Chen, Z;Xiao, Y;McGovern, E;Snyder, J;Krishnan, A;Hill, C;Cordner, K;Zouak, A;Salama, ME;Yohai, J;Tucker, E;Chen, J;Zhou, J;McConnell, T;Migliaccio, AR;Koche, R;Rampal, R;Fan, R;Levine, RL;Hoffman, R; | CXCL8/CXCR2 signaling mediates bone marrow fibrosis and is a therapeutic target in myelofibrosis | Blood | 36800567 | ple was independently verified by a hematopathologist (W.X.) or pulled directly from clinical pathology reports at the time of sample collection. Deidentified, healthy CD34+ cells were purchased from AllCells. CD34+ selection was carried out using Fi | Full Paper |
2023 | Kiridena, S;Wijayaratna, U;Levon, E;Moschella, P;Pirrallo, R;Tzeng, T;Anker, J; | X?Ray Visualized Sensors for Peritoneal Dialysis Catheter Infection | Advanced Functional Materials | Deidentified human peritoneal fluid was obtained from Discovery Life Sciences, Huntsville, AL, a commercial biospecimen source. Tantalum beads (0.394 mm diameter) Save | Full Paper | |
2023 | Tarafder, S;Ghataure, J;Langford, D;Brooke, R;Kim, R;Eyen, SL;Bensadoun, J;Felix, JT;Cook, JL;Lee, CH; | Advanced bioactive glue tethering Lubricin/PRG4 to promote integrated healing of avascular meniscus tears | Bioactive materials | 37214259 | ?S-encapsulating TGF?3 (R&D systems) (2.5 ?g per 500 mg PLGA) was applied to the incised tissues. Then the meniscus explants were placed on top of monolayer-cultured P2 - P3 syMSCs or hBMSCs (AllCells, Alameda, CA) at 80-90% confluence per our previo | Full Paper |
2023 | Sarno, J;Domizi, P;Liu, Y;Merchant, M;Pedersen, CB;Jedoui, D;Jager, A;Nolan, GP;Gaipa, G;Bendall, SC;Bava, FA;Davis, KL; | Dasatinib overcomes glucocorticoid resistance in B-cell acute lymphoblastic leukemia | Nature communications | 37217509 | Healthy human bone marrow samples (n = 3 for RNA-Seq, n = 4 for CyTOF) were purchased through AllCells. De-identified bone marrow samples from pediatric patients Save | Full Paper |
2023 | Yang, Y;Yang, H;Alcaina, Y;Puc, J;Birt, A;Vedvyas, Y;Gallagher, M;Alla, S;Riascos, MC;McCloskey, JE;Du, K;Gonzalez-Valdivieso, J;Min, IM;de Stanchina, E;Britz, M;von Hofe, E;Jin, MM; | Inducible expression of interleukin-12 augments the efficacy of affinity-tuned chimeric antigen receptors in murine solid tumor models | Nature communications | 37045815 | quoted and stored at ?80?°C. CAR-T cells were generated by transducing activated T cells with lentivirus. Primary T cells were enriched from commercially obtained leukopaks from healthy donors (AllCells) via MACS separation using CD4 (Miltenyi Biote | Full Paper |
2023 | Lee, JY;Jonus, HC;Sadanand, A;Branella, GM;Maximov, V;Suttapitugsakul, S;Schniederjan, MJ;Shim, J;Ho, A;Parwani, KK;Fedanov, A;Pilgrim, AA;Silva, JA;Schnepp, RW;Doering, CB;Wu, R;Spencer, HT;Goldsmith, KC; | Identification and targeting of protein tyrosine kinase 7 (PTK7) as an immunotherapy candidate for neuroblastoma | Cell reports. Medicine | 37343516 | Bacterial and virus strains ------------------------- Stbl3 Competent Cells Spencer Lab N/A ------------------------- Biological samples ------------------------- Healthy PBMC AllCells LP,CR,MNC, 10M COG-424s (Neuroblastoma PDX) Chi | Full Paper |
2023 | Chen, SS;Barrientos, JC;Ferrer, G;King-Richards, M;Chen, YJ;Ravichandran, P;Ibrahim, M;Kieso, Y;Waters, S;Kutok, JL;Peluso, M;Sharma, S;Weaver, DT;Pachter, JA;Rai, KR;Chiorazzi, N; | Duvelisib Eliminates CLL B Cells, Impairs CLL-Supporting Cells, and Overcomes Ibrutinib Resistance in a Xenograft Model | Clinical cancer research : an official journal of the American Association for Cancer Research | 37071496 | Human PBMCs obtained from whole blood of CLL donors were purchased from a commercial source (Bioreclamation IVT or ALLCELLS) were resuspended (1 × 10 6 cells/ Save | Full Paper |
2023 | Xiang, J;Liu, Q;Shaknovich, R;Venn, O; | Abstract 779: Clonal B-cell expansion and the potential challenges to blood-based early cancer detection | Cancer Research | ht tubes of frozen buffy coat for a young healthy donor (18-35; no pre-existing health conditions; nonsmoker; viral negative) was sourced commercially (Discovery Life Sciences, Huntsville, AL, USA) and used as the backgrou | Full Paper | |
2023 | Fahl, S;Colwell, K;Smith, C;Ott, C;Moore, A;Williams, K; | Abstract 602: Single cell evaluation of intratumoral B cells across solid tumor indications | Cancer Research | 1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsvill | Full Paper | |
2023 | Li, A;Wei, H; | Abstract 5338: A novel in vitro assay to evaluate the roles of hepatic metabolism on anticancer drug safety and efficacy | Cancer Research | 1Discovery Life Sciences LLC, Columbia, MD.++1Discovery Life Sciences LLC, Columbia, MD | Full Paper | |
2023 | Roy, G;Kadekar, P;Douglas, L;Frappier, M;Currie, J;Dhillon, J;Cesarone, G;Siderits, R;Kirchner, K;Demeule, M;Marsolais, C; | Abstract 3942: Differential expression of a novel transport receptor, SORT1 (sortilin), in cancer versus healthy tissues that can be utilized for targeted delivery of anti-cancer drugs | Cancer Research | 1Theratechnologies Inc., Montreal, Quebec, Canada;++1Theratechnologies Inc., Montreal, Quebec, Canada;++1Theratechnologies Inc., Montreal, Quebec, Canada;++1Theratechnologies Inc., Montreal, Quebec, Canada;++1Theratechnologies Inc., Montreal, Quebec, | Full Paper | |
2023 | Cheng, C;Chen, H;Kirchner, K;Cesarone, G; | Abstract 2763: Characterization of a novel immunohistochemistry (IHC) assay for CEACAM5 using a commercial antibody | Cancer Research | [Abcam], and 327 [Sino Biological]) to evaluate CEACAM5 detection in formalin-fixed, paraffin-embedded (FFPE) human cancer tissues from Discovery Life Sciences Save | Full Paper | |
2023 | Zielinski, D;Vogtmann, R;Siemon, A;Koppel, C;Schipper, C;Tereshchenko, A;Platero, S;Schildhaus, H; | Abstract 1018: Multiplex immunofluorescence and image analysis to investigate the role of the immune contexture and fibroblast activation for tumor cell budding in colorectal cancer | Cancer Research | 1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsvill | Full Paper | |
2023 | Kumar, A;Taghi Khani, A;Duault, C;Aramburo, S;Sanchez Ortiz, A;Lee, SJ;Chan, A;McDonald, T;Huang, M;Lacayo, NJ;Sakamoto, KM;Yu, J;Hurtz, C;Carroll, M;Tasian, SK;Ghoda, L;Marcucci, G;Gu, Z;Rosen, ST;Armenian, S;Izraeli, S;Chen, CW;Caligiuri, MA;Forman, SJ;Maecker, HT;Swaminathan, S; | Intrinsic suppression of type I interferon production underlies the therapeutic efficacy of IL-15-producing natural killer cells in B-cell acute lymphoblastic leukemia | Journal for immunotherapy of cancer | 37217248 | opoietic Tissue Biorepository and University of Pennsylvania Stem Cell and Xenograft Core after informed consent per Institutional Review Board policies. Age-matched healthy BMMCs were purchased from AllCells (Alameda, California, USA) and Stem Cell | Full Paper |
2023 | Nirschl, CJ;Brodkin, HR;Domonkos, C;Dwyer, CJ;Hicklin, DJ;Ismail, N;Seidel-Dugan, C;Steiner, P;Steuert, Z;Sullivan, JM;Winston, WM;Salmeron, A; | mWTX-330, an IL 12 INDUKINE Molecule, Activates and Reshapes Tumor-infiltrating CD8+ T and NK Cells to Generate Antitumor Immunity | Cancer immunology research | 37074216 | Dissociated human tumor samples were purchased from Discovery Life Sciences and included the following indications: bladder cancer, glioblastoma multiforme, gastric Save | Full Paper |
2023 | Diwanji, R;O'Brien, NA;Choi, JE;Nguyen, B;Laszewski, T;Grauel, AL;Yan, Z;Xu, X;Wu, J;Ruddy, DA;Piquet, M;Pelletier, MR;Savchenko, A;Charette, L;Rodrik-Outmezguine, V;Baum, J;Millholland, JM;Wong, CC;Martin, AM;Dranoff, G;Pruteanu-Malinici, I;Cremasco, V;Sabatos-Peyton, C;Jayaraman, P; | Targeting the IL1? Pathway for Cancer Immunotherapy Remodels the Tumor Microenvironment and Enhances Antitumor Immune Responses | Cancer immunology research | 37040466 | Dissociated human microsatellite-stable colorectal carcinoma (MSS-CRC) samples were obtained from Discovery Life Sciences from five donors. Between 25,000 and Save | Full Paper |
2023 | Huang, W;Lin, W;Chen, B;Zhang, J;Gao, P;Fan, Y;Lin, Y;Wei, P; | NFAT and NF-?B dynamically co-regulate TCR and CAR signaling responses in human T cells | Cell reports | 37347664 | K562 Laboratory of Wendell Lim N/A Jurkat Laboratory of Arthur Weiss N/A Human PBMC ALLCELLS PB004F-C | Full Paper |
2023 | Raj, N;Chan, JA;Wang, SJ;Aggarwal, RR;Calabrese, S;DeMore, A;Fong, L;Grabowsky, J;Hope, TA;Kolli, KP;Mulvey, CK;Munster, PN;Perez, K;Punn, S;Reidy-Lagunes, D;Von Fedak, S;Zhang, L;Bergsland, EK; | Pembrolizumab alone and pembrolizumab plus chemotherapy in previously treated, extrapulmonary poorly differentiated neuroendocrine carcinomas | British journal of cancer | 37208512 | Background To date, single-agent immune checkpoint inhibitor (CPI) therapy has proven to be ineffective against biomarker-unselected extrapulmonary poorly Save | Full Paper |
2023 | Reissig, TM;Tzianopoulos, I;Liffers, ST;Rosery, VK;Guyot, M;Ting, S;Wiesweg, M;Kasper, S;Meister, P;Herold, T;Schmidt, HH;Schumacher, B;Albers, D;Markus, P;Treckmann, J;Schuler, M;Schildhaus, HU;Siveke, JT; | Smaller panel, similar results: genomic profiling and molecularly informed therapy in pancreatic cancer | ESMO open | 37148593 | stock ownership: none; honoraries for CME presentations: Amgen, Boehringer Ingelheim, Bristol-Myers Squibb, Janssen, Novartis; research funding to institution: AstraZeneca, Bristol Myers-Squibb. HUS: Targos Molecular Pathology, Inc. (employment); Roc | Full Paper |
2023 | Han, R;Guo, H;Shi, J;Wang, H;Zhao, S;Jia, Y;Liu, X;Li, J;Cheng, L;Zhao, C;Li, X;Zhou, C; | Tumour microenvironment changes after osimertinib treatment resistance in non-small cell lung cancer | European journal of cancer (Oxford, England : 1990) | 37320935 | Fresh PBMCs of three healthy donors were purchased from Allcells (China). A total of 2 × 10 6 PBMC cells/well were seeded into 24-well plated and were treated with: Save | Full Paper |
2023 | Geoerger, B;Marshall, LV;Nysom, K;Makin, G;Bouffet, E;Defachelles, AS;Amoroso, L;Aerts, I;Leblond, P;Barahona, P;Van-Vlerken, K;Fu, E;Solca, F;Lorence, RM;Ziegler, DS; | Afatinib in paediatric patients with recurrent/refractory ErbB-dysregulated tumours: Results of a phase I/expansion trial | European journal of cancer (Oxford, England : 1990) | 37178647 | Biomarker assays were performed centrally by TARGOS Molecular Pathology GmbH using tissue samples from archived tumour blocks, or tissue sections [20]. Save | Full Paper |
2023 | Robert, ME;Rüschoff, J;Jasani, B;Graham, RP;Badve, SS;Rodriguez-Justo, M;Kodach, LL;Srivastava, A;Wang, HL;Tang, LH;Troncone, G;Rojo, F;Van Treeck, BJ;Pratt, J;Shnitsar, I;Kumar, G;Karasarides, M;Anders, RA; | Erratum to High Interobserver Variability Among Pathologists Using Combined Positive Score to Evaluate PD-L1 Expression in Gastric, Gastroesophageal Junction, and Esophageal Adenocarcinoma [Modern Pathology 36(5) (2023) 100154] | Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc | 37327723 | Yale University School of Medicine, New Haven, Connecticut. Electronic address: marie.robert@yale.edu.++Discovery Life Sciences, Hesse, Germany.++Discovery Life Sciences, Hesse, Germany.++Mayo Clinic, Rochester, Minnesota.++Emory University School of | Full Paper |
2023 | Dong, Q;Tong, M;Yu, X;Wang, L;Ao, J;Guan, D;Tang, Y;Liu, J;Long, L;Tong, Y;Fang, S;Zhou, H;Huang, Y;Gong, L;Lou, L;Huang, W; | Carbohydrate Strengthens the Immunotherapeutic Effect of Small-Molecule PD-L1 Inhibitors | Journal of medicinal chemistry | 37226718 | Stimulator cells from donor A and responder cells from donor B constitute the mixed lymphocyte reaction (MLR). Pheral Blood Mononuclear Cells (PBMCs) were purchased from Allcells (Shanghai) and used following the instruction of the manufacturer. DC c | Full Paper |
2023 | Papakonstantinou, A;Napoli, S;Joval, L;Butjosa-Espin, M;Malavila, A;Puy, M;Pimentel, I;Zamora, E;Torres, P;Rodas, N;Manich, C;Seoane, J;Nonell, L;Nuciforo, P;Oliveira, M; | 19P Tumor-associated microbiome composition and response to neoadjuvant chemotherapy (NACT) in early triple-negative breast cancer (TNBC) | ESMO Open | ncer Research (AACR). P.G. Nuciforo: Financial Interests, Personal, Invited Speaker: Novartis; Financial Interests, Personal, Advisory Board: MSD Oncology, Bayer; Financial Interests, Personal, Other, Consultant: Targos Molecular Pathology GmbH. M. O | Full Paper | |
2023 | Akiyama, H;Carter, BZ;Andreeff, M;Ishizawa, J; | Molecular Mechanisms of Ferroptosis and Updates of Ferroptosis Studies in Cancers and Leukemia | Cells | 37190037 | Another study demonstrates that progestin and adipoQ receptor 3 (PAQR3) enhances erastin- as well as RSL3-induced ferroptosis in ALLcells through the degradation of Save | Full Paper |
2023 | Chaand, M;Fiore, C;Johnston, B;D'Ippolito, A;Moon, DH;Carulli, JP;Shearstone, JR; | Erythroid lineage chromatin accessibility maps facilitate identification and validation of NFIX as a fetal hemoglobin repressor | Communications biology | 37316562 | Fetal CB-derived CD34+ cells (AllCells, LLC) were transduced with concentrated lentivirus at an MOI = 1. Transduced cells were selected in the presence of 2 µg/mL Save | Full Paper |
2023 | Lin, W;Singh, V;Springer, R;Choonoo, G;Gupta, N;Patel, A;Frleta, D;Zhong, J;Owczarek, T;Decker, C;Macdonald, L;Murphy, A;Thurston, G;Mohrs, M;Ioffe, E;Lu, YF; | Human CD4 cytotoxic T lymphocytes mediate potent tumor control in humanized immune system mice | Communications biology | 37185301 | from fetal liver or cord blood, respectively. Fetal liver CD34+ HSPC were obtained from Advanced Biosciences Resources (Alameda, CA) with proper consent66 and cord blood CD34+ HSPC were obtained from AllCells, HemaCare, or STEMCELL Technologies. Huma | Full Paper |
2023 | Maden, M;Polvadore, T;Polanco, A;Barbazuk, WB;Stanley, E; | Osteoderms in a mammal the spiny mouse Acomys and the independent evolution of dermal armor | iScience | 37378333 | na NovaSeq6000 platform to yield nearly 898 million paired-end, 150 bp reads (mean of 74.8 M read pairs (s = 9.1 M read pairs) per library). Library construction and sequencing were performed by HudsonAlpha Discovery in Huntsville, Alabama, USA. Qua | Full Paper |
2023 | Egelston, CA;Guo, W;Yost, SE;Ge, X;Lee, JS;Frankel, PH;Cui, Y;Ruel, C;Schmolze, D;Murga, M;Tang, A;Martinez, N;Karimi, M;Somlo, G;Lee, PP;Waisman, JR;Yuan, Y; | Immunogenicity and efficacy of pembrolizumab and doxorubicin in a phase I trial for patients with metastatic triple-negative breast cancer | Cancer immunology, immunotherapy : CII | 37294342 | Biomarker Working Group on Breast Cancer Guidelines [18]. PD-L1 was determined by QualTek Molecular Laboratory (Goleta, CA) using immunohistochemistry (IHC) with 22C3 antibody (Merck & Co, Kenilworth, NJ). PD-L1 was positive if membrane staining was | Full Paper |
2023 | Becker, SA;Petrich, BG;Yu, B;Knight, KA;Brown, HC;Raikar, SS;Doering, CB;Spencer, HT; | Enhancing the effectiveness of ?? T cells by mRNA transfection of chimeric antigen receptors or bispecific T cell engagers | Molecular therapy oncolytics | 37387794 | ed from healthy donor blood through the Children’s Clinical Translational Discovery Core at Emory University under the core’s approved institutional review board protocol or ordered directly from AllCells. PBMCs were isolated from fresh blood using F | Full Paper |
2023 | Chervin, AS;Stone, JD;Konieczna, I;Calabrese, KM;Wang, N;Haribhai, D;Dong, F;White, MK;Rodriguez, LE;Bukofzer, GT;Ellis, PA;Cosgrove, C;Hecquet, C;Clarin, JD;Palma, JP;Reilly, EB; | ABBV-184: A novel survivin-specific TCR/CD3 bispecific T cell engager is active against both solid tumor and hematological malignancies | Molecular cancer therapeutics | 37294945 | Primary frozen viable PBMCs from AML patients and including AML blasts were purchased from Discovery Life Sciences and verified for HLA-A2 expression by staining with the HLA-A2 specific monoclonal antibody BB7.2 and detecting by flow cytometry | Full Paper |
2023 | Korntner, SH;Di Nubila, A;Gaspar, D;Zeugolis, DI; | Macromolecular crowding in animal component-free, xeno-free and foetal bovine serum media for human bone marrow mesenchymal stromal cell expansion and differentiation | Frontiers in bioengineering and biotechnology | 36949882 | ed. 2.2 Isolation and expansion of hBMSCs Fresh human whole bone marrow from the iliac crest of two different donors (donor 1: female, 22 years old; donor 2: male, 25 years old) was purchased from AllCells (United States) and hBMSCs were isolated u | Full Paper |
2023 | Dempsey, MP;Andersen, KE;Wells, BM;Taylor, MA;Cashman, CL;Conrad, LB;Kearney, CA;Conklin, MB;Via, ER;Doe, EM;Komirisetty, R;Dearborn, S;Reddy, ST;Farias-Eisner, R; | Stability Characterization of the Novel Anti-Cancer HM-10/10 HDL-Mimetic Peptide | International journal of molecular sciences | 37373203 | 82043-96OD), one plate per lot, were obtained from In Vitro ADMET Laboratories (Malden, MA, USA). The transport medium was replaced with 200 ?L of warm (37 C) Save | Full Paper |
2023 | El Ouardi, M;Tamarit, L;Vayá, I;Miranda, MA;Andreu, I; | Cellular photo(geno)toxicity of gefitinib after biotransformation | Frontiers in pharmacology | 37351506 | UPV-CSIC, Universitat Politècnica de València, Valencia, Spain 2 Unidad Mixta de Investigación UPV- IIS La Fe, Hospital Universitari i Politècnic La Fe, Valencia, Spain Edited by: Albert P. Li, In Vitro ADMET Laboratories, United States Reviewed by | Full Paper |
2023 | Takei, S;Kinoshita, H;Jamal, M;Kumihashi, M;Yamashita, T;Tanaka, E;Kawahara, S;Abe, H;Tsutsui, K;Kimura, S; | Case report: Fatal poisoning caused by additive effects of two barbiturates | Frontiers in pharmacology | 37292155 | Medicine, Faculty of Medicine, Kagawa University, Takamatsu, Japan 2 Biodesign Inc, Tokyo, Japan 3 Kagawa Prefectural University of Health Sciences, Takamatsu, Kagawa, Japan Edited by: Albert P. Li, In Vitro ADMET Laboratories, United States Review | Full Paper |
2023 | Li, S;Zhan, J;Wang, Y;Oduro, PK;Owusu, FB;Zhang, J;Leng, L;Li, R;Wei, S;He, J;Wang, Q; | Suxiao Jiuxin Pill attenuates acute myocardial ischemia via regulation of coronary artery tone | Frontiers in pharmacology | 37234713 | vestigated. The EC50 and Rmax (maximal vasorelaxation) values were then calculated. 2.8 Cell culture and western blotting analysis Human umbilical vein endothelial cells (HUVECs) were purchased from AllCells Biotech Co., Ltd. (Shanghai, China). The | Full Paper |
2023 | Greenstein, AE;Hunt, HJ; | The glucocorticoid receptor modulator relacorilant reverses the immunosuppressive effects of cortisol | International immunopharmacology | 37230031 | GR was assessed using a rabbit monoclonal antibody clone D8H2 from Cell Signaling Technology (Cat#3660S) as described previously [41]. CD3 (Dako, A0452), FOXP3 (eBioscience 14-4777), CD57 (ThermoFisher, MA5-12008), and PD-1 (Abcam, ab53587) were acqu | Full Paper |
2023 | Cyr, MG;Wilson, HD;Spierling, AL;Chang, J;Peng, H;Steinberger, P;Rader, C; | Concerted Antibody and Antigen Discovery by Differential Whole-cell Phage Display Selections and Multi-omic Target Deconvolution | Journal of molecular biology | 37019174 | Fresh healthy donor PBMCs were bought from AllCells and cryopreserved prior to use with 50% FBS, 10% DMSO in RPMI-1640 medium. Save | Full Paper |
2023 | Isaioglou, I;Aldehaiman, MM;Li, Y;Lahcen, AA;Rauf, S;Al-Amoodi, AS;Habiba, U;Alghamdi, A;Nozue, S;Habuchi, S;Salama, KN;Merzaban, JS; | CD34+ HSPCs-derived exosomes contain dynamic cargo and promote their migration through functional binding with the homing receptor E-selectin | Frontiers in cell and developmental biology | 37181754 | O2 concentration of 5% v/v. The cell cultures were passaged frequently to maintain the cells at 0.8 × 106 cells/ml. Primary human AML CD34+ cells from Mobilized Peripheral Blood were purchased from AllCells, while Primary Human CD34+ cells from Mobi | Full Paper |
2023 | Basu, A;Champagne, RN;Patel, NG;Nicholson, ED;Weiss, RJ; | TFCP2 is a transcriptional regulator of heparan sulfate assembly and melanoma cell growth | The Journal of biological chemistry | 37061003 | in Table S4. RNA sequencing and differential gene expression analysis Total RNA extracted from wildtype and knockout cell lines was submitted for library preparation and next-generation sequencing (HudsonAlpha Discovery). Raw RNA sequencing data was | Full Paper |
2023 | Spriano, F;Aresu, L;Cascione, L;Risi, G;Arribas, AJ;Napoli, S;Forster-Gross, N;Bachmann, F;Engelhardt, M;Lane, H;Bertoni, F; | The microtubule-targeted agent lisavanbulin (BAL101553) shows anti-tumor activity in lymphoma models | American journal of cancer research | 37293172 | (TMA) (LY1001D and LY2086B, TissueArray.com) were stained for EB1 using a CE-marked immunohistochemistry Clinical Trial Assay (Discovery Life Sciences Biomarker Save | Full Paper |
2023 | Baraibar, I;García, A;Salvà, F;Ros, J;Saoudi, N;Comas, R;Castillo, G;Sanchis, M;García-Álvarez, A;Hernando, J;Capdevila, J;Castells, MR;Martí, M;Landolfi, S;Espín, E;Navalpotro, B;Guevara, J;Dopazo, C;Nuciforo, P;Vivancos, A;Tabernero, J;Élez, E; | Impact of the COVID-19 pandemic in the early-onset colorectal cancer | Translational oncology | 37031602 | Paolo Nuciforo reports personal financial interest in form of scientific consultancy role for Targos Molecular Pathology. His-institution has received research funding from Save;- Paolo Nuciforo reports personal financial interest in form of scie | Full Paper |
2023 | Pousse, L;Korfi, K;Medeiros, BC;Berrera, M;Kumpesa, N;Eckmann, J;Hutter, IK;Griesser, V;Karanikas, V;Klein, C;Amann, M; | CD25 targeting with the afucosylated human IgG1 antibody RG6292 eliminates regulatory T cells and CD25+ blasts in acute myeloid leukemia | Frontiers in oncology | 37205201 | Frozen healthy BMMC were purchased from Discovery Life Sciences. All human samples were collected under the approval of the relevant Institutional Review Board (IRB Save | Full Paper |
2023 | Kourula, S;Derksen, M;Jardi, F;Jonkers, S;van Heerden, M;Verboven, P;Theuns, V;Van Asten, S;Huybrechts, T;Kunze, A;Frazer-Mendelewska, E;Lai, KW;Overmeer, R;Roos, JL;Vries, RGJ;Boj, SF;Monshouwer, M;Pourfarzad, F;Snoeys, J; | Intestinal organoids as an in vitro platform to characterize disposition, metabolism, and safety profile of small molecules | European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences | 37244450 | Intestinal organoids derived from LGR5 + adult stem cells allow for long-term culturing, more closely resemble human physiology than traditional intestinal models, like Save;- HQM Incubation Medium and co-factor N were acquired from in vitro ADME | Full Paper |
2023 | Gnanapragasam, MN;Planutis, A;Glassberg, JA;Bieker, JJ; | Identification of a genomic DNA sequence that quantitatively modulates KLF1 transcription factor expression in differentiating human hematopoietic cells | Scientific reports | 37165057 | is human GRCh37/hg19 genome browser (https://main.genome-browser.bx.psu.edu/index.html), focusing on results using CD34+ or bone marrow derived erythroid cells. Human CD34+ cells were purchased from AllCells or obtained from the Yale Cooperative Cen | Full Paper |
2023 | Li, J;Zhang, Z;Zhuang, Y;Wang, F;Cai, T; | Small RNA transcriptome analysis using parallel single-cell small RNA sequencing | Scientific reports | 37160973 | ng). PBMCs preparation Cryopreserved CD3+ Pan T cells (PB009-1F-C-5M), CD19+ B cells (PB010-P-F-C), CD14+ monocytes (PB-011-P-F-1-C), and CD56+ natural killer cells (PB012-P-F-C) were purchased from AllCells (Shanghai, China). The CD3+ Pan T cells w | Full Paper |
2023 | Ke, H;Zhang, F;Wang, J;Xiong, L;An, X;Tu, X;Chen, C;Wang, Y;Mao, B;Guo, S;Ju, C;He, X;Sun, R;Zhang, L;O'Connor, OA;Li, QX; | HX009, a novel BsAb dual targeting PD1 x CD47, demonstrates potent anti-lymphoma activity in preclinical models | Scientific reports | 37012357 | Gibco). Jurkat-CSR cells, from ImmuneOnco Biopharmaceuticals (Shanghai), were cultured in RPMI-1640 (Gibco) with 10% FBS (Gemini). Human PBMCs used in the studies were purchased from ALLCELL (https://allcells.com) where informed consent and approved | Full Paper |
2023 | Adhikary, G;Heipertz, EL;Preradovic, M;Chen, X;Xu, W;Newland, JJ;Kaur, N;Vemuri, MC;Eckert, RL; | Natural killer cells suppress human cutaneous squamous cell carcinoma cancer cell survival and tumor growth | Molecular carcinogenesis | 36994661 | Cryopreserved peripheral blood mononuclear cells (PBMCs) were obtained from AllCells. NK cells were enriched via negative selection using the Human NK Cell Save | Full Paper |
2023 | Sweeney, EE;Sekhri, P;Telaraja, D;Chen, J;Chin, SJ;Chiappinelli, KB;Sanchez, CE;Bollard, CM;Cruz, CRY;Fernandes, R; | Engineered tumor-specific T cells using immunostimulatory photothermal nanoparticles | Cytotherapy | 37278683 | ix-coated plates in Astrocyte Medium (Thermo Fisher Scientific). Cells were expanded as per the specifications provided by the supplier. Healthy donor peripheral blood leukopaks were purchased from AllCells (Alameda, CA, USA) with the corresponding h | Full Paper |
2023 | Zhang, L;Yu, L;Xu, Y;Qin, P;Shen, P;Liu, K;Fei, M;Wang, H;Cao, Y;Lu, L;Gao, W;Zhang, Z; | Demonstrating analytical similarity of a biosimilar HLX04 to bevacizumab with a panel of state-of-the-art methods and tiering of quality attributes | Analytical and bioanalytical chemistry | 37162525 | Human umbilical vein endothelial cell (HUVEC), obtained from Allcells (No. H-001F, CA, USA), was used to determine the inhibitory effects of HLX04 and CN-/EU-Avastin® on proliferation of cells expressing VEGFR. HUVEC expresses VEGFR that binds to VEG | Full Paper |
2023 | Verner, EL;Jackson, JB;Severson, E;Valkenburg, KC;Greer, AE;Riley, DR;Sausen, M;Maddox, C;McGregor, PM;Karandikar, A;Hastings, SB;Previs, RA;Reddy, VP;Jensen, TJ;Ramkissoon, SH; | Validation of the Labcorp Plasma Focus Test to Facilitate Precision Oncology Through Cell-Free DNA Genomic Profiling of Solid Tumors | The Journal of molecular diagnostics : JMD | 37068734 | Clinical samples used to evaluate the analytical performance of the Labcorp Plasma Focus test were sourced from multiple biorepositories or as part of internal sample collections (BioIVT, Chestertown, MD; Discovery Life Sciences, Huntsville, AL; Prec | Full Paper |
2023 | Ding, H;Yao, B;Ci, L;Feng, J;Ouyang, P;Chen, G;Hui, X;Zhou, D; | Enhancing the Anti-tumor Potency of a Novel Siglec-15 Antibody by Engineering its Fc-mediated Effector Functions | Journal of immunotherapy (Hagerstown, Md. : 1997) | 37103472 | Total PBMCs (AllCells) from a healthy human donor were resuspended in cell culture media (RPMI1640 + 10% FBS) at a density of 150,000 cells per well in triplicate. Save | Full Paper |
2023 | Ekiciler, A;Chen, WLK;Bo, Y;Pugliano, A;Donzelli, M;Parrott, N;Umehara, K; | Quantitative Cytochrome P450 3A4 Induction Risk Assessment Using Human Hepatocytes Complemented with Pregnane X Receptor-Activating Profiles | Drug metabolism and disposition: the biological fate of chemicals | 36460477 | on 24- or 96-well collagen I-coated plates at 0.6 or 0.06 × 10 6 cells/well, respectively, using high viability cryo-hepatocyte recovery kits (In Vitro ADMET Laboratories, LLC; Save | Full Paper |
2023 | Bell-Glenn, S;Salas, LA;Molinaro, AM;Butler, RA;Christensen, BC;Kelsey, KT;Wiencke, JK;Koestler, DC; | Calculating detection limits and uncertainty of reference-based deconvolution of whole-blood DNA methylation data | Epigenomics | 37337720 | Cells used to isolate the DNA to create the mixtures were purchased from AllCells corporation (CA, USA), StemExpress (CA, USA), and STEMCELL Technologies ( Save | Full Paper |
2023 | Banerjee, P;Diniz, WJS;Rodning, SP;Dyce, PW; | miRNA expression profiles of peripheral white blood cells from beef heifers with varying reproductive potential | Frontiers in genetics | 37234872 | The quality-checked libraries were pooled and sequenced in the NextSeq 500 using the single-end 50 bp chemistry at Discovery Life Sciences (Hudson Alpha Institute of Save;nt Bioanalyzer high-sensitivity DNA assay (Agilent, Santa Clara, CA, United S | Full Paper |
2023 | Lamothe, RC;Storlie, MD;Espinosa, DA;Rudlaff, R;Browne, P;Liu, J;Rivas, A;Devoto, A;Oki, J;Khoubyari, A;Goltsman, DSA;Lin, JL;Butterfield, CN;Brown, CT;Thomas, BC;Cost, GJ; | Novel CRISPR-Associated Gene-Editing Systems Discovered in Metagenomic Samples Enable Efficient and Specific Genome Engineering | The CRISPR journal | 37219969 | oporation, cells were harvested for flow cytometry and genomic DNA extraction as described previously. Primary HSC culture and nucleofection Mobilized peripheral blood CD34+ cells were acquired from AllCells and cultured in StemCell StemSpan SFEM I | Full Paper |
2023 | Alexander, GE;Lin, W;Ortega, FE;Ramaiah, M;Jung, B;Ji, L;Revenkova, E;Shah, P;Croisetiere, C;Berman, JR;Eubank, L;Naik, G;Brooks, J;Mich, A;Shojaee, S;Ronaghi, N;Chawla, H;Hou, X;Liu, Q;Yakym, CAV;Moradi, PW;Halks-Miller, M;Aravanis, AM;Parpart-Li, S;Hunkapiller, N; | Analytical validation of a multi-cancer early detection test with cancer signal origin using a cell-free DNA-based targeted methylation assay | PloS one | 37058491 | Six non-cancer samples were obtained from Discovery Life Sciences (Huntsville, AL; catalog #s 220130 and 220140) and 6 cancer samples were obtained from Save;ncer) across dilution series created by spiking cfDNA from cancer samples into cfDNA deriv | Full Paper |
2023 | Li, X;Le, Y;Seo, JE;Guo, X;Li, Y;Chen, S;Mittelstaedt, RA;Moore, N;Guerrero, S;Sims, A;King, ST;Atrakchi, AH;McGovern, TJ;Davis-Bruno, KL;Keire, DA;Elespuru, RK;Heflich, RH;Mei, N; | Revisiting the mutagenicity and genotoxicity of N-nitroso propranolol in bacterial and human in vitro assays | Regulatory toxicology and pharmacology : RTP | 37210026 | National Center for Toxicological Research, U.S. Food and Drug Administration, Jefferson, AR, 72079, USA. Electronic address: xilin.li@fda.hhs.gov.++National Center for Toxicological Research, U.S. Food and Drug Administration, Jefferson, AR, 72079, | Full Paper |
2023 | Coleman, R; | Metastasis prevention with bone-targeted agents: a complex interaction between the microenvironment and tumour biology | Journal of bone and mineral metabolism | 37162605 | amplification status was blinded and followed pre-specified sample handling and standard operating methodology by a central laboratory (Targos Molecular Pathology, Save | Full Paper |
2023 | Kliver, S;Houck, ML;Perelman, PL;Totikov, A;Tomarovsky, A;Dudchenko, O;Omer, AD;Colaric, Z;Weisz, D;Aiden, EL;Chan, S;Hastie, A;Komissarov, A;Ryder, OA;Graphodatsky, A;Johnson, WE;Maldonado, JE;Pukazhenthi, BS;Marinari, PE;Wildt, DE;Koepfli, KP; | Chromosome-length genome assembly and karyotype of the endangered black-footed ferret (Mustela nigripes) | The Journal of heredity | 37249392 | The black-footed ferret (Mustela nigripes) narrowly avoided extinction to become an oft-cited example of the benefits of intensive management, research, and collaboration Save | Full Paper |
2023 | Martha, L;Nakata, A;Furuya, S;Liu, W;Zhang, X;Mizoi, K;Ogihara, T; | Transporter and metabolic enzyme-mediated intra-enteric circulation of SN-38, an active metabolite of irinotecan: A new concept | Biochemical and biophysical research communications | 37148742 | sages 72-83 were used. Human cryopreserved suspension enterocytes (Lot. HE3072, male, 55 years old, Caucasian) were purchased from In Vitro ADMET Laboratories (MD, USA). All other reagents and solvents were commercial products of special grade | Full Paper |
2023 | He, S;Liu, J;Hu, L;Zhan, Y;Tong, H;Zhu, H;Guo, H;Sun, H;Liu, M; | Design, synthesis, biological evaluation and molecular docking studies of quercetin-linker-H2S donor conjugates for the treatment of diabetes and wound healing | Chemistry & biodiversity | 37329234 | All cell culture materials were obtained from Gibco. HepG2 cells were cryopreserved in our laboratory and used after resuscitation. HUVECs cells were purchased from Shanghai Allcells Co., Ltd | Full Paper |
2023 | Thompson, EN;Carlino, MJ;Scanlon, VM;Grimes, HL;Krause, DS; | Assay optimization for the objective quantification of human multilineage colony-forming units | Experimental hematology | 37271449 | Cells were derived commercially (AllCells, Alameda, CA) or were derived from healthy donors who were already donating cells for allogeneic transplantation provided Save | Full Paper |
2023 | Goda, C;Kolovich, S;Rudich, A;Karunasiri, M;Kulkarni, R;Rajgolikar, G;Neidemire-Colley, L;Singh, S;Sircar, A;Ranganathan, P;Garzon, R;Sehgal, L;Dorrance, AM; | Epidermal growth factor-like 7 is a novel therapeutic target in mantle cell lymphoma | Experimental hematology | 37209901 | Full Paper | |
2023 | Yi, PC;Zhuo, L;Lin, J;Chang, C;Goddard, A;Yoon, OK; | Impact of delayed PBMC processing on functional and genomic assays | Journal of immunological methods | 37353001 | An additional five whole blood samples from healthy adults were sourced from AllCells (Alameda, CA, USA), all of whom provided informed consent, under their IRB- Save | Full Paper |
2023 | Chen, Z;Javed, N;Moore, M;Wu, J;Sun, G;Vinyard, M;Collins, A;Pinello, L;Najm, FJ;Bernstein, BE; | Integrative dissection of gene regulatory elements at base resolution | Cell genomics | 37388913 | us Biologicals Cat#NB100-1800 TAL1 antibody SantaCruz Biotech Cat#sc-393287 Cell lines and primary cells Jurkat cell line, Clone E6.1 ATCC Cat#TIB152, RRID:CVCL_0367 CD4+ T cells AllCells N/A ------------------------- Chemical | Full Paper |
2023 | Kessler, ER;Callihan, E;Hu, J;Eule, C;Srivastava, G;Kemme, DJ;Iruku, P;Rana, V;Moore, J;Schuster, SR;Amirault, M;Flaig, TW;Lam, ET; | A Phase I/II Clinical Trial of Pembrolizumab and Cabozantinib in Metastatic Renal Cell Carcinoma | Cancer research communications | 37377613 | Full Paper | |
2023 | Farabaugh, CS;Doak, S;Roy, S;Elespuru, R; | In vitro micronucleus assay: Method for assessment of nanomaterials using cytochalasin B | Frontiers in toxicology | 37180488 | Urbana?Champaign, Champaign, United States Khaled Habas, University of Bradford, United Kingdom *Correspondence: Rosalie Elespuru, rosalie.elespuru@dls.com † Present address: Rosalie Elespuru, Discovery Life Sciences, Columbia, MD, United States | Full Paper |
2023 | Baro-Sastre, B;Kim, CY;Lin, C;Kongsomboonvech, AK;Tetard, M;Salinas, ND;Tolia, NH;Egan, ES; | Plasmodium falciparum exploits CD44 as a co-receptor for erythrocyte invasion | bioRxiv : the preprint server for biology | 37090581 | Generation of cRBCs was performed essentially as previously described 37. Briefly, bone marrow primary human CD34+ HSPCs (Stem Cell Technologies; AllCells) were cultured in PIMDM composed of Iscove Basal Medium (Sigma) with 4 mM L-Glutamine, 330 µg/m | Full Paper |
2023 | Okano, F;Saito, T;Minamida, Y;Kobayashi, S;Ido, T;Miyauchi, Y;Wasai, U;Akazawa, D;Kume, M;Ishibashi, M;Jiang, K;Aicher, A;Heeschen, C;Yonehara, T; | Identification of Membrane-expressed CAPRIN-1 as a Novel and Universal Cancer Target, and Generation of a Therapeutic Anti-CAPRIN-1 Antibody TRK-950 | Cancer research communications | 37082579 | ng formula based on the Cr-51 dose released from the target cells: The ADCC activity of TRK-950 via human and monkey PBMCs was conducted at Translational Drug Development (TD2). We used human PBMCs (AllCells, catalog no. PB003F) and Cynomolgus Monke | Full Paper |
2023 | Montalban-Bravo, G;Ma, F;Thongon, N;Yang, H;Gomez, IG;Rodriguez-Sevilla, JJ;Adema, V;Wildeman, B;Lockyer, P;Kim, YJ;Tanaka, T;Darbaniyan, F;Pancholy, S;Zhang, G;Al-Atrash, G;Dwyer, K;Takahashi, K;Garcia-Manero, G;Kantarjian, H;Colla, S; | Targeting MCL1-driven anti-apoptotic pathways to overcome hypomethylating agent resistance in RAS -mutated chronic myelomonocytic leukemia | bioRxiv : the preprint server for biology | 37066354 | RAS pathway mutations, which are present in 30% of patients with chronic myelomonocytic leukemia (CMML) at diagnosis, confer a high risk of resistance to and Save | Full Paper |
2023 | Dillon, LW;Higgins, J;Nasif, H;Othus, M;Beppu, L;Smith, TH;Schmidt, E;Valentine, CC;Salk, JJ;Wood, BL;Erba, HP;Radich, JP;Hourigan, CS; | Quantification of measurable residual disease using duplex sequencing in adults with acute myeloid leukemia | medRxiv : the preprint server for health sciences | 37034683 | The presence of measurable residual disease (MRD) is strongly associated with treatment outcomes in acute myeloid leukemia (AML). Despite the correlation with clinical Save | Full Paper |
2023 | Flümann, R;Hansen, J;Pelzer, BW;Nieper, P;Lohmann, T;Kisis, I;Riet, T;Kohlhas, V;Nguyen, PH;Peifer, M;Abedpour, N;Bosco, G;Thomas, RK;Kochanek, M;Knüfer, J;Jonigkeit, L;Beleggia, F;Holzem, A;Büttner, R;Lohneis, P;Meinel, J;Ortmann, M;Persigehl, T;Hallek, M;Calado, DP;Chmielewski, M;Klein, S;Göthert, JR;Chapuy, B;Zevnik, B;Wunderlich, FT;von Tresckow, B;Jachimowicz, RD;Melnick, AM;Reinhardt, HC;Knittel, G; | Distinct Genetically Determined Origins of Myd88/BCL2-Driven Aggressive Lymphoma Rationalize Targeted Therapeutic Intervention Strategies | Blood cancer discovery | 36346827 | Roche, Cofounder and CSO of Targos MP Inc. (until May 2021), Gnothis Inc/Stockholm (Member of Board of Directors and Coowner). D.P. Calado reports other support from Cancer Research UK (CC2078), Wellcome Trust (CC2078), and UK Medical Research Counci | Full Paper |
2023 | Mark W., R;Joanne, W;Mary Jo, K;Melissa E., M;John V., L;Peter, F; | Sleep Disturbances and Chronic Pain as Potential Indicators for Therapeutic Intervention in Subjects with Post-Traumatic Stress Disorder | Journal of Depression and Anxiety Disorders | cruited to an age and gender-matched case-control study (N = 78; control n = 39; PTSD n = 39). Participants were recruited in the US between January and June 2019 by PrecisionMed (California, US) and Discovery Life Sciences (California, US). A compre | Full Paper | |
2023 | Buckley, D;Tew, B;Gooden, G;Salhia, B; | Whole genome bisulfite sequencing of tumor DNA and matching cfDNA in relapsed pediatric cancer | Research Square | from Conversant Bio (Table 1). Twelve additional cfDNA healthy controls from adults were included for model building in cfDNA, detailed below (Conversant Bio). Patients Save | Full Paper | |
2023 | Ridzuan, A;Sebastian, A;Noorazman, A;Kannan, T;Syed, N;Nurul, A; | Interleukin-17A enhances osteogenic differentiation by activating ERK/MAPK in stem cells derived from human exfoliated deciduous teeth | Biomedical Research and Therapy | the participation of the MAPK signaling pathway in SHED osteogenic differentiation. MATERIALS AND METHODS CELL CULTURE AND OSTEOGENIC DIFFERENTIATION IN VITRO The SHED cell line, obtained from ALLCELLS (Alameda, CA, USA), was derived from huma | Full Paper | |
2023 | Pillsbury, C;Dougan, J;Rabe, J;Fonseca, J;Zhou, C;Evans, A;Abukharma, H;Ichoku, O;Gonzalez-Flamenco, G;Park, S;Aljudi, A;DeRyckere, D;Castellino, S;Rafiq, S;Langermann, S;Liu, L;Henry, C;Porter, C; | Siglec-15 promotes evasion of adaptive immunity in B-cell acute lymphoblastic leukemia | Cancer Research Communications | All samples were acquired after written informed consent was provided. Residual, fresh bone marrow aspirate and peripheral blood samples from pediatric B-ALL patients were analyzed for Sig15 expression by flow cytometry under protocol (IRB#96145). Bo | Full Paper | |
2023 | Kessler, E;Callihan, E;Hu, J;Eule, C;Srivastava, G;Kemme, D;Iruku, P;Rana, V;Moore, J;Schuster, S;Amirault, M;Flaig, T;Lam, E; | Data from A Phase I/II Clinical Trial of Pembrolizumab and Cabozantinib in Metastatic Renal Cell Carcinoma | American Association for Cancer Research | PD-L1 testing was performed on archival tumor tissues by Discovery Life Sciences (formerly QualTek Molecular Laboratories) using a previously validated IHC assay for Save | Full Paper | |
2023 | Sharma, P;Zhang, X;Ly, K;Kim, J;Wan, Q;Kim, J;Lou, M;Kain, L;Teyton, L;Winau, F; | Hyperglycosylation of prosaposin in tumor DCs promotes immune escape in cancer | bioRxiv | Dissociated whole tumor samples were purchased from Discovery Life Sciences (USA). Melanoma, myeloid, and CD8 T cells were FACS-sorted as described above. Melanoma cells were ?-irradiated (10,000 rad), and induction of apoptosis was | Full Paper | |
2023 | Tierney, B;Foox, J;Ryon, K;Butler, D;Damle, N;Young, B;Mozsary, C;Babler, K;Yin, X;Carattini, Y;Andrews, D;Solle, N;Kumar, N;Shukla, B;Vidovic, D;Currall, B;Williams, S;Schürer, S;Stevenson, M;Amirali, A;Beaver, C;Kobetz, E;Boone, M;Reding, B;Laine, J;Comerford, S;Lamar, W;Tallon, J;Hirschberg, J;Proszynski, J;Sharkey, M;Church, G;Grills, G;Solo-Gabriele, H;Mason, C; | Geospatially-resolved public-health surveillance via wastewater sequencing | medRxiv | 550 HudsonAlpha Discovery (Huntsville, AL) performed all sequencing library preparation on the 551 generated nucleic acids. The nucleic acid samples underwent Save | Full Paper | |
2023 | Zhang, X;Meng, F;Lyu, W;He, J;Wei, R;Du, Z;Zhang, C;Guan, Y;Huang, X;Lyu, G;Tian, X;Zhang, L;Tao, W; | Histone lactylation antagonizes senescence and skeletal muscle aging via facilitating gene expression reprogramming | bioRxiv | IMR90 cells were purchased from the American Type Culture Collection (ATCC), HUVECs were purchased from AllCells, and MEF cells were isolated from 12.5-14- day-old embryos of C57BL/6 mice | Full Paper | |
2023 | Sorensen, JT; | Classification of a novel subgroup of shared hepatitis B virus core and e antigen epitopes and their antibody reactivity in clinical immunoassay formats | Thesis | Protocols for BSL-2 ELISA are summarized in section 5.3.1. HBV positive samples were all purchased from Discovery Life Sciences Biological Sample Repository | Full Paper | |
2023 | Najia, MA; | Transposable elements and the regulatory logic of hematopoietic differentiation | Thesis | umbilical cord blood cells (AllCells) were thawed from liquid nitrogen storage via CD34+ umbilical cord blood cells (AllCells) were thawed from liquid nitrogen storage and Save | Full Paper | |
2023 | Schejtman Borisonik, A; | Lentiviral gene therapy for p47-deficient Chronic Granulomatous disease | Thesis | CD34+ cells used in the experiments were frozen vials of previously isolated HD CD34+ cells from a G-CSF mobilised apheresis (ALLCells) using the CliniMACS prodigy | Full Paper | |
2023 | Kortchak, S; | Development of Programmed Cell Death Ligand Derived Peptides for the Treatment of Autoimmune Diseases | Thesis | Cell Culture. Jurkat NFAT-PD-1 reporter cells (BPS Biosciences, San Diego, CA) were maintained in Growth Medium 2A (BPS Biosciences, San Diego, CA) medium. Peripheral blood mononuclear cells (PBMCs) were purchased from AllCells and maintained in RPMI | Full Paper | |
2023 | Maughon Jr, TS; | Metabolic Profiling of Mesenchymal Stromal Cells for Critical Quality Attribute Identification | Thesis | at three densities (10,000, 5,000 and 2,000 cells/well) in a 96 well plate and cultured for 24 hours. PBMCs (AllCells, Alameda CA) were thawed in Roswell Park Memorial Institute (RPMI) media (RPMI, 20% FBS, 2mM L-glutamine, 50 U/mL penicillin, 50 ?g/ | Full Paper | |
2023 | Han, L;Dong, L;Leung, K;Zhao, Z;Li, Y;Gao, L;Chen, Z;Xue, J;Qing, Y;Li, W;Pokharel, SP;Gao, M;Chen, M;Shen, C;Tan, B;Small, A;Wang, K;Zhang, Z;Qin, X;Yang, L;Wunderlich, M;Zhang, B;Mulloy, JC;Marcucci, G;Chen, CW;Wei, M;Su, R;Chen, J;Deng, X; | METTL16 drives leukemogenesis and leukemia stem cell self-renewal by reprogramming BCAA metabolism | Cell stem cell | 36608679 | ColonyGEL-Mouse Base Medium Reachbio Cat# 1201 ColonyGEL -Human Base Medium Reachbio Cat# 1101 | Full Paper |
2023 | Le Floc'h, A;Nagashima, K;Birchard, D;Scott, G;Ben, LH;Ajithdoss, D;Gayvert, K;Romero Hernandez, A;Herbin, O;Tay, A;Farrales, P;Korgaonkar, CK;Pan, H;Shah, S;Kamat, V;Chatterjee, I;Popke, J;Oyejide, A;Lim, WK;Kim, JH;Huang, T;Franklin, M;Olson, W;Norton, T;Perlee, L;Yancopoulos, GD;Murphy, AJ;Sleeman, MA;Orengo, JM; | Blocking common γ chain cytokine signaling ameliorates T cell-mediated pathogenesis in disease models | Science translational medicine | 36630481 | To induce GVHD, we injected immunodeficient NSG (Jackson Laboratory, 005557) female mice (8 weeks old) retro-orbitally with 10 7 human PBMCs (ReachBio, 0500-401). Mice were Save | Full Paper |
2023 | Wang, H;Georgakopoulou, A;Zhang, W;Kim, J;Gil, S;Ehrhardt, A;Lieber, A; | HDAd6/35++ - A new helper-dependent adenovirus vector platform for in vivo transduction of hematopoietic stem cells | Molecular therapy. Methods & clinical development | 37081854 | Lineage-negative (Lin-) cells were isolated by depletion of lineage-committed cells in BM MNCs using the mouse lineage cell depletion kit (Miltenyi Biotec) according to the manufacturer’s instructions. Colony-forming unit assays were performed using | Full Paper |
2023 | Belcher, JD;Nataraja, S;Abdulla, F;Zhang, P;Chen, C;Nguyen, J;Ruan, C;Singh, M;Demes, S;Olson, L;Stickens, D;Stanwix, J;Clarke, E;Huang, Y;Biddle, M;Vercellotti, GM; | The BACH1 inhibitor ASP8731 inhibits inflammation and vaso-occlusion and induces fetal hemoglobin in sickle cell disease | Frontiers in medicine | 37144034 | Department of Medicine, Division of Hematology, Oncology and Transplantation, University of Minnesota, Minneapolis, MN, United States.++Mitobridge Inc., Cambridge, MA, United States.++Department of Medicine, Division of Hematology, Oncology and Trans | Full Paper |
2023 | Wu, T;Pelus, LM;Plett, PA;Sampson, CH;Chua, HL;Fisher, A;Feng, H;Liu, L;Li, H;Ortiz, M;Chittajallu, S;Luo, Q;Bhatwadekar, AD;Meyer, TB;Zhang, X;Zhou, D;Fischer, KD;McKinzie, DL;Miller, SJ;Orschell, CM; | Further Characterization of Multi-Organ DEARE and Protection by 16,16 Dimethyl Prostaglandin E2 in a Mouse Model of the Hematopoietic Acute Radiation Syndrome | Radiation research | 37014943 | Total nucleated BM cells from non-irradiated mice were plated at 2 × 104 per dish in ColonyGEL 1202 Mouse Complete Medium (Reach Bio, Seattle, WA) | Full Paper |
2023 | Borot, F;Humbert, O;Newby, GA;Fields, E;Kohli, S;Radtke, S;Laszlo, GS;Mayuranathan, T;Ali, AM;Weiss, MJ;Yen, JS;Walter, RB;Liu, DR;Mukherjee, S;Kiem, HP; | Multiplex Base Editing to Protect from CD33-Directed Therapy: Implications for Immune and Gene Therapy | bioRxiv : the preprint server for biology | 36865281 | Cord blood CD34+ 526 cells were 527 additionally cultured with UM171 0.35 nM (Xcessbio). In colony-forming cell assays, 1000-1200 528 sorted cells were seeded into 3.5 ml ColonyGEL 1402 (ReachBio) | Full Paper |
2023 | Vujovic, A;de Rooij, L;Chahi, AK;Chen, HT;Yee, BA;Loganathan, SK;Liu, L;Chan, DCH;Tajik, A;Tsao, E;Moreira, S;Joshi, P;Xu, J;Wong, N;Balde, Z;Jahangiri, S;Zandi, S;Aigner, S;Dick, JE;Minden, MD;Schramek, D;Yeo, GW;Hope, KJ; | In Vivo Screening Unveils Pervasive RNA-Binding Protein Dependencies in Leukemic Stem Cells and Identifies ELAVL1 as a Therapeutic Target | Blood cancer discovery | 36763002 | Thawed primary AML samples were counted and plated in a methylcellulose-based hematopoietic colony formation medium (Colony Gel, ReachBio cat. no. 1102), supplemented with 1.1 μmol/L DHTS (MilliporeSigma; cat. no. D0947-10MG) or equivalent DMSO (Fish | Full Paper |
2023 | Zhang, Z;Zhou, K;Han, L;Small, A;Xue, J;Huang, H;Weng, H;Su, R;Tan, B;Shen, C;Li, W;Zhao, Z;Qing, Y;Qin, X;Wang, K;Leung, K;Boldin, M;Chen, C;Ann, D;Qian, Z;Deng, X;Chen, J;Chen, Z; | RNA m6A reader YTHDF2 facilitates precursor miR-126 maturation to promote acute myeloid leukemia progression | Genes & Diseases | ColonyGel 1201-mouse base medium (1201, Reachbio) were used for seeding cells at 20, 000 per 35 mm dish. Murine cytokines and reagents were supplemented as follows: 10 ng/ Save | Full Paper | |
2023 | Davies, J;Prieto, EM;Guelcher, S; | Characterization of Macrophage Behavior in the Human Immunoresponse and Bone Remodeling | cdn.vanderbilt.edu | We cultured primary human monocytes (Reachbio, Seattle, WA) in Corning T25 flasks with 10 mL of modified Dulbecco’s modified Eagle medium (DMEM) media and split them every 9 days. We changed media on Day 1, 5, and 7, according to Table 1. Penicillin | Full Paper | |
2023 | Vujovic, A; | Investigating RNA-Binding Protein Dependencies in Hematopoietic and Acute Myeloid Leukemic Stem Cells | Thesis | Thawed primary AML samples were counted and plated in a methylcellulose-based hematopoietic colony formation medium (Colony Gel, ReachBio Cat# 1102), supplemented with 1.1μM DHTS (MilliporeSigma Cat# D0947-10MG) or equivalent DMSO (Fisher Scientific | Full Paper | |
2022 | Somarathna, M;Hwang, PT;Millican, RC;Alexander, GC;Isayeva-Waldrop, T;Sherwood, JA;Brott, BC;Falzon, I;Northrup, H;Shiu, YT;Stubben, CJ;Totenhagen, J;Jun, HW;Lee, T; | Nitric oxide releasing nanomatrix gel treatment inhibits venous intimal hyperplasia and improves vascular remodeling in a rodent arteriovenous fistula | Biomaterials | 34836683 | RNA isolation and sequencing were performed by Discovery Life Sciences (Huntsville, AL). Total RNA was isolated using standard Discovery Life Sciences protocols. All samples underwent RNA quality control assessment using a Fragment Analyzer (Agilen | Full Paper |
2022 | Choi, DY;Park, JN;Paek, SH;Choi, SC;Paek, SH; | Detecting early-stage malignant melanoma using a calcium switch-enriched exosome subpopulation containing tumor markers as a sample | Biosensors & bioelectronics | 34847362 | Clinical samples of human sera from healthy donors and malignant melanoma patients were obtained from Discovery Life Sciences (DLS; Los Osos, CA, USA). Other materials are listed and described about the sources in details in Supplementary Informati | Full Paper |
2022 | Bormann Chung, C;Lee, J;Barritault, M;Bringuier, PP;Xu, Z;Huang, WY;Beharry, A;Castillo, J;Christiansen, J;Lin, JC;Sheffield, BS; | Evaluating Targeted Next-Generation Sequencing Assays and Reference Materials for NTRK Fusion Detection | The Journal of molecular diagnostics : JMD | 34656759 | The 30 FFPE NTRK fusion-negative tumor samples (confirmed as NTRK fusion negative by an NGS laboratory-developed test) tested in the specificity analyses for AFL, TSO500, and OFA were purchased from Indivumed GmbH (Hamburg, Germany) and Discovery Lif | Full Paper |
2022 | Freeman, J;Conklin, J; | Standardization of two SARS-CoV-2 serology assays to the WHO 20/136 human standard reference material | Journal of virological methods | 34915088 | WHO 20/136 is standard reference material for SARS-CoV-2 serology assays. Standardization of serology assays that target the same antigen and class of immunoglobulin will enable comparison of results between studies that use various lab-developed a | Full Paper |
2022 | Ganan-Gomez, I;Yang, H;Ma, F;Montalban-Bravo, G;Thongon, N;Marchica, V;Richard-Carpentier, G;Chien, K;Manyam, G;Wang, F;Alfonso, A;Chen, S;Class, C;Kanagal-Shamanna, R;Ingram, JP;Ogoti, Y;Rose, A;Loghavi, S;Lockyer, P;Cambo, B;Muftuoglu, M;Schneider, S;Adema, V;McLellan, M;Garza, J;Marchesini, M;Giuliani, N;Pellegrini, M;Wang, J;Walker, J;Li, Z;Takahashi, K;Leverson, JD;Bueso-Ramos, C;Andreeff, M;Clise-Dwyer, K;Garcia-Manero, G;Colla, S; | Stem cell architecture drives myelodysplastic syndrome progression and predicts response to venetoclax-based therapy | Nature medicine | 35241842 | simultaneously received the cytidine deaminase inhibitor E7727 (cedazuridine) to increase HMA bioavailability. BM samples from 21 HDs (median age, 53 years; range, 49-66 years) were obtained from AllCells or from MD Anderson’s Department of Stem Cel | Full Paper |
2022 | Lebedin, M;Foglierini, M;Khorkova, S;Vázquez García, C;Ratswohl, C;Davydov, AN;Turchaninova, MA;Daubenberger, C;Chudakov, DM;Lanzavecchia, A;de la Rosa, K; | Different classes of genomic inserts contribute to human antibody diversity | Proceedings of the National Academy of Sciences of the United States of America | 36037353 | 42), and ethical review boards at Ifakara Health Institute and the University of Lausanne, and all volunteers provided informed consent before blood donation. Bone marrow specimens were obtained from AllCells. Extraction of Human PBMCs. Blood sample | Full Paper |
2022 | Simmons, SK;Lithwick-Yanai, G;Adiconis, X;Oberstrass, F;Iremadze, N;Geiger-Schuller, K;Thakore, PI;Frangieh, CJ;Barad, O;Almogy, G;Rozenblatt-Rosen, O;Regev, A;Lipson, D;Levin, JZ; | Mostly natural sequencing-by-synthesis for scRNA-seq using Ultima sequencing | Nature biotechnology | 36109685 | We purchased nine cryopreserved human PMBC samples (AllCells). We thawed PBMC vials in a 37 °C water bath for ~2 min. A quick counting revealed high viability (90%) in all samples. We added 1 ml RPMI1640 (Thermo Fisher Scientific, 11875093) with 10% | Full Paper |
2022 | Shy, BR;Vykunta, VS;Ha, A;Talbot, A;Roth, TL;Nguyen, DN;Pfeifer, WG;Chen, YY;Blaeschke, F;Shifrut, E;Vedova, S;Mamedov, MR;Chung, JJ;Li, H;Yu, R;Wu, D;Wolf, J;Martin, TG;Castro, CE;Ye, L;Esensten, JH;Eyquem, J;Marson, A; | High-yield genome engineering in primary cells using a hybrid ssDNA repair template and small-molecule cocktails | Nature biotechnology | 36008610 | Primary adult blood cells were obtained from healthy human donors as a leukapheresis pack purchased from StemCell Technologies, Inc. or Allcells Inc, as a Trima residual from Vitalant, or from fresh whole blood under a protocol approved by the UCSF C | Full Paper |
2022 | Zhang, B;Srivastava, A;Mimitou, E;Stuart, T;Raimondi, I;Hao, Y;Smibert, P;Satija, R; | Characterizing cellular heterogeneity in chromatin state with scCUT&Tag-pro | Nature biotechnology | 35332340 | available on the protocols.io platform, here: https://www.protocols.io/private/57E45A034D5311ECA43B0A58A9FEAC02. PBMC acquisition and processing Cryopreserved healthy donor PBMCs were purchased from AllCells. After thawing into DMEM with 10% FBS, th | Full Paper |
2022 | Fiskin, E;Lareau, CA;Ludwig, LS;Eraslan, G;Liu, F;Ring, AM;Xavier, RJ;Regev, A; | Single-cell profiling of proteins and chromatin accessibility using PHAGE-ATAC | Nature biotechnology | 34675424 | Thermo Fisher Scientific), resuspended in DMEM containing 10% FBS, centrifuged, washed with PBS and resuspended in FC buffer (above). For PBMC and CD8 T-cell experiments, cryopreserved PBMCs or CD8 T cells (AllCells) were thawed, washed in PBS and re | Full Paper |
2022 | Omer-Javed, A;Pedrazzani, G;Albano, L;Ghaus, S;Latroche, C;Manzi, M;Ferrari, S;Fiumara, M;Jacob, A;Vavassori, V;Nonis, A;Canarutto, D;Naldini, L; | Mobilization-based chemotherapy-free engraftment of gene-edited human hematopoietic stem cells | Cell | 35617958 | V4XP-3032 TaqMan Gene Expression Assay ThermoFisher Scientifi Cat# 4331182 ------------------------- Experimental models: Cell lines ------------------------- Human: G-CSF mPB CD34+ HSPCs AllCells N/A Human: G-CSF/Mozobil mPB CD34+ HS | Full Paper |
2022 | Battaglia, S;Dong, K;Wu, J;Chen, Z;Najm, FJ;Zhang, Y;Moore, MM;Hecht, V;Shoresh, N;Bernstein, BE; | Long-range phasing of dynamic, tissue-specific and allele-specific regulatory elements | Nature genetics | 36195755 | Epigenomic maps identify gene regulatory elements by their chromatin state. However, prevailing short-read sequencing methods cannot effectively distinguish alleles, evaluate the Save | Full Paper |
2022 | Bottomly, D;Long, N;Schultz, AR;Kurtz, SE;Tognon, CE;Johnson, K;Abel, M;Agarwal, A;Avaylon, S;Benton, E;Blucher, A;Borate, U;Braun, TP;Brown, J;Bryant, J;Burke, R;Carlos, A;Chang, BH;Cho, HJ;Christy, S;Coblentz, C;Cohen, AM;d'Almeida, A;Cook, R;Danilov, A;Dao, KT;Degnin, M;Dibb, J;Eide, CA;English, I;Hagler, S;Harrelson, H;Henson, R;Ho, H;Joshi, SK;Junio, B;Kaempf, A;Kosaka, Y;Laderas, T;Lawhead, M;Lee, H;Leonard, JT;Lin, C;Lind, EF;Liu, SQ;Lo, P;Loriaux, MM;Luty, S;Maxson, JE;Macey, T;Martinez, J;Minnier, J;Monteblanco, A;Mori, M;Morrow, Q;Nelson, D;Ramsdill, J;Rofelty, A;Rogers, A;Romine, KA;Ryabinin, P;Saultz, JN;Sampson, DA;Savage, SL;Schuff, R;Searles, R;Smith, RL;Spurgeon, SE;Sweeney, T;Swords, RT;Thapa, A;Thiel-Klare, K;Traer, E;Wagner, J;Wilmot, B;Wolf, J;Wu, G;Yates, A;Zhang, H;Cogle, CR;Collins, RH;Deininger, MW;Hourigan, CS;Jordan, CT;Lin, TL;Martinez, ME;Pallapati, RR;Pollyea, DA;Pomicter, AD;Watts, JM;Weir, SJ;Druker, BJ;McWeeney, SK;Tyner, JW; | Integrative analysis of drug response and clinical outcome in acute myeloid leukemia | Cancer cell | 35868306 | Acute myeloid leukemia (AML) is a cancer of myeloid-lineage cells with limited therapeutic options. We previously combined ex vivo drug sensitivity with genomic, transcriptomic, and Save | Full Paper |
2022 | Ma, H;Guo, Y;Tang, H;Tseng, CK;Wang, L;Zong, H;Wang, Z;He, Y;Chang, Y;Wang, S;Huang, H;Ke, Y;Yuan, Y;Wu, M;Zhang, Y;Drelich, A;Kempaiah, KR;Peng, BH;Wang, A;Yang, K;Yin, H;Liu, J;Yue, Y;Xu, W;Zhu, S;Ji, T;Zhang, X;Wang, Z;Li, G;Liu, G;Song, J;Mu, L;Xiang, Z;Song, Z;Chen, H;Bian, Y;Zhang, B;Chen, H;Zhang, J;Liao, Y;Zhang, L;Yang, L;Chen, Y;Gilly, J;Xiao, X;Han, L;Jiang, H;Xie, Y;Zhou, Q;Zhu, J; | Broad ultra-potent neutralization of SARS-CoV-2 variants by monoclonal antibodies specific to the tip of RBD | Cell discovery | 35169121 | In ADCP experiment, CD14 + monocytes (Allcells) were cultured and differentiated for 7 days to obtain macrophage cells. Macrophages were labeled with violet dye (ThermoFisher), Save | Full Paper |
2022 | Ferrari, S;Jacob, A;Cesana, D;Laugel, M;Beretta, S;Varesi, A;Unali, G;Conti, A;Canarutto, D;Albano, L;Calabria, A;Vavassori, V;Cipriani, C;Castiello, MC;Esposito, S;Brombin, C;Cugnata, F;Adjali, O;Ayuso, E;Merelli, I;Villa, A;Di Micco, R;Kajaste-Rudnitski, A;Montini, E;Penaud-Budloo, M;Naldini, L; | Choice of template delivery mitigates the genotoxic risk and adverse impact of editing in human hematopoietic stem cells | Cell stem cell | 36206730 | tain Kit Thermo Fisher Cat# L34957 7-aminoactinomycin D Sigma Aldrich SML1633; CAS: 7240-37-1 ------------------------- Biological samples ------------------------- Mobilized Leukopak AllCells N/A ------------------------- Chemica | Full Paper |
2022 | Chan, S;Belmar, N;Ho, S;Rogers, B;Stickler, M;Graham, M;Lee, E;Tran, N;Zhang, D;Gupta, P;Sho, M;MacDonough, T;Woolley, A;Kim, H;Zhang, H;Liu, W;Zheng, P;Dezso, Z;Halliwill, K;Ceccarelli, M;Rhodes, S;Thakur, A;Forsyth, CM;Xiong, M;Tan, SS;Iyer, R;Lake, M;Digiammarino, E;Zhou, L;Bigelow, L;Longenecker, K;Judge, RA;Liu, C;Trumble, M;Remis, JP;Fox, M;Cairns, B;Akamatsu, Y;Hollenbaugh, D;Harding, F;Alvarez, HM; | An anti-PD-1-GITR-L bispecific agonist induces GITR clustering-mediated T cell activation for cancer immunotherapy | Nature cancer | 35256819 | Human allogeneic PBMCs (AllCells) were used to purify negatively selected populations of T cells (catalog no. 19051, Stemcell) and CD11b monocytes (catalog no. 19058, Stemcell). Save | Full Paper |
2022 | Dey, M;Kim, M;Dogan, M;Nagamine, M;Kozhaya, L;Celik, N;Unutmaz, D;Ozbolat, I; | Chemotherapeutics and CAR‐T Cell‐Based Immunotherapeutics Screening on a 3D Bioprinted Vascularized Breast Tumor Model | Advanced Functional Materials | Leukopaks from healthy adults were purchased from ALLCells (Alameda, CA) in deidentified form and processed to isolate Peripheral Blood Mononuclear Cells (PBMCs) using Ficoll-paque plus (GE Healthcare). CD8+ T cells were purified from PBMCs using Dyn | Full Paper | |
2022 | Elagib, KE;Brock, A;Clementelli, CM;Mosoyan, G;Delehanty, LL;Sahu, RK;Pacheco-Benichou, A;Fruit, C;Besson, T;Morris, SW;Eto, K;Jobaliya, C;French, DL;Gadue, P;Singh, S;Shi, X;Qin, F;Cornelison, R;Li, H;Iancu-Rubin, C;Goldfarb, AN; | Relieving DYRK1A repression of MKL1 confers an adult-like phenotype to human infantile megakaryocytes | The Journal of clinical investigation | 35925681 | alculator/hypergeometric.aspx). A P value less than 0.05 was considered significant. Study approval. CD34+ cells purchased from the Fred Hutchinson Cancer Research Center (Seattle, Washington, USA), AllCells (Alameda, California, USA), and StemCell | Full Paper |
2022 | Brady, JM;Phelps, M;MacDonald, SW;Lam, EC;Nitido, A;Parsons, D;Boutros, CL;Deal, CE;Garcia-Beltran, WF;Tanno, S;Natarajan, H;Ackerman, ME;Vrbanac, VD;Balazs, AB; | Antibody-mediated prevention of vaginal HIV transmission is dictated by IgG subclass in humanized mice | Science translational medicine | 35895834 | To generate huPBMC-engrafted NSG mice, frozen huPBMCs (AllCells) were thawed and expanded in RPMI 1640 medium (Sigma-Aldrich) supplemented with 10% fetal bovine serum ( Save | Full Paper |
2022 | Jennings, D;Huntwork-Rodriguez, S;Henry, AG;Sasaki, JC;Meisner, R;Diaz, D;Solanoy, H;Wang, X;Negrou, E;Bondar, VV;Ghosh, R;Maloney, MT;Propson, NE;Zhu, Y;Maciuca, RD;Harris, L;Kay, A;LeWitt, P;King, TA;Kern, D;Ellenbogen, A;Goodman, I;Siderowf, A;Aldred, J;Omidvar, O;Masoud, ST;Davis, SS;Arguello, A;Estrada, AA;de Vicente, J;Sweeney, ZK;Astarita, G;Borin, MT;Wong, BK;Wong, H;Nguyen, H;Scearce-Levie, K;Ho, C;Troyer, MD; | Preclinical and clinical evaluation of the LRRK2 inhibitor DNL201 for Parkinson's disease | Science translational medicine | 35675433 | 2017 {study IDs: SAN-BB-01 [approved by Quorum Review independent review board (IRB)], PLMDEN201609v1 (approved by New England IRB), and US-IRB-13-2016.1 (approved by E&I Review Services)}. PBMCs from two donors for pS935 LRRK2 and pT73 Rab10 dose-re | Full Paper |
2022 | Barreyro, L;Sampson, AM;Ishikawa, C;Hueneman, KM;Choi, K;Pujato, MA;Chutipongtanate, S;Wyder, M;Haffey, WD;O'Brien, E;Wunderlich, M;Ramesh, V;Kolb, EM;Meydan, C;Neelamraju, Y;Bolanos, LC;Christie, S;Smith, MA;Niederkorn, M;Muto, T;Kesari, S;Garrett-Bakelman, FE;Bartholdy, B;Will, B;Weirauch, MT;Mulloy, JC;Gul, Z;Medlin, S;Kovall, RA;Melnick, AM;Perentesis, JP;Greis, KD;Nurmemmedov, E;Seibel, WL;Starczynowski, DT; | Blocking UBE2N abrogates oncogenic immune signaling in acute myeloid leukemia | Science translational medicine | 35263148 | BM samples directly from patients and sequenced. Healthy BM specimens were obtained from ALLCells Inc. Human CD34+ umbilical cord blood and adult BM-derived mononuclear cells were obtained from the Translational Research Development Support Laborator | Full Paper |
2022 | Sandberg, ML;Wang, X;Martin, AD;Nampe, DP;Gabrelow, GB;Li, CZ;McElvain, ME;Lee, WH;Shafaattalab, S;Martire, S;Fisher, FA;Ando, Y;Liu, E;Ju, D;Wong, LM;Xu, H;Kamb, A; | A carcinoembryonic antigen-specific cell therapy selectively targets tumor cells with HLA loss of heterozygosity in vitro and in vivo | Science translational medicine | 35235342 | Informed consent for primary T cells and donor collection protocols were approved by an Institutional Review Board at AllCells or HemaCare. Peripheral blood mononuclear cells (PBMCs) were purified from Leukopaks purchased from AllCells or HemaCare, a | Full Paper |
2022 | Uehara, K;Harumoto, T;Makino, A;Koda, Y;Iwano, J;Suzuki, Y;Tanigawa, M;Iwai, H;Asano, K;Kurihara, K;Hamaguchi, A;Kodaira, H;Atsumi, T;Yamada, Y;Tomizuka, K; | Targeted delivery to macrophages and dendritic cells by chemically modified mannose ligand-conjugated siRNA | Nucleic acids research | 35524566 | are). Preparation of human monocyte-derived macrophages and DCs Two types of human monocyte-derived macrophages (h-Mo-Mφs) were generated as described in Supplementary Figure S1A. CD14+ monocytes (AllCells, Alameda, CA, USA) were cultured (37°C, 5% | Full Paper |
2022 | Pennycuick, A;Selway, H;Lam, J;Khan, K; | 331P Predicting outcomes following colorectal cancer resection: Using real-world data to empower adjuvant treatment decision making | Annals of Oncology | : Financial Interests, Personal, Invited Speaker: Novartis; Financial Interests, Personal, Advisory Board: MSD Oncology, Bayer; Financial Interests, Personal, Other, Consultant: Targos Molecular Pathology GmbH. A. Vivancos: Financial Interests, Perso | Full Paper | |
2022 | Glaser, M;von Levetzow, C;Michels, S;Nogova, L;Katzenmeier, M;Wömpner, C;Schmitz, J;Bitter, E;Terjung, I;Passmann, E;Schaufler, D;Eisert, A;Fischer, R;Riedel, R;Weber, J;Hahne, S;Merkelbach-Bruse, S;Büttner, R;Wolf, J;Scheffler, M; | 1729P The biological effect of small-scale ROS1 aberrations: An in silico analysis | Annals of Oncology | MS. R. Riedel: Financial Interests, Personal, Funding: Boehringer Ingelheim, Loxo Oncology, Novartis, Lilly. J. Weber: Financial Interests, Personal, Advisory Board: Lilly. R. Büttner: Financial Interests, Personal, Ownership Interest: Targos Molecul | Full Paper | |
2022 | Poole, A;Karuppiah, V;Hartt, A;Haidar, JN;Moureau, S;Dobrzycki, T;Hayes, C;Rowley, C;Dias, J;Harper, S;Barnbrook, K;Hock, M;Coles, C;Yang, W;Aleksic, M;Lin, AB;Robinson, R;Dukes, JD;Liddy, N;Van der Kamp, M;Plowman, GD;Vuidepot, A;Cole, DK;Whale, AD;Chillakuri, C; | Therapeutic high affinity T cell receptor targeting a KRASG12D cancer neoantigen | Nature communications | 36088370 | ersberg, Germany). PBMCs were either purchased cryo-frozen from commercial suppliers (Cellular Technology Limited (CTL), OH & Tissue Solutions, Glasgow, UK) or prepared from healthy donor leukopaks (ALLCELLS, CA) by Ficoll density gradient centrifug | Full Paper |
2022 | Sano, Y;Azuma, Y;Tsunenari, T;Kayukawa, Y;Shinozuka, J;Fujii, E;Amano, J;Nishito, Y;Maruyama, T;Kinoshita, Y;Sakamoto, Y;Yoshida, A;Miyazaki, Y;Sato, Y;Teramoto-Seida, C;Ishiguro, T;Tanaka, T;Kitazawa, T;Endo, M; | Combination of T cell-redirecting bispecific antibody ERY974 and chemotherapy reciprocally enhances efficacy against non-inflamed tumours | Nature communications | 36071036 | (Tokyo, Japan). After an acclimatisation of 3 weeks, mice were irradiated (2.5 Gy; MBR-1520R-3; Hitachi Power Solutions Co. Ltd., Ibaraki, Japan) 1 day before transplantation of human CD34+ cells (AllCells, Alameda, CA, USA) via intravenous injection | Full Paper |
2022 | Badrani, JH;Strohm, AN;Lacasa, L;Civello, B;Cavagnero, K;Haung, YA;Amadeo, M;Naji, LH;Lund, SJ;Leng, A;Kim, H;Baum, RE;Khorram, N;Mondal, M;Seumois, G;Pilotte, J;Vanderklish, PW;McGee, HM;Doherty, TA; | RNA-binding protein RBM3 intrinsically suppresses lung innate lymphoid cell activation and inflammation partially through CysLT1R | Nature communications | 35908044 | &D Systems, Minneapolis, MN) in T cell media. Post-stimulation supernatant was collected and stored at −80 C for ELISA analysis. Human PBMCs were isolated from commercially purchased leukopacks (Allcells, Alameda, CA, USA). Human peripheral blood IL | Full Paper |
2022 | Li, F;Zhang, H;Wang, W;Yang, P;Huang, Y;Zhang, J;Yan, Y;Wang, Y;Ding, X;Liang, J;Qi, X;Li, M;Han, P;Zhang, X;Wang, X;Cao, J;Fu, YX;Yang, X; | T cell receptor β-chain-targeting chimeric antigen receptor T cells against T cell malignancies | Nature communications | 35882880 | ded by Dr. Justin Kline (University of Chicago). B16-OVA cells were kindly provided by Dr. Hans Schreiber (University of Chicago). Human peripheral blood mononuclear cells (PBMCs) were purchased from Allcells Biotechnology, Limited (Shanghai, China) | Full Paper |
2022 | Jo, S;Das, S;Williams, A;Chretien, AS;Pagliardini, T;Le Roy, A;Fernandez, JP;Le Clerre, D;Jahangiri, B;Chion-Sotinel, I;Rozlan, S;Dessez, E;Gouble, A;Dusséaux, M;Galetto, R;Duclert, A;Marcenaro, E;Devillier, R;Olive, D;Duchateau, P;Poirot, L;Valton, J; | Endowing universal CAR T-cell with immune-evasive properties using TALEN-gene editing | Nature communications | 35773273 | cell products and to allow their large-scale utilization against multiple malignancies for the benefit of a broader range of patients. Methods Materials Cryopreserved human PBMCs were acquired from ALLCELLS (cat# PB006F). PBMCs were cultured in CTS | Full Paper |
2022 | Cai, T;Gouble, A;Black, KL;Skwarska, A;Naqvi, AS;Taylor, D;Zhao, M;Yuan, Q;Sugita, M;Zhang, Q;Galetto, R;Filipe, S;Cavazos, A;Han, L;Kuruvilla, V;Ma, H;Weng, C;Liu, CG;Liu, X;Konoplev, S;Gu, J;Tang, G;Su, X;Al-Atrash, G;Ciurea, S;Neelapu, SS;Lane, AA;Kantarjian, H;Guzman, ML;Pemmaraju, N;Smith, J;Thomas-Tikhonenko, A;Konopleva, M; | Targeting CD123 in blastic plasmacytoid dendritic cell neoplasm using allogeneic anti-CD123 CAR T cells | Nature communications | 35484100 | The production of R&D grade batches of UCART123 was done using commercially available NHPBMC cells ordered from ALLCELLS or HEMACARE. These are normal human Save | Full Paper |
2022 | Salas, LA;Zhang, Z;Koestler, DC;Butler, RA;Hansen, HM;Molinaro, AM;Wiencke, JK;Kelsey, KT;Christensen, BC; | Enhanced cell deconvolution of peripheral blood using DNA methylation for high-resolution immune profiling | Nature communications | 35140201 | lymphocytes memory (CD4mem), T regulatory cells (Treg), T-cytotoxic lymphocytes naïve (CD8nv), T-cytotoxic lymphocytes memory (CD8mem), and natural killer lymphocytes (NK) cells] were purchased from AllCells corporation (Alameda, CA, USA), StemExpre | Full Paper |
2022 | Wiesweg, M;Hense, J;Darwiche, K;Michels, S;Hautzel, H;Kobe, C;Metzenmacher, M;Herold, T;Zaun, G;Laue, K;Drzezga, A;Schildhaus, H;Wolf, J;Herrmann, K;Schuler, M; | 1171P A phase II theranostic study with osimertinib in patients with EGFR-mutated non-small cell lung cancer (NSCLC) progressing on EGFR tyrosine kinase inhibitors (TKI) and undetectable EGFR T790M (THEROS) | Annals of Oncology | ovartis Oncology; Financial Interests, Personal, Full or part-time Employment: Targos Molecular Pathology, Inc. J. Wolf: Financial Interests, Personal, Advisory Board: Amgen, AstraZeneca, Bayer, Blueprint, BMS, Boehringer Ingelheim, Chugai, Daiichi S | Full Paper | |
2022 | Chansaenroj, A;Adine, C;Charoenlappanit, S;Roytrakul, S;Sariya, L;Osathanon, T;Rungarunlert, S;Urkasemsin, G;Chaisuparat, R;Yodmuang, S;Souza, GR;Ferreira, JN; | Magnetic bioassembly platforms towards the generation of extracellular vesicles from human salivary gland functional organoids for epithelial repair | Bioactive materials | 35387159 | d EV; and (3) to identify novel signaling cues in EV that may optimize organoid development towards epithelial SG repair. 2 Materials and methods 2.1 Adult stem cell culture hDPSC were obtained from AllCells (Alameda, CA, USA) and cultured in Dulbec | Full Paper |
2022 | Kavanagh, ME;Horning, BD;Khattri, R;Roy, N;Lu, JP;Whitby, LR;Ye, E;Brannon, JC;Parker, A;Chick, JM;Eissler, CL;Wong, AJ;Rodriguez, JL;Rodiles, S;Masuda, K;Teijaro, JR;Simon, GM;Patricelli, MP;Cravatt, BF; | Selective inhibitors of JAK1 targeting an isoform-restricted allosteric cysteine | Nature chemical biology | 36097295 | In vitro TE50 values for JAK1_C817 and TYK2_C838 were obtained by treating 500 µg cell lysate generated from primary human PBMCs (AllCells), Jurkat T cells (ATCC, #TIB-152), or MDA-MB-468 breast cancer cells (ATCC, #HTB-132), with DMSO or compound fo | Full Paper |
2022 | Lam, J;Lee, B;Yu, J;Kwee, BJ;Kim, Y;Kim, J;Choi, Y;Yoon, JS;Kim, Y;Baek, K;Jeon, NL;Sung, KE; | A microphysiological system-based potency bioassay for the functional quality assessment of mesenchymal stromal cells targeting vasculogenesis | Biomaterials | 36201944 | Human bone marrow-derived MSCs were obtained from eight different donors purchased from RoosterBio (RB9, RB12, RB14, RB16; Frederick, MD) at passage 1 (P1), Lonza (8F560, 167,696; Walkersville, MD) at passage 2 (P2), and AllCells (PCBM1632, PCBM1641; | Full Paper |
2022 | Han, C;Khodadadi-Jamayran, A;Lorch, AH;Jin, Q;Serafin, V;Zhu, P;Politanska, Y;Sun, L;Gutierrez-Diaz, BT;Pryzhkova, MV;Abdala-Valencia, H;Bartom, ET;Buldini, B;Basso, G;Velu, SE;Sarma, K;Mattamana, BB;Cho, BK;Obeng, RC;Goo, YA;Jordan, PW;Tsirigos, A;Zhou, Y;Ntziachristos, P; | SF3B1 homeostasis is critical for survival and therapeutic response in T cell leukemia | Science advances | 35061527 | ing PCR to detect the TCRb-NOTCH1 translocation (TCRBJ2S4CUTLL1F: 5′-GGACCCGGCTCTCAGTGCT-3′, NOTCH1CUTTL1R: 5′-TCCCGCCCTCCAAAATAAGG-3′). Human CD3+, CD8+, and CD4+ T cells were purchased from AllCells.com (Alameda, CA) or from Astarte Biologics (Both | Full Paper |
2022 | Pan, Z;Chen, J;Xiao, X;Xie, Y;Jiang, H;Zhang, B;Lu, H;Yuan, Y;Han, L;Zhou, Y;Zong, H;Wang, L;Sun, R;Zhu, J; | Characterization of a novel bispecific antibody targeting tissue factor-positive tumors with T cell engagement | Acta pharmaceutica Sinica. B | 35847491 | for the T cell activation test were bought from AllCells (Shanghai, China). PBMC used in other experiments were isolated from leukocyte concentrate (AllCells) using Ficoll-Paque PLUS ( Save;nded conditions and used within 2 months after resuscitatio | Full Paper |
2022 | Hu, J;Zhong, Y;Shang, X; | A versatile and scalable single-cell data integration algorithm based on domain-adversarial and variational approximation | Briefings in bioinformatics | 34585247 | Integration of two modal of multimodal data on human PBMCs of a healthy female donor aged 25 that were obtained by 10x Genomics from AllCells. UMAP visualization on integrated Save | Full Paper |
2022 | Peng, S;Hu, P;Xiao, YT;Lu, W;Guo, D;Hu, S;Xie, J;Wang, M;Yu, W;Yang, J;Chen, H;Zhang, X;Zhu, Y;Wang, Y;Yang, Y;Zhu, G;Chen, S;Wang, J;Zhang, B;Chen, W;Wu, H;Sun, Z;Ding, T;Zhang, H;Yi, Z;Liu, M;Ren, S; | Single-Cell Analysis Reveals EP4 as a Target for Restoring T-Cell Infiltration and Sensitizing Prostate Cancer to Immunotherapy | Clinical cancer research : an official journal of the American Association for Cancer Research | 34740924 | Purpose: Immunotherapies targeting immune checkpoint molecules have shown promising treatment for a subset of cancers; however, many "cold" tumors, such as prostate cancer, Save | Full Paper |
2022 | Siegel, RJ;Singh, AK;Panipinto, PM;Shaikh, FS;Vinh, J;Han, SU;Kenney, HM;Schwarz, EM;Crowson, CS;Khuder, SA;Khuder, BS;Fox, DA;Ahmed, S; | Extracellular sulfatase-2 is overexpressed in rheumatoid arthritis and mediates the TNF-?-induced inflammatory activation of synovial fibroblasts | Cellular & molecular immunology | 36068294 | Human serum samples were purchased from commercial vendors (Discovery Life Sciences, Newtown, PA; Innovative Research, Novi, MI; or Sanguine Biosciences, Los Angeles, CA) or generously shared by Dr. Cynthia Crowson (Mayo Clinic, Rochester, MN) | Full Paper |
2022 | Gyurdieva, A;Zajic, S;Chang, YF;Houseman, EA;Zhong, S;Kim, J;Nathenson, M;Faitg, T;Woessner, M;Turner, DC;Hasan, AN;Glod, J;Kaplan, RN;D'Angelo, SP;Araujo, DM;Chow, WA;Druta, M;Demetri, GD;Van Tine, BA;Grupp, SA;Fine, GD;Eleftheriadou, I; | Biomarker correlates with response to NY-ESO-1 TCR T cells in patients with synovial sarcoma | Nature communications | 36075914 | s were digitally obtained using CaseViewer (3D Histech, Budapest, Hungary). Protein expression by IHC NY-ESO-1 staining was performed using the E978 clone (Sigma, Catalog #: N2038, at 1??g/mL) at QualTek Laboratory (Goleta, CA; now part of Discovery | Full Paper |
2022 | Ni, Z;Sun, P;Zheng, J;Wu, M;Yang, C;Cheng, M;Yin, M;Cui, C;Wang, G;Yuan, L;Gao, Q;Li, Y; | JNK Signaling Promotes Bladder Cancer Immune Escape by Regulating METTL3-Mediated m6A Modification of PD-L1 mRNA | Cancer research | 35502544 | CD8+ T cells (catalog no. PB009-3F-C) were obtained from AllCells (Shanghai) and cultured in ImmunoCult-XF T Cell Expansion Medium (STEMCELL Technologies, catalog no. 10981). Seventy-two hours after activation with ImmunoCult Human CD3/CD28/CD2 T Cel | Full Paper |
2022 | Ge, X;Yost, SE;Lee, JS;Frankel, PH;Ruel, C;Cui, Y;Murga, M;Tang, A;Martinez, N;Chung, S;Yeon, C;Stewart, D;Li, D;Rajurkar, S;Somlo, G;Mortimer, J;Waisman, J;Yuan, Y; | Phase II Study Combining Pembrolizumab with Aromatase Inhibitor in Patients with Metastatic Hormone Receptor Positive Breast Cancer | Cancers | 36077811 | mal TILs were measured by hematoxylin and eosin (H&E) staining of formalin-fixed paraffin-embedded (FFPE) tumor biopsies according to the International TIL Work Group guideline [16]. PD-L1 analysis: QualTek Molecular Laboratory (Goleta, CA, USA) per | Full Paper |
2022 | Shirk, B;Shirk, P;Furlong, R;Scully, E;Wu, K;Siegfried, B; | Gene Editing of the ABC Transporter/White Locus Using Crispr/Cas9-Mediated Mutagenesis in the Indian Meal Moth | SSRN Electronic Journal | y and sequencing, and Kris Hartzer for laboratory assistance. Library 497 preparation and sequencing were performed at HudsonAlpha Genomic Services Lab 498 (Huntsville, AL). We also thank Karen Garren for her work to isolate the P. interpunctella 499 | Full Paper | |
2022 | Kanter, J;Thompson, AA;Pierciey, FJ;Hsieh, M;Uchida, N;Leboulch, P;Schmidt, M;Bonner, M;Guo, R;Miller, A;Ribeil, JA;Davidson, D;Asmal, M;Walters, MC;Tisdale, JF; | Lovo-cel gene therapy for sickle cell disease: Treatment process evolution and outcomes in the initial groups of the HGB-206 study | American journal of hematology | 36161320 | MCW served as medical director for AllCells and as a consultant for AllCells, Ensoma, Vertex, and BioLabs. The remaining authors declare no competing financial interests. Save | Full Paper |
2022 | Wei, Y;Kanagal-Shamanna, R;Zheng, H;Bao, N;Lockyer, PP;Class, CA;Darbaniyan, F;Lu, Y;Lin, K;Yang, H;Montalban-Bravo, G;Ganan-Gomez, I;Soltysiak, KA;Do, KA;Colla, S;Garcia-Manero, G; | Cooperation between KDM6B overexpression and TET2 deficiency in the pathogenesis of chronic myelomonocytic leukemia | Leukemia | 35697791 | Materials and methods Human samples BM specimens were obtained from the MD Anderson Cancer Center tissue bank following institutional guidelines. BM samples from healthy individuals were obtained from AllCells (Emeryville, CA) | Full Paper |
2022 | Lu, M;Xia, L;Elmansy, N;Clementelli, C;Tremblay, D;Hoffman, R; | Combined Drug Targeting of p53-dependent and -independent Pathways Depletes Myelofibrosis Hematopoietic Stem/Progenitor Cells | Leukemia | 34642468 | met the World Health Organization criteria for the diagnosis of MF [41, 42]. Patient characteristics are provided in Supplemental Table 1. Normal donor (ND) human bone marrow (BM) was purchased from AllCells (Emeryville, CA). The experiments in which | Full Paper |
2022 | Bae, J;Accardi, F;Hideshima, T;Tai, YT;Prabhala, R;Shambley, A;Wen, K;Rowell, S;Richardson, PG;Munshi, NC;Anderson, KC; | Targeting LAG3/GAL-3 to overcome immunosuppression and enhance anti-tumor immune responses in multiple myeloma | Leukemia | 34290359 | roval by the Institutional Review Board at Dana-Farber Cancer Institute (Boston, MA). In addition, healthy individuals BM [N = 5] or leukapheresis [N = 12] products were purchased from either AllCells (Alameda, CA) or the Blood Donor Center at Boston | Full Paper |
2022 | Huang, G;Cheng, Z;Hildebrand, A;Wang, C;Cimini, M;Roy, R;Lucchese, AM;Benedict, C;Mallaredy, V;Magadum, A;Joladarashi, D;Thej, C;Gonzalez, C;Trungcao, M;Garikipati, VNS;Elrod, JW;Koch, WJ;Kishore, R; | Diabetes impairs cardioprotective function of endothelial progenitor cell-derived extracellular vesicles via H3K9Ac inhibition | Theranostics | 35673580 | days, db/+ EPCs were cultured at 37°C, 5% CO2 atmosphere. Male mice were used to avoid the reproductive hormone effect in female mice. Human CD34+ Hematopoietic stem cells (HSC) were purchased from AllCells, LLC and were cultured in a human hematopoi | Full Paper |
2022 | Shen, Y;Eng, JS;Fajardo, F;Liang, L;Li, C;Collins, P;Tedesco, D;Nolan-Stevaux, O; | Cancer cell-intrinsic resistance to BiTE therapy is mediated by loss of CD58 costimulation and modulation of the extrinsic apoptotic pathway | Journal for immunotherapy of cancer | 35296559 | Target cells were cocultured with freshly thawed human CD3 + T cells (ALLCELLS) and increasing concentrations of TCEs. Assay conditions were effector-to-target ratio (E:T)=2:1 and Save | Full Paper |
2022 | Froning, KJ;Sereno, A;Huang, F;Demarest, SJ; | Generalizable design parameters for soluble T cell receptor-based T cell engagers | Journal for immunotherapy of cancer | 35260435 | ously11 with minor modifications throughout the protocol. Saos-2 and HCT-116 cells were cultured as described earlier. Primary naïve T cells were from StemExpress (cat#PB03020C, Donor#D001003581) or AllCells (cat# PB009-1F, Lt# 3009286). For the assa | Full Paper |
2022 | Wu, ZH;Li, N;Mei, XF;Chen, J;Wang, XZ;Guo, TT;Chen, G;Nie, L;Chen, Y;Jiang, MZ;Wang, JT;Wang, HB; | Preclinical characterization of the novel anti-SIRPα antibody BR105 that targets the myeloid immune checkpoint | Journal for immunotherapy of cancer | 35256517 | Allogeneic PBMCs (AllCells) from different donors were added at a dendritic cell:PBMCs ratio of 1:20. Indicated mAbs were added at a concentration of 10 µg/mL immediately, and the Save | Full Paper |
2022 | Lee, KM;Lin, CC;Servetto, A;Bae, J;Kandagatla, V;Ye, D;Kim, G;Sudhan, DR;Mendiratta, S;González Ericsson, PI;Balko, JM;Lee, J;Barnes, S;Malladi, VS;Tabrizi, S;Reddy, SM;Yum, S;Chang, CW;Hutchinson, KE;Yost, SE;Yuan, Y;Chen, ZJ;Fu, YX;Hanker, AB;Arteaga, CL; | Epigenetic Repression of STING by MYC Promotes Immune Evasion and Resistance to Immune Checkpoint Inhibitors in Triple-Negative Breast Cancer | Cancer immunology research | 35561311 | After a week, 1 A 107 human PBMCs (hPBMC; ALLCELLS) were injected intravenously. Two weeks later, SUM159PT tumors were harvested for analysis of tumor-infiltrating immune Save | Full Paper |
2022 | Li, W;Yang, S;Xu, P;Zhang, D;Tong, Y;Chen, L;Jia, B;Li, A;Lian, C;Ru, D;Zhang, B;Liu, M;Chen, C;Fu, W;Yuan, S;Gu, C;Wang, L;Li, W;Liang, Y;Yang, Z;Ren, X;Wang, S;Zhang, X;Song, Y;Xie, Y;Lu, H;Xu, J;Wang, H;Yu, W; | SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network | EBioMedicine | 35124429 | Human umbilical vein endothelial cells (HUVEC) were cultured in the commercial culture medium (AllCells, Cat# H-004). VERO C1008 (E6) (Cat# GNO17) and its culture medium MEM Save;ed with 10% FBS (Gibco, Cat# 10270-106) and 1% Penicillin-Streptomyci | Full Paper |
2022 | Zhang, C;Chen, Z;Liu, J;Wu, M;Yang, J;Zhu, Y;Lu, W;Ruan, C; | 3D-printed pre-tapped-hole scaffolds facilitate one-step surgery of predictable alveolar bone augmentation and simultaneous dental implantation | Composites Part B: Engineering | The human bone marrow mesenchymal stem cells (hBMSCs, obtained from Allcells, Silicon Valley, CA) were cultured in α-MEM (Gibco, USA) supplemented with 1% penicillin-streptomycin (Gibco, USA) and 10% fetal bovine serum (FBS) (Gibco, USA) in an atmosp | Full Paper | |
2022 | Petaroudi, M;Rodrigo-Navarro, A;Dobre, O;Dalby, MJ;Salmeron-Sanchez, M; | Living Biomaterials to Engineer Hematopoietic Stem Cell Niches | Advanced healthcare materials | 35933595 | Fresh, cryopreserved bone marrow CD34+ cells isolated from the posterior iliac crest of healthy and consenting donors were purchased from AllCells. All cultures containing CD34+ Save | Full Paper |
2022 | Suyama, T;Takemoto, Y;Miyauchi, H;Kato, Y;Matsuzaki, Y;Kato, R; | Morphology-based noninvasive early prediction of serial-passage potency enhances the selection of clone-derived high-potency cell bank from mesenchymal stem cells | Inflammation and regeneration | 36182958 | Bone marrow mononuclear cells were prepared from bone marrow aspirate (AllCells, Alameda, USA) collected from healthy donors using density gradient centrifugation with Ficoll (GE Save Cached | Full Paper |
2022 | Wang, J;Jiang, J;Yang, X;Zhou, G;Wang, L;Xiao, B; | Tethering Piezo channels to the actin cytoskeleton for mechanogating via the cadherin-β-catenin mechanotransduction complex | Cell reports | 35139384 | Experimental models: Cell lines HEK293T Xiao et al., 2011 N/A MDCK Xu Tan Lab in Tsinghua University N/A HUVEC Purchased from Allcells N/A | Full Paper |
2022 | Sun, Y;Wang, T;Lv, Y;Li, J;Jiang, X;Jiang, J;Zhang, D;Bian, W;Zhang, C; | MALAT1 promotes platelet activity and thrombus formation through PI3k/Akt/GSK-3β signalling pathway | Stroke and vascular neurology | 36241224 | Allcells Biotechnology (Shanghai, China) was the supplier of the Cord Blood-Stem/Progenitor (CD34+) cells that were used in this study. Serum-free expansion medium (StemCell Technologies, Canada) was used in the cultivation of CD34+ cells. To facilit | Full Paper |
2022 | Manshouri, T;Veletic, I;Li, P;Yin, CC;Post, SM;Verstovsek, S;Estrov, Z; | GLI1 activates pro-fibrotic pathways in myelofibrosis fibrocytes | Cell death & disease | 35595725 | ld Health Organization revised criteria [1]. Control BM biopsies were obtained from morphologically normal BM donors and control BM aspirates were obtained from commercially available healthy donors (AllCells, Alameda, CA, USA). The patients’ and con | Full Paper |
2022 | Zhang, J;Liu, F;Yang, Y;Yu, N;Weng, X;Yang, Y;Gong, Z;Huang, S;Gan, L;Sun, S;Zhang, X;Gong, Y;Liu, Y;Guo, W; | Integrated DNA and RNA sequencing reveals early drivers involved in metastasis of gastric cancer | Cell death & disease | 35449126 | ze the results using the positive control contained in the different membranes. T-cell amplification and tumor-reactive T cell killing assay Peripheral blood mononuclear cells (PBMCs) purchased from AllCells (China) were activated with anti-CD3 anti | Full Paper |
2022 | Liu, P;Zhang, Q;Mi, J;Wang, S;Xu, Q;Zhuang, D;Chen, W;Liu, C;Zhang, L;Guo, J;Wu, X; | Exosomes derived from stem cells of human deciduous exfoliated teeth inhibit angiogenesis in vivo and in vitro via the transfer of miR-100-5p and miR-1246 | Stem cell research & therapy | 35241153 | Human umbilical vein endothelial cells (HUVECs) were purchased from AllCells (Cat. H-001F, AllCells) and were cultured in DMEM (Cat. SH30021.01, Hyclone) with 4.5 g/L D-Glucose Save | Full Paper |
2022 | McLemore, AF;Hou, HA;Meyer, BS;Lam, NB;Ward, GA;Aldrich, AL;Rodrigues, MA;Vedder, A;Zhang, L;Padron, E;Vincelette, ND;Sallman, DA;Abdel-Wahab, O;List, AF;McGraw, KL; | Somatic gene mutations expose cytoplasmic DNA to co-opt the cGAS/STING/NLRP3 axis in myelodysplastic syndromes | JCI insight | 35788117 | using Ficoll-Paque (GE Healthcare) from patients with MDS and healthy donors who provided informed consent at the Moffitt Cancer Center or NTUH or were purchased from AllCells. Save Cached | Full Paper |
2022 | Xie, J;Gui, X;Deng, M;Chen, H;Chen, Y;Liu, X;Ku, Z;Tan, L;Huang, R;He, Y;Zhang, B;Lewis, C;Chen, K;Xu, L;Xu, J;Huang, T;Liao, XC;Zhang, N;An, Z;Zhang, CC; | Blocking LAIR1 signaling in immune cells inhibits tumor development | Frontiers in immunology | 36211388 | Human allogeneic pan T cells (PB009-1F, Allcells) were stained with Carboxy fluorescein succinimidyl ester (CFSE) (C34554, Thermo Fisher Scientific), and mixed with 3 x10 5 mature Save | Full Paper |
2022 | Hu, JF;Wang, ZW;Liao, CY;Chen, ZW;Kang, FP;Lin, CF;Lin, TS;Huang, L;Tian, YF;Chen, S; | Induced expression of CCL19 promotes the anti-tumor ability of CAR-T cells by increasing their infiltration ability | Frontiers in immunology | 35990619 | (CRL-1682, ATCC) cells were obtained from ATCC and cultured in RPMI-1640 medium (cat. no. 11875093; Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. Human T cells were obtained from Allcells (cat. no. PB009-CD3-F). Both of the cells | Full Paper |
2022 | Bjornson-Hooper, ZB;Fragiadakis, GK;Spitzer, MH;Chen, H;Madhireddy, D;Hu, K;Lundsten, K;McIlwain, DR;Nolan, GP; | A Comprehensive Atlas of Immunological Differences Between Humans, Mice, and Non-Human Primates | Frontiers in immunology | 35359965 | apeutics between humans and model organisms will greatly improve the evaluation of therapeutic candidates. Materials and Methods Blood Venous human blood was obtained from the Stanford Blood Center, AllCells Inc. (Alameda, CA) (exempt, non-human sub | Full Paper |
2022 | Peng, H;Nerreter, T;Mestermann, K;Wachter, J;Chang, J;Hudecek, M;Rader, C; | ROR1-targeting switchable CAR-T cells for cancer therapy | Oncogene | 35859167 | Pan-T cells were isolated from fresh PBMC of healthy donors (Allcells) by negative selection (Pan T Cell Isolation Kit; Miltenyi Biotec), activated using Dynabeads Human T-Activator Save | Full Paper |
2022 | Zhang, M;Zhu, Y;Zhu, J;Xie, Y;Wu, R;Zhong, J;Qiu, Z;Jiang, L; | circ_0086296 induced atherosclerotic lesions via the IFIT1/STAT1 feedback loop by sponging miR-576-3p | Cellular & molecular biology letters | 36138395 | HUVECs were obtained from AllCells (Shanghai, China) as previously reported [7, 33]. HUVECs were seeded in EC complete growth medium at 37 C. Then, 100 μg/mL ox-LDL was Save Cached | Full Paper |
2022 | Abdul-Aziz, A;Weigel, C;Kovacs, A;Wu, Y;Byrd, J;Hertlein, E;Oakes, C; | P381: DNA METHYLATION PROFILING OF MESENCHYMAL STROMAL CELLS ISOLATED FROM FEMURAL HEAD BONE MARROW VERSUS BONE MARROW ASPIRATES: RELEVANCE FOR AML STUDY BASED CONTROLS | HemaSphere | Aspirate-derived BMSCs (n= 7) were expanded from bone marrow mononuclear cells obtained from a commercial source (AllCells). For genome-wide DNA methylation analyses, the Save | Full Paper | |
2022 | Owens, TD;Brameld, KA;Verner, EJ;Ton, T;Li, X;Zhu, J;Masjedizadeh, MR;Bradshaw, JM;Hill, RJ;Tam, D;Bisconte, A;Kim, EO;Francesco, M;Xing, Y;Shu, J;Karr, D;LaStant, J;Finkle, D;Loewenstein, N;Haberstock-Debic, H;Taylor, MJ;Nunn, P;Langrish, CL;Goldstein, DM; | Discovery of Reversible Covalent Bruton's Tyrosine Kinase Inhibitors PRN473 and PRN1008 (Rilzabrutinib) | Journal of medicinal chemistry | 35302767 | The ability of selected compounds to block BCR-driven activation of B cells was assessed by expression of the CD69 surface marker, as previously described. (37) Briefly, HWB (AllCells, Alameda, CA, USA) pretreated for 1 h with serial dilutions of tes | Full Paper |
2022 | Zheng, L;Wang, H;Zuo, P;Liu, Y;Xu, H;Ye, BC; | Rapid On-Chip Isolation of Cancer-Associated Exosomes and Combined Analysis of Exosomes and Exosomal Proteins | Analytical chemistry | 35575685 | The biotin-labeled rabbit antihuman CD63 antibody (anti-CD63) was purchased from AllCells Biotech Co., Ltd. (Shanghai, China). The horseradish peroxidase (HRP)-conjugated secondary antibody, rabbit anti-human CD9 polyclonal antibody, and bicinchonini | Full Paper |
2022 | Avanzino, BC;Prabhakar, K;Dalvi, P;Hartstein, S;Kehm, H;Balasubramani, A;Boudreau, AA;Buelow, B;Chang, K;Davison, LM;Iyer, S;Kalwit, V;Lewis Wilson, K;Malik-Chaudhry, HK;Pierson, W;Pineda, G;Rangaswamy, US;Saiganesh, S;Schellenberger, U;Ugamraj, HS;Yabut, RD;Buelow, R;Chapman, J;Trinklein, ND;Harris, KE; | A T-cell engaging bispecific antibody with a tumor-selective bivalent folate receptor alpha binding arm for the treatment of ovarian cancer | Oncoimmunology | 36016696 | In a similar follow-on study, NCG mice were injected with activated human PBMCs (AllCells). Prior to injection, PBMCs were activated for 3 d with 1 µg/mL plate-coated anti-CD3 ( Save | Full Paper |
2022 | Xue, W;Zhang, Q;Chen, Y;Zhu, Y; | Hydrogen Sulfide Improves Angiogenesis by Regulating the Transcription of pri-miR-126 in Diabetic Endothelial Cells | Cells | 36078059 | The HUVECs from passages 4 to 7 were used in the experiment and were cultured in endothelial completed medium (ALLCELLS, Shanghai, China) at 37 C in 5% CO 2 . The HUVECs Save Cached | Full Paper |
2022 | Sharma, M;Bellio, MA;Benny, M;Kulandavelu, S;Chen, P;Janjindamai, C;Han, C;Chang, L;Sterling, S;Williams, K;Damianos, A;Batlahally, S;Kelly, K;Aguilar-Caballero, D;Zambrano, R;Chen, S;Huang, J;Wu, S;Hare, JM;Schmidt, A;Khan, A;Young, K; | Mesenchymal Stem Cell-derived Extracellular Vesicles Prevent Experimental Bronchopulmonary Dysplasia Complicated By Pulmonary Hypertension | Stem cells translational medicine | 35758326 | es, and isotype control was performed on P2 WJ-MSC to confirm the MSC identity. BM-MSC Production BM-MSCs were isolated from fresh adult bone marrow aspirates, and obtained from a commercial source (AllCells, Alameda, CA). Briefly, bone marrow was p | Full Paper |
2022 | Ohori-Morita, Y;Niibe, K;Limraksasin, P;Nattasit, P;Miao, X;Yamada, M;Mabuchi, Y;Matsuzaki, Y;Egusa, H; | Novel Mesenchymal Stem Cell Spheroids with Enhanced Stem Cell Characteristics and Bone Regeneration Ability | Stem cells translational medicine | 35267026 | heir therapeutic potential in bone regeneration. Materials and Methods BM-MSC Adherent Culture Human BM-MSCs of an 18-year-old male (donor 1; Lonza, Basel, Switzerland), a 22-year-old male (donor 2; AllCells, Alameda, CA, USA), and a 24-year-old mal | Full Paper |
2022 | Stratmann, S;Yones, SA;Garbulowski, M;Sun, J;Skaftason, A;Mayrhofer, M;Norgren, N;Herlin, MK;Sundström, C;Eriksson, A;Höglund, M;Palle, J;Abrahamsson, J;Jahnukainen, K;Munthe-Kaas, MC;Zeller, B;Tamm, KP;Cavelier, L;Komorowski, J;Holmfeldt, L; | Transcriptomic analysis reveals proinflammatory signatures associated with acute myeloid leukemia progression | Blood advances | 34619772 | children (Table 1). Detailed biological characteristics and supporting clinical information are reported in supplemental Tables 2 and 3. CD34-expressing bone marrow (BM) cells from 5 healthy donors (AllCells Inc., Alameda, CA) were used as normal con | Full Paper |
2022 | Jeon, E;Choi, D;Choi, S;Won, J;Jo, Y;Kim, H;Jung, Y;Shin, S;Min, H;Choi, H;Lee, M;Park, Y;Chung, J;Jin, H; | Enhancing adoptive T‐cell therapy with fucoidan‐based IL ‐2 delivery microcapsules | Bioengineering & Translational Medicine | Cryopreserved human peripheral blood mononuclear cells (PBMC) were purchased from AllCells (Emeryvill, CA). Total CD3+T cells were isolated by negative selection with a magnetic isolation kit and CD4+T, CD8+T, and regulatory T (Treg) cells were then | Full Paper | |
2022 | Lun, Y;Zhou, Y;Li, Q;Chen, P;Huang, Y;Ye, G; | Preparation and characterization of a magnetic microsphere synthesized from sucrose allyl ether for transcatheter arterial embolization | Materials Today Chemistry | Human umbilical vein endothelial cells (HUVECs, AllCells, US) were subcultured in a low glucose Dulbecco's modified eagle medium containing 10% fetal bovine serum and 1% penicillin/streptomycin (100 U·mL−1) in an atmosphere of 310.15 K and 5% CO2 | Full Paper | |
2022 | Lu, W;Zhou, C;Ma, Y;Li, J;Jiang, J;Chen, Y;Dong, L;He, F; | Improved osseointegration of strontium-modified titanium implants by regulating angiogenesis and macrophage polarization | Biomaterials science | 35384947 | HUVECs together with complete and basal medium were purchased from Allcells Bio (Shanghai, China). The murine macrophage cell lines (Raw264.7) were obtained from the Save | Full Paper |
2022 | Zhou, Y;Li, XH;Xue, WL;Jin, S;Li, MY;Zhang, CC;Yu, B;Zhu, L;Liang, K;Chen, Y;Tao, BB;Zhu, YZ;Wang, MJ;Zhu, YC; | YB-1 Recruits Drosha to Promote Splicing of pri-miR-192 to Mediate the Proangiogenic Effects of H2S | Antioxidants & redox signaling | 35044231 | HUVECs were purchased from Allcells (Shanghai, China) and cultured in endothelial basal medium (EBM; Allcells, Shanghai, China) supplemented with hydrocortisone, bovine brain Save | Full Paper |
2022 | Li, J;Hong, T;Wei, Y;Guo, L;Lee, M;Yang, H;Class, C;Yang, Y;Wang, X;He, H;Siwko, S;You, MJ;Zhou, Y;Garcia-Manero, G;Huang, Y; | Aberrant DNA hydroxymethylation reshapes transcription factor binding in myeloid neoplasms | Clinical epigenetics | 35765052 | BM samples from healthy individuals were obtained from AllCells (Emeryville, CA). BM mononuclear cells were isolated using a Ficoll-Paque density gradient media (GE, Sweden). Save Cached | Full Paper |
2022 | Fang, J;Li, R;Zhang, Y;Oduro, PK;Li, S;Leng, L;Wang, Z;Rao, Y;Niu, L;Wu, HH;Wang, Q; | Aristolone in Nardostachys jatamansi DC. induces mesenteric vasodilation and ameliorates hypertension via activation of the KATP channel and PDK1-Akt-eNOS pathway | Phytomedicine : international journal of phytotherapy and phytopharmacology | 35738117 | Human umbilical vein endothelial cells (HUVECs) were obtained from AllCells Biotech Co. Ltd. (Shanghai, China) and cultured in Endothelial Cell Medium (ECM; AllCells Biotech Co. Ltd., Shanghai, China) with 10% fetal bovine serum, 1% endothelial growt | Full Paper |
2022 | Liang, W;Chen, J;Zheng, H;Lin, A;Li, J;Wu, W;Jie, Q; | MiR-199a-5p-containing macrophage-derived extracellular vesicles inhibit SMARCA4 and alleviate atherosclerosis by reducing endothelial cell pyroptosis | Cell biology and toxicology | 35930100 | Human monocyte-derived macrophages (hMDMs, PB-MDM-001F, AllCells) were purchased from Milestone Biotechnologies (Shanghai, China). The hMDMs were cultured at 37 °C in RPMI1640 medium (supplemented with 10% FBS and 1% penicillin/streptomycin) with 5% | Full Paper |
2022 | Wang, J;Li, C;He, K;Kuang, Z;Lu, J;Yao, Y;He, F;Li, N;Li, L;Fu, F;Wu, Z;Zhou, S;Kang, D;Qiu, X;Wu, M;Liu, Y;Cao, X;Xu, M;Chen, B;Wu, W;Guo, F; | Characterization of anti-CD79b/CD3 bispecific antibody, a potential therapy for B cell malignancies | Cancer immunology, immunotherapy : CII | 35963895 | Materials and methods Reagents IBI38D9 and human IgG1 were produced by Innovent Biologics Co., Ltd. (Suzhou, China). Human IgG was purchased from Equitech-Bio. Peripheral blood mononuclear cells (PBMCs) were purchased from the AllCells | Full Paper |
2022 | Ni, H;Cao, L;Wu, Z;Wang, L;Zhou, S;Guo, X;Gao, Y;Jing, H;Wu, M;Liu, Y;Ding, J;Zhang, P;Zhou, Y;Chen, B;Xiong, Y;Sun, J;Prinz, B;Baruah, H;Geoghegan, J;Yu, M;Wu, W;Liu, J; | Combined strategies for effective cancer immunotherapy with a novel anti-CD47 monoclonal antibody | Cancer immunology, immunotherapy : CII | 34165607 | CD14+ monocytes were isolated from peripheral blood mononuclear cells (PBMCs, Allcells) and then differentiated into macrophages following incubation for 7 days with granulocyte- Save | Full Paper |
2022 | Wu, ZH;Li, N;Gao, ZZ;Chen, G;Nie, L;Zhou, YQ;Jiang, MZ;Chen, Y;Chen, J;Mei, XF;Hu, F;Wang, HB; | Development of the Novel Bifunctional Fusion Protein BR102 That Simultaneously Targets PD-L1 and TGF-β for Anticancer Immunotherapy | Cancers | 36230887 | IgG1 isotype control was expressed by Biointron Biological (Taizhou, China). 2.2. Cell Lines and Cell Culture Dendritic cells (DCs) and peripheral blood mononuclear cells (PBMCs) were purchased from AllCells (Shanghai, China). TF-1 cells were from t | Full Paper |
2022 | Wang, X;Chen, G;Nie, L;Wu, Z;Wang, X;Pan, C;Chen, X;Zhao, X;Zhu, J;He, Q;Wang, H; | IL-2K35C-moFA, a Long-Acting Engineered Cytokine with Decreased Interleukin 2 Receptor α Binding, Improved the Cellular Selectivity Profile and Antitumor Efficacy in a Mouse Tumor Model | Cancers | 36230665 | Next, 100 μL CellTiter-Glo (G7572, Promega Corporation, Madison, WI, USA) was added; luminescence was recorded suing a Spectramax M5. 2.8. p-STAT5 Assay in Treg and CD8+ T Cell Tregs (PB009-4F-2, Allcells, Shanghai, China) at a density of 1 × 106 c | Full Paper |
2022 | Sekhri, P;Ledezma, DK;Shukla, A;Sweeney, EE;Fernandes, R; | The Thermal Dose of Photothermal Therapy Generates Differential Immunogenicity in Human Neuroblastoma Cells | Cancers | 35326601 | Healthy donor peripheral blood leukopaks were purchased from AllCells (Alameda, CA, USA) along with the HLA report. Peripheral blood mononuclear cells (PBMCs) were isolated by Save | Full Paper |
2022 | Ning, K;Roy, A;Cheng, F;Xu, P;Kleiboeker, S;Escalante, CR;Wang, J;Qiu, J; | High-Throughput Screening Identifies Inhibitors for Parvovirus B19 Infection of Human Erythroid Progenitors | Journal of virology | 34669461 | Primary human CD34+ hematopoietic stem cells (HSCs), which were isolated from the bone marrow of a healthy human donor, were purchased from AllCells LLC (Alameda, CA). B19V-containing plasma samples were obtained from ViraCor Eurofins Laboratories (L | Full Paper |
2022 | Liu, Y;Tsang, K;Mays, M;Hansen, G;Chiecko, J;Crames, M;Wei, Y;Zhou, W;Fredrick, C;Hu, J;Liu, D;Gebhard, D;Huang, ZF;Datar, A;Kronkaitis, A;Gueneva-Boucheva, K;Seeliger, D;Han, F;Sen, S;Kasturirangan, S;Scheer, JM;Nixon, AE;Panavas, T;Marlow, MS;Kumar, S; | An adapted consensus protein design strategy for identifying globally optimal biotherapeutics | mAbs | 35613320 | isolated from human peripheral blood mononuclear cells (PBMCs) using a negative selection kit (EasySep). PBMCs were isolated from Leukopak collected from healthy volunteers, which were obtained from ALLcells. Redirected T-cell cytotoxicity was assaye | Full Paper |
2022 | Zhao, J;Jiang, L;Yang, H;Deng, L;Meng, X;Ding, J;Yang, S;Zhao, L;Xu, W;Wang, X;Zhu, Z;Huang, H; | A strategy for the efficient construction of anti-PD1-based bispecific antibodies with desired IgG-like properties | mAbs | 35239451 | #F9512) at 4°C for 1 h. Cells were washed three times and then analyzed on the CytoFLEX Cytometer System (Beckman Coulter). Allogeneic mixed lymphocyte reaction Monocytes were enriched from PBMCs (AllCells, Cat# PB002-C-300) by adherence on tissue c | Full Paper |
2022 | McGuire, BE;Mela, JE;Thompson, VC;Cucksey, LR;Stevens, CE;McWhinnie, RL;Winkler, DFH;Pelech, S;Nano, FE; | Escherichia coli recombinant expression of SARS-CoV-2 protein fragments | Microbial cell factories | 35123472 | mall number of serum or plasma samples from positive tested donors and all pre-COVID-19 samples were acquired by purchase (Precision for Medicine, Norton, MA, USA; Innovative Research, Novi, MI, USA; AllCells, Alameda, CA, USA) or by donation (CureIm | Full Paper |
2022 | Li, G;Reid, KM;Spitler, K;Beatty, N;Boucher, J;Davila, ML; | CD3 engagement as a new strategy for allogeneic "off-the-shelf" T cell therapy | Molecular therapy oncolytics | 35317526 | lls was harvested, and 0.45 μm was filtered and cryopreserved for future use. For T cell transduction, healthy donor leukopaks were purchased from Stemcell Technologies (Vancouver, BC, Canada) and ALLCELLS (Alameda, CA). PBMCs were isolated using sta | Full Paper |
2022 | Biscaia, S;Branquinho, MV;Alvites, RD;Fonseca, R;Sousa, AC;Pedrosa, SS;Caseiro, AR;Guedes, F;Patrício, T;Viana, T;Mateus, A;Maurício, AC;Alves, N; | 3D Printed Poly(????-caprolactone)/Hydroxyapatite Scaffolds for Bone Tissue Engineering: A Comparative Study on a Composite Preparation by Melt Blending or Solvent Casting Techniques and the Influence of Bioceramic Content on Scaffold Properties | International journal of molecular sciences | 35216432 | ON 4505 equipment in a dry state at a rate of 1 mm/min. Five specimens were tested for each composition. 4.3. Cytocompatibility Analysis 4.3.1. Cell Culture and Maintenance hDPSCs were acquired from AllCells, LLC (Cat. DP0037F, Lot N° DPSC090411-01) | Full Paper |
2022 | Cunningham, AW;Jones, M;Frank, N;Sethi, D;Miller, MM; | Stem-like memory T cells are generated during hollow fiber perfusion-based expansion and enriched after cryopreservation in an automated modular cell therapy manufacturing process | Cytotherapy | 36031522 | Leukopaks from three healthy donors were acquired by processing whole blood on the Spectra Optia Apheresis System and obtained through AllCells (Alameda, CA, USA) (Fig. 1A). The apheresis product was shipped to the lab overnight, and CD3+ T cells wer | Full Paper |
2022 | Jimenez, AC;Heist, CA;Navaei, M;Yeago, C;Roy, K; | Longitudinal two-dimensional gas chromatography mass spectrometry as a non-destructive at-line monitoring tool during cell manufacturing identifies volatile features correlative to cell product quality | Cytotherapy | 35882596 | CellBIND 96-well plate (Corning) for 48-h before co-culture at 50 000 cells per well. PBMCs (AllCells, Alameda, CA, USA) were thawed with a CTL anti-aggregate solution (Cellular Technology Ltd, Shaker Heights, OH, USA) and plated in a six-well plate | Full Paper |
2022 | Maughon, TS;Shen, X;Huang, D;Michael, AOA;Shockey, WA;Andrews, SH;McRae, JM;Platt, MO;Fernández, FM;Edison, AS;Stice, SL;Marklein, RA; | Metabolomics and cytokine profiling of mesenchymal stromal cells identify markers predictive of T-cell suppression | Cytotherapy | 34696960 | ethylenediaminetetraacetic acid; Gibco) and then seeded at three densities (10 000, 5000 and 2000 cells/well) in a 96-well plate and cultured for 24 h. PBMCs (AllCells, Alameda, CA, USA) were thawed in Roswell Park Memorial Institute medium, 20% feta | Full Paper |
2022 | Xu, C;Yang, J;Kosters, A;Babcock, BR;Qiu, P;Ghosn, EEB; | Comprehensive multi-omics single-cell data integration reveals greater heterogeneity in the human immune system | iScience | 36185375 | ical samples ------------------------- Human Adult Peripheral Blood Emory University’s Children’s Clinical and Translational Discovery Core N/A Human Adult Bone Marrow Emory University; AllCells N/A ------------------------- Critical co | Full Paper |
2022 | Magis, W;DeWitt, MA;Wyman, SK;Vu, JT;Heo, SJ;Shao, SJ;Hennig, F;Romero, ZG;Campo-Fernandez, B;Said, S;McNeill, MS;Rettig, GR;Sun, Y;Wang, Y;Behlke, MA;Kohn, DB;Boffelli, D;Walters, MC;Corn, JE;Martin, DIK; | High-level correction of the sickle mutation is amplified in vivo during erythroid differentiation | iScience | 35633935 | Cryopreserved CD34+ cells were thawed according to AllCells instructions and cultured for 2 days in StemSpan SFEM with CC110 supplement (StemCell Technologies). For each Save;. Methods CD34+cells CD34+ HSPCs homozygous for the sickle mutation were | Full Paper |
2022 | Liu, P;Qin, L;Liu, C;Mi, J;Zhang, Q;Wang, S;Zhuang, D;Xu, Q;Chen, W;Guo, J;Wu, X; | Exosomes Derived From Hypoxia-Conditioned Stem Cells of Human Deciduous Exfoliated Teeth Enhance Angiogenesis via the Transfer of let-7f-5p and miR-210-3p | Frontiers in cell and developmental biology | 35557954 | Human umbilical vein endothelial cells (HUVECs) were purchased from AllCells (Cat. H-001F, AllCells) and were cultured in DMEM (Cat. SH30021.01, Hyclone) supplemented with 10 Save | Full Paper |
2022 | Li, L;Zhou, B;Xu, H;Shi, H;Gao, L;Ge, B; | Zinc-Loaded Black Phosphorus Multifunctional Nanodelivery System Combined With Photothermal Therapy Have the Potential to Treat Prostate Cancer Patients Infected With COVID-19 | Frontiers in endocrinology | 35464050 | n, USA). Human HMGB1 ELISA Kit was obtained from Arigo Biolaboratories (Taiwan, China). ATP content detection kit was obtained from Solarbio (Beijing, China). Dendritic cells (DCs) were obtained from AllCells (San Francisco, USA). FITC anti-human CD1 | Full Paper |
2022 | McGovern, K;Castro, AC;Cavanaugh, J;Coma, S;Walsh, M;Tchaicha, J;Syed, S;Natarajan, P;Manfredi, M;Zhang, XM;Ecsedy, J; | Discovery and Characterization of a Novel Aryl Hydrocarbon Receptor Inhibitor, IK-175, and Its Inhibitory Activity on Tumor Immune Suppression | Molecular cancer therapeutics | 35666806 | Naive human T cells (CD4+/CD62L+) from two independent donors were isolated from cryopreserved CD4+ T cells (AllCells) by magnetic selection with human CD62 L microbeads (Miltenyi). On Day 1, naive CD62L+ human T cells were activated with human CD3/C | Full Paper |
2022 | Lin, W;Qian, J;Wang, H;Ren, L;Yang, Y;Chen, C;Chen, X;Huang, Y;Liu, J;Xu, N;Teng, L; | Cisplatin plus anti-PD-1 antibody enhanced treatment efficacy in advanced esophageal squamous cell carcinoma | American journal of cancer research | 35261780 | Therapies for patients with advanced esophageal squamous cell carcinoma (ESCC) are limited and accompanied by dismal prognosis. Here we use ESCC cell line K30 and TE-1 to Save | Full Paper |
2022 | Duan, J;Lei, D;Ling, C;Wang, Y;Cao, Z;Zhang, M;Zhang, H;You, Z;Yao, Q; | Three-dimensional-printed polycaprolactone scaffolds with interconnected hollow-pipe structures for enhanced bone regeneration | Regenerative biomaterials | 35719204 | CR MasterMix (ABM, CA) on a Light Cycler 480 II (Roche, CHE). To evaluate the expression of angiogenesis genes (HIF1-α and VEGF), human umbilical vein endothelial cells (HUVECs) were purchased from AllCells. First, 6 × 105 HUVECs were seeded vertica | Full Paper |
2022 | Li, Z;Kou, L;Fu, X;Xie, Z;Xu, M;Guo, L;Lin, T;Gong, S;Zhang, S;Liu, M; | Design, synthesis, and biological evaluation of triazole-pyrimidine-methylbenzonitrile derivatives as dual A2A/A2B adenosine receptor antagonists | Journal of enzyme inhibition and medicinal chemistry | 35616298 | Cryopreserved PBMCs (Allcells) were thawed and recovered in RPMI1640 medium overnight before being used. And compounds to be tested were diluted with DMSO to 100 folds of Save | Full Paper |
2022 | Hu, S;Muniraj, G;Mishra, A;Hong, K;Lum, JL;Hong, CHL;Rosa, V;Sriram, G; | Characterization of silver diamine fluoride cytotoxicity using microfluidic tooth-on-a-chip and gingival equivalents | Dental materials : official publication of the Academy of Dental Materials | 35778310 | Objective This study aims to characterize the cytotoxicity potential of silver diamine fluoride (SDF) on dental pulp stem cells (DPSC) and gingival equivalents. Methods DPSC cultured on Save | Full Paper |
2022 | Dogan, M;Karhan, E;Kozhaya, L;Placek, L;Chen, X;Yigit, M;Unutmaz, D; | Engineering Human MAIT Cells with Chimeric Antigen Receptors for Cancer Immunotherapy | Journal of immunology (Baltimore, Md. : 1950) | 36165183 | Healthy adult blood was obtained from AllCells (Quincy, MA). PBMCs were isolated using Ficoll-Paque plus (GE Healthcare). CD4 + T, CD8 + T, and CD19 + B cells and CD14 + Save | Full Paper |
2022 | Ben Nasr, M;Robbins, D;Parone, P;Usuelli, V;Tacke, R;Seelam, AJ;Driver, E;Le, T;Sabouri-Ghomi, M;Guerrettaz, L;Shoemaker, D;Fiorina, P; | Pharmacologically Enhanced Regulatory Hematopoietic Stem Cells Revert Experimental Autoimmune Diabetes and Mitigate Other Autoimmune Disorders | Journal of immunology (Baltimore, Md. : 1950) | 35321879 | A total of 5000 cryopreserved and preisolated human mobilized peripheral blood HSCs (CD34 + cells) (AllCells) were plated into each well of a 384-well plate (Corning) in StemSpan- Save | Full Paper |
2022 | Melani, RD;Des Soye, BJ;Kafader, JO;Forte, E;Hollas, M;Blagojevic, V;Negrão, F;McGee, JP;Drown, B;Lloyd-Jones, C;Seckler, HS;Camarillo, JM;Compton, PD;LeDuc, RD;Early, B;Fellers, RT;Cho, BK;Mattamana, BB;Goo, YA;Thomas, PM;Ash, MK;Bhimalli, PP;Al-Harthi, L;Sha, BE;Schneider, JR;Kelleher, NL; | Next-Generation Serology by Mass Spectrometry: Readout of the SARS-CoV-2 Antibody Repertoire | Journal of proteome research | 34878788 | odium heparin (BD 367874, Fisher Scientific) by centrifugation at 1,500 × g for 10 min. Plasma from a convalescent patient featuring a high titer of anti-SARS-CoV-2-RBD antibodies was purchased from AllCells (commercial sample 1 - CS1) and used as a | Full Paper |
2022 | Kawato, Y;Fukahori, H;Nakamura, K;Kanno, A;Kubo, K;Hiramitsu, M;Matsuda, T;Hanada, Y;Furukawa, T;Nakajima, Y;Kinugasa, F;Morokata, T; | Potential benefit of the cathepsin S inhibitor, ASP1617, as a treatment for systemic lupus erythematosus | European journal of pharmacology | 35157914 | Five different lots of peripheral blood-derived frozen B cell were purchased from AllCells (Alameda, CA, USA). Cell suspensions (final, 2 × 10 6 Save | Full Paper |
2022 | Pieles, O;Höring, M;Adel, S;Reichert, TE;Liebisch, G;Morsczeck, C; | Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells | Stem cells international | 35903407 | Human dental follicle cells were purchased from AllCells (Alameda, CA, USA) and cultured in Dulbecco's Modified Eagle's Medium (DMEM) containing 10% fetal bovine serum (FBS) Save | Full Paper |
2022 | Schlichtner, S;Yasinska, IM;Ruggiero, S;Berger, SM;Aliu, N;Prunk, M;Kos, J;Meyer, NH;Gibbs, BF;Fasler-Kan, E;Sumbayev, VV; | Expression of the Immune Checkpoint Protein VISTA Is Differentially Regulated by the TGF-β1 - Smad3 Signaling Pathway in Rapidly Proliferating Human Cells and T Lymphocytes | Frontiers in medicine | 35223897 | Medium was also supplemented with penicillin (50 IU/ml), and streptomycin sulfate (50 μg/ml). Primary human AML mononuclear blasts (AML-PB001F, newly diagnosed/untreated) were also purchased from AllCells (Alameda, CA, USA) and handled according to | Full Paper |
2022 | Yoshimaru, K;Yamaza, T;Kajioka, S;Sonoda, S;Yanagi, Y;Matsuura, T;Yoshizumi, J;Oda, Y;Iwata, N;Takai, C;Nakayama, S;Taguchi, T; | Dental pulp stem cells as a therapy for congenital entero-neuropathy | Scientific reports | 35484137 | ies were passaged to expand the number of dDPSCs. Cells at P3 were used for the experiments. BMMSCs isolated from human whole bone marrow aspirates obtained from healthy adult volunteers (n = 3; AllCells, Alameda, CA, USA) and human skin fibroblasts | Full Paper |
2022 | Herrera, VLM;Walkey, AJ;Nguyen, MQ;Gromisch, CM;Mosaddhegi, JZ;Gromisch, MS;Jundi, B;Lukassen, S;Carstensen, S;Denis, R;Belkina, AC;Baron, RM;Pinilla-Vera, M;Mueller, M;Kimberly, WT;Goldstein, JN;Lehmann, I;Shih, AR;Eils, R;Levy, BD;Ruiz-Opazo, N; | A targetable 'rogue' neutrophil-subset, [CD11b+DEspR+] immunotype, is associated with severity and mortality in acute respiratory distress syndrome (ARDS) and COVID-19-ARDS | Scientific reports | 35379853 | ARDS (n = 4) for inertial microfluidic separation (BDL, RMB, MPV) according to respective institutional guidelines. Blood collection Fresh normal peripheral blood neutrophils were procured from AllCells, LLC (CA), which were shipped overnight in Isc | Full Paper |
2022 | Kim, DE;Shin, YH;Cho, JE;Myung, S;Kim, HG;Kim, KC;Park, CM;Yoon, CH; | Identification of 3-Oxindole Derivatives as Small Molecule HIV-1 Inhibitors Targeting Tat-Mediated Viral Transcription | Molecules (Basel, Switzerland) | 35956872 | d fetal bovine serum (all obtained from Gibco-BRL, Gaithersburg, MD, USA). The bl-DTR cells were additionally supplemented with 1 μg/mL puromycin and 200 μg/mL zeocin. The PBMCs were purchased from AllCells (Alameda, CA, USA) and cultured, as describ | Full Paper |
2022 | Saaid, A;Ensanya, A;Suzina, S;Nurul, A;Samsudin, A;Azlina, A; | Odontogenic induction of human amniotic membrane scaffold for dental pulp regeneration | Materials Chemistry and Physics | For this study, deciduous teeth stem cells (DTSCs), obtained from ALLCELLS, USA, were used at passage 4-8. The cells were allowed to grow in a-modified Eagle's medium (α-MEM) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin/streptomyc | Full Paper | |
2022 | Jaimes, MC;Leipold, M;Kraker, G;Amir, EA;Maecker, H;Lannigan, J; | Full spectrum flow cytometry and mass cytometry: A 32-marker panel comparison | Cytometry. Part A : the journal of the International Society for Analytical Cytology | 35593221 | Frozen PBMCs from 5 donors were obtained from AllCells Alameda (Alameda, CA). Cells were provided aliquoted in 25 million cells per vial in freezing media and cryopreserved in liquid nitrogen until ready to use. Ethical review and regulatory complian | Full Paper |
2022 | Moore, KP;Schwaid, AG;Tudor, M;Park, S;Beshore, DC;Converso, A;Shipe, WD;Anand, R;Lan, P;Moningka, R;Rothman, DM;Sun, W;Chi, A;Cornella-Taracido, I;Adam, GC;Bahnck-Teets, C;Carroll, SS;Fay, JF;Goh, SL;Lusen, J;Quan, S;Rodriguez, S;Xu, M;Andrews, CL;Song, C;Filzen, T;Li, J;Hollenstein, K;Klein, DJ;Lammens, A;Lim, UM;Fang, Z;McHale, C;Li, Y;Lu, M;Diamond, TL;Howell, BJ;Zuck, P;Balibar, CJ; | A Phenotypic Screen Identifies Potent DPP9 Inhibitors Capable of Killing HIV-1 Infected Cells | ACS chemical biology | 36044633 | Cells were purchased from AllCells in cryopreserved vials. Cells were centrifuged at 500×g for 10 min at 4 C. The supernatant was removed, and cells were washed with 20 mL PBS. Save | Full Paper |
2022 | Zhang, H;Lv, X;Kong, Q;Tan, Y; | IL-6/IFN-γ double knockdown CAR-T cells reduce the release of multiple cytokines from PBMCs in vitro | Human vaccines & immunotherapeutics | 35049413 | rward TGGGAGCATGTGAATGCCATCC Reverse GTCGGCTCCTGGAGGTCAAACA β-actin Forward CGCCCCAGGCACCAGGGC Reverse GCTGGGGTGTTGAAGGT 2.3. IL-6/IFN-γ double KD CAR-T cell culture The PBMCs (Allcells, Cat: PB005F) were resuspended in CTSTM AIM | Full Paper |
2022 | Zhou, Z;Qin, M;Khodahemmati, S;Li, W;Niu, B;Li, J;Liu, Y;Gao, J; | Gene expression in human umbilical vein endothelial cells exposed to fine particulate matter: RNA sequencing analysis | International journal of environmental health research | 34102927 | We maintained HUVECs (Allcells, China) routinely in HUVEC complete culture medium (Allcells, China), supplemented with 10% fetal bovine serum (FBS), 2% growth factors, 100 U/mL Save | Full Paper |
2022 | Wang, X;Wong, LM;McElvain, ME;Martire, S;Lee, WH;Li, CZ;Fisher, FA;Maheshwari, RL;Wu, ML;Imun, MC;Murad, R;Toledo Warshaviak, D;Yin, J;Kamb, A;Xu, H; | A rational approach to assess off-target reactivity of a dual-signal integrator for T cell therapy | Toxicology and applied pharmacology | 35085592 | Informed-consent for use of primary T cells and donor collection protocols was approved by an Institutional Review Board (IRB) at Allcells or HemaCare. Allcells and HemaCare Save | Full Paper |
2022 | Andrews, SH;Klinker, MW;Bauer, SR;Marklein, RA; | Morphological landscapes from high content imaging reveal cytokine priming strategies that enhance mesenchymal stromal cell immunosuppression | Biotechnology and bioengineering | 34716713 | Human bone marrow-derived MSCs were obtained from four different donors purchased from Lonza, AllCells, and RoosterBio (see Table S1 for donor information). MSC culture conditions for the Lonza and AllCells (8F3560, 110877, PCBM1662) were chosen base | Full Paper |
2022 | Mandal, S;Sunagawa, SW;Prathipati, PK;Belshan, M;Shibata, A;Destache, CJ; | Targeted Immuno-Antiretroviral to Promote Dual Protection against HIV: A Proof-of-Concept Study | Nanomaterials (Basel, Switzerland) | 35683795 | were maintained in a complete DMEM medium (HiDMEM medium supplemented with 10% FBS and 1× AA) as standard protocol [14,15]. The human peripheral blood mononuclear cells (hPBMCs) were purchased from AllCells (Alameda, CA, USA) and maintained in comp | Full Paper |
2022 | Huang, P;Zhang, C;Delawary, M;Korchak, JA;Suda, K;Zubair, AC; | Development and evaluation of IL-6 overexpressing mesenchymal stem cells (MSCs) | Journal of tissue engineering and regenerative medicine | 34890489 | Human bone marrow derived mesenchymal stem cells (BMSCs) were isolated from commercial de-identified bone marrow (AllCells, Alameda, CA) from a healthy 28-year-old male Save | Full Paper |
2022 | Harper, T;Sharma, A;Kaliyaperumal, S;Fajardo, F;Hsu, K;Liu, L;Davies, R;Wei, YL;Zhan, J;Estrada, J;Kvesic, M;Nahrwold, L;Deisting, W;Panzer, M;Cooke, K;Lebrec, H;Nolan-Stevaux, O; | Characterization of an Anti-CD70 Half-Life Extended Bispecific T-Cell Engager (HLE-BiTE) and Associated On-Target Toxicity in Cynomolgus Monkeys | Toxicological sciences : an official journal of the Society of Toxicology | 35583313 | Human T cells (AllCells) or cynomolgus monkey or human peripheral blood mononuclear cells (PBMCs) (SNBL) were cocultured with target cells at an effector cell (E) to target cell (T) Save | Full Paper |
2022 | Wang, P;Zhang, J;Zhang, H;Zhang, F; | The role of MACF1 on acute myeloid leukemia cell proliferation is involved in Runx2-targeted PI3K/Akt signaling | Molecular and cellular biochemistry | 35857251 | Bone marrow CD34 + hematopoietic stem and progenitor cells (HSPCs) were purchased from AllCells (Alameda, CA, USA) and cultured in X-Vivo 15 media (Lonza, Basel, Switzerland) Save | Full Paper |
2022 | Shams, F;Bayat, H;Mohammadian, O;Mahboudi, S;Vahidnezhad, H;Soosanabadi, M;Rahimpour, A; | Advance trends in targeting homology-directed repair for accurate gene editing: An inclusive review of small molecules and modified CRISPR-Cas9 systems | BioImpacts : BI | 35975201 | A) Treatment group 1A (unedited HSCs from AllCells). The first mouse was found dead in Treatment group 2B, which contained edited bought HSCs (AllCells), had the highest bone Save | Full Paper |
2022 | Liu, Y;Ma, X;Yang, H;Li, X;Ma, Y;Ason, B;Liu, S;Hu, LA; | APLNR Regulates IFN-γ signaling via β-arrestin 1 mediated JAK-STAT1 pathway in melanoma cells | The Biochemical journal | 35084016 | Naive CD8+ T cells used for co-culture assay were obtained from Allcells and cultured in RPMI 1640 medium supplemented with 10% FBS, 1× HEPES, 1× PS, 2 mM Glutamine, 1 mM Save | Full Paper |
2022 | Venn-Watson, SK;Butterworth, CN; | Broader and safer clinically-relevant activities of pentadecanoic acid compared to omega-3: Evaluation of an emerging essential fatty acid across twelve primary human cell-based disease systems | PloS one | 35617322 | lowed ethical guidelines and documented informed consent: Cell Applications, Inc., CellzDirect, Celsis-IVT, Leukolab, Life Technologies, Lonza, ScienCell, Hemacare Corporation, Stemcell Technologies, AllCells, Physician’s Plasma Alliance, Lifeline Ce | Full Paper |
2022 | Okada, Y;Kawashima, N;Noda, S;Murano, H;Han, P;Hashimoto, K;Kaneko, T;Okiji, T; | VEGFA promotes odonto/osteoblastic differentiation in dental pulp stem cells via ERK/p38 signaling | Journal of Dental Sciences | SHEDs (P5, DP001F; AllCells, Alameda, CA, USA) were cultured in alpha-modified Eagle's minimum essential medium (α-MEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Waltham, MA, USA) and an antibiotic and antifungal soluti | Full Paper | |
2022 | Chen, W;Qie, C;Hu, X;Wang, L;Jiang, J;Liu, W;Liu, J; | A small molecule inhibitor of VSIG-8 prevents its binding to VISTA | Investigational new drugs | 35404016 | PBMCs were purchased from Allcells Biotechnology (Shanghai) Co., LTD, and we got a statement confirming that informed consent was obtained from all subjects, the attachment is on response. Jurkat cells were cultured in RPMI-1640 medium (Biological In | Full Paper |
2022 | Han, Y;Bai, X;Wang, X; | Exosomal myeloperoxidase as a biomarker of deep venous thrombosis | Annals of translational medicine | 35242854 | al microscope (Olympus). HUVECs culture We purchased HUVECs from American Type Culture Collection and cultured them in endothelial cell complete medium containing endothelial cell growth supplement (AllCells, Alameda, CA, USA) at 37 °C in a humidifi | Full Paper |
2022 | Sato, M;Fujii, K;Takagi, H;Shibuya, I;Oka, D;Yamaya, N;Hagita, H;Matsumoto, M;Inagaki, K; | Antibacterial and Immunosuppressive Effects of OPS-2071, a Candidate Therapy for Inflammatory Bowel Disease | Digestive diseases and sciences | 34463880 | Mouse splenocytes were prepared from eight-week-old female BALB/c mice, and human peripheral blood mononuclear cells (PBMC) were purchased from AllCells (Alameda, CA). To Save | Full Paper |
2022 | Skaddan, MB;Wooten, DW;Wilcox, KC;Voorbach, MJ;Reuter, DR;Jia, ZJ;Foster-Duke, KD;Hickson, JA;Vaidyanathan, S;Reed, AD;Tovcimak, AE;Guo, Q;Comley, RA;Lee, L;Finnema, SJ;Mudd, SR; | [18F]BTK-1: A Novel Positron Emission Tomography Tracer for Imaging Bruton's Tyrosine Kinase | Molecular imaging and biology | 35482146 | Purpose Bruton's tyrosine kinase (BTK) is a key component of B cell receptor (BCR) signaling, and as such a critical regulator of cell proliferation and survival. Aberrant BCR signaling is Save | Full Paper |
2022 | Wu, C;Wang, X;Shang, H;Wei, H; | Construction of a Humanized PBMC-PDX Model to Study the Efficacy of a Bacterial Marker in Lung Cancer Immunotherapy | Disease markers | 36072895 | , Ltd., and the RPMI-1640 Complete Medium (10%FBS; Gibco) was used for culture. When the cells reached 80% confluence, they were passed on. 2.3. PBMCs Immune Reconstitution PBMCs were purchased from AllCells and processed according to the company's | Full Paper |
2022 | Ryan, DE;Diamant-Levi, T;Steinfeld, I;Taussig, D;Visal-Shah, S;Thakker, S;Lunstad, BD;Kaiser, RJ;McCaffrey, R;Ortiz, M;Townsend, J;Welch, WRW;Singh, M;Curry, B;Dellinger, DJ;Bruhn, L; | Phosphonoacetate Modifications Enhance the Stability and Editing Yields of Guide RNAs for Cas9 Editors | Biochemistry | 35436085 | Human primary T cells (LP, CR, CD3+, NS) were obtained from AllCells (Alameda, CA) and were cultured in RPMI 1640 plus GlutaMax media supplemented with 10% fetal bovine serum, 5 ng/mL human IL-7, and 5 ng/mL human IL-15 (Gibco). Primary T cells were | Full Paper |
2022 | Darbaniyan, F;Zheng, H;Kanagal-Shamanna, R;Lockyer, P;Montalban-Bravo, G;Estecio, M;Lu, Y;Soltysiak, KA;Chien, KS;Yang, H;Sasaki, K;Class, C;Ganan-Gomez, I;Do, KA;Garcia-Manero, G;Wei, Y; | Transcriptomic Signatures of Hypomethylating Agent Failure in Myelodysplastic Syndromes and Chronic Myelomonocytic Leukemia | Experimental hematology | 36150563 | CD34 + cells isolated from healthy individuals (AllCells, Alameda CA) and from patients with MDS or CMML were plated into human methylcellulose colony formation medium Methocult- Save | Full Paper |
2022 | Valdez, BC;Yuan, B;Murray, D;Nieto, Y;Popat, U;Andersson, BS; | Enhanced cytotoxicity of bisantrene when combined with venetoclax, panobinostat, decitabine and olaparib in acute myeloid leukemia cells | Leukemia & lymphoma | 35188042 | Bisantrene (Bis), a topoisomerase-II inhibitor, is less cardiotoxic than the current anthracyclines. Its synergistic cytotoxicity with newly developed antineoplastic drugs has not been Save | Full Paper |
2022 | Fan, F;Liu, F;Shen, P;Tao, L;Zhang, H;Wu, H; | Salvianolic acid B, a new type I IRE1 kinase inhibitor, abrogates AngII-induced angiogenesis by interacting with IRE1 in its active conformation | Clinical and experimental pharmacology & physiology | 36153795 | Primary human umbilical vein endothelial cells (HUVECs) were purchased from AllCells (Shanghai, China) and cultured in EBM media (AllCells ) according to the manufacturer's Save | Full Paper |
2022 | Tong, Q;Liu, H;Qi, Q;Dai, C;Yang, T;Qian, F; | Development of a fully human anti-GITR antibody with potent antitumor activity using H2L2 mice | FEBS open bio | 35674216 | h well, and luminescence values were measured using a Varioskan LUX (Thermo, Carlsbad, CA, USA). T‐cell activation assays Total T cells from frozen human peripheral blood mononuclear cells (PBMCs, AllCells, Alameda, CA, USA) were first isolated usin | Full Paper |
2022 | Yang, M;Tkach, D;Boyne, A;Kazancioglu, S;Duclert, A;Poirot, L;Duchateau, P;Juillerat, A; | Optimized two-step electroporation process to achieve efficient nonviral-mediated gene insertion into primary T cells | FEBS open bio | 34510816 | ineering in human primary cells and provide a foundation for further advances using nonviral gene editing methods. Materials and methods T‐cell culture Cryopreserved human PBMCs were acquired from ALLCELLS. PBMCs were cultured in X‐vivo‐15 media (Lo | Full Paper |
2022 | Pieles, O;Reichert, TE;Morsczeck, C; | Protein kinase A is activated during bone morphogenetic protein 2-induced osteogenic differentiation of dental follicle stem cells via endogenous parathyroid hormone-related protein | Archives of oral biology | 35338829 | Human dental follicle stem cells (Catalog number FT002F, Lot number ACF001) were commercially obtained from AllCells (Emeryville, USA) and cultured in Dulbecco's Modified Eagle's Medium (DMEM) high glucose (Sigma Aldrich, St. Louis, USA) with 10% fet | Full Paper |
2022 | Qian, J;Yu, J;Zhu, X;Liang, S; | MiR-335 promotes corneal neovascularization by Targeting EGFR | BMC ophthalmology | 35701740 | surgery and on day 3, 7, 11 and 14. The Animal Research Committee of the Affiliated Hospital of Nantong University approved all animal studies. Cell culture and different treatments HUVECs were from AllCells (Shanghai, China). They were put in an RP | Full Paper |
2022 | Wang, W;Tang, W;Shan, E;Zhang, L;Chen, S;Yu, C;Gao, Y; | MiR-130a-5p contributed to the progression of endothelial cell injury by regulating FAS | European journal of histochemistry : EJH | 35638591 | cells (HUVEC) in vitro. Materials and Methods Cell culture HUVEC cells have played a major role as a model system for the study of the regulation of endothelial cell function. HUVEC cells (Shanghai AllCells Biotech Co., Ltd. Shanghai, China) were cu | Full Paper |
2022 | Koh, H;Zhen, X;Kim, J;Ha, HY;Lee, JH; | Generation and characterization of human umbilical cord blood-derived induced pluripotent stem cells (KRIBBi005-A) | Stem cell research | 35085946 | Ethical approval Approval obtained by Public Institutional Bioethics Committee designated by the MOHW (P01-201909-31-002). Cord blood mononuclear cells were purchased (AllCells LLC) | Full Paper |
2022 | Hashim, SNM;Azlina, A; | Ultrastructural morphological changes of VEGF treated-stem cells from human exfoliated deciduous teeth cultured on human amniotic membrane | Acta Microscopica | SHED (AllCells, USA) were cultured in a complete medium made of the Minimum Essential Medium (MEM) Alpha Medium (α-MEM) (Gibco, USA), supplemented with 15% of fetal bovine serum (FBS) (Gibco, USA) and 50 U/ml of penicillin-st | Full Paper | |
2022 | Bai, Y;Zhang, X;Zheng, J;Liu, Z;Yang, Z;Zhang, X; | Overcoming high level adenosine-mediated immunosuppression by DZD2269, a potent and selective A2aR antagonist | Journal of experimental & clinical cancer research : CR | 36229853 | bR, CHO-A1R and CHO-A3R) were purchased from GenScript. Cell lines RM-1, B16F10 and Pan02 were obtained from the American Type Culture Collection (ATCC). Cryopreserved human PBMCs were purchased from AllCells. All CHO cells were cultured in Ham’s F12 | Full Paper |
2022 | Kartha, VK;Duarte, FM;Hu, Y;Ma, S;Chew, JG;Lareau, CA;Earl, A;Burkett, ZD;Kohlway, AS;Lebofsky, R;Buenrostro, JD; | Functional inference of gene regulation using single-cell multi-omics | Cell genomics | 36204155 | AILS Human peripheral blood mononuclear cells Cryopreserved human peripheral blood mononuclear cells (PBMCs) and isolated peripheral blood CD4+, CD8+, CD14+, CD19+ and CD56+ cells were purchased from AllCells (see Table S1 for catalog numbers and don | Full Paper |
2022 | Riaz, S;Azlina, A;Mahmood, Z;Htun, AT; | Long-term treatment of dentine with triple antibiotic paste promotes stem cell viability and attachment | Journal of Taibah University Medical Sciences | 35983454 | , the dentine chips were removed from the well plates and air-dried on a filter paper. The samples were then stored in a sterile container at 4 °C until further use. Cell culture Commercial DPSCs (AllCells, USA) were used from passage 7 to 9 at 70%- | Full Paper |
2022 | Salam, N;Gibson, IR; | Lithium ion doped carbonated hydroxyapatite compositions: Synthesis, physicochemical characterisation and effect on osteogenic response in vitro | Biomaterials advances | 35939955 | the American Type Culture Collection (via LGC standards, UK), PromoCell (Germany), and AllCells (USA), respectively. Cells were maintained in routine culture conditions using: high glucose DMEM with 10 % FBS and 4 mM l-glutamine for C2C12 cells, Gibc | Full Paper |
2022 | Nakauchi, Y;Azizi, A;Thomas, D;Corces, MR;Reinisch, A;Sharma, R;Cruz Hernandez, D;Köhnke, T;Karigane, D;Fan, A;Martinez-Krams, D;Stafford, M;Kaur, S;Dutta, R;Phan, P;Ediriwickrema, A;McCarthy, E;Ning, Y;Phillips, T;Ellison, CK;Guler, GD;Bergamaschi, A;Ku, CJ;Levy, S;Majeti, R; | The Cell Type-Specific 5hmC Landscape and Dynamics of Healthy Human Hematopoiesis and TET2-Mutant Preleukemia | Blood cancer discovery | 35532363 | Normal donor human BM cells were obtained fresh from AllCells, and peripheral blood cells Human BM samples (CD34+ cell enriched) were purchased from AllCells. Mononuclear Save | Full Paper |
2022 | Baskar, R;Chen, AF;Favaro, P;Reynolds, W;Mueller, F;Borges, L;Jiang, S;Park, HS;Kool, ET;Greenleaf, WJ;Bendall, SC; | Integrating transcription-factor abundance with chromatin accessibility in human erythroid lineage commitment | Cell reports methods | 35463156 | # ab181544 Cleaved caspase 3-PE BD Biosciences Cat# 550821, RRID:AB_393906 ------------------------- Biological samples ------------------------- Adult bone marrow All Cells Inc https://allcells.com/research-grade-tissue-products/bone-m | Full Paper |
2022 | Kwak, J;Choi, W;Bae, Y;Kim, M;Choi, S;Oh, W;Jin, H; | HLA-A2 Promotes the Therapeutic Effect of Umbilical Cord Blood-Derived Mesenchymal Stem Cells in Hyperoxic Lung Injury | Bioengineering (Basel, Switzerland) | 35447737 | St. Louis, MO, USA) for 1 h at 37 °C. The UCB-MSCs (1 × 103 cells/well) were seeded and maintained at 37 °C in a humidified incubator for 4 h and then co-cultured with PBMCs (1 × 105 cells/well; Allcells, Boston, MA, USA) from different donors. Phyto | Full Paper |
2022 | Vivanco Gonzalez, N;Oliveria, JP;Tebaykin, D;Ivison, GT;Mukai, K;Tsai, MM;Borges, L;Nadeau, KC;Galli, SJ;Tsai, AG;Bendall, SC; | An optimized protocol for phenotyping human granulocytes by mass cytometry | STAR protocols | 35434655 | y donors (with unknown allergy status) were obtained from the Stanford Blood Center (Palo Alto, CA, USA). Healthy bone marrow and peripheral blood samples paired from the same donor were ordered from AllCells (Alameda, CA, USA). Samples from patients | Full Paper |
2022 | Bell-Glenn, S;Thompson, JA;Salas, LA;Koestler, DC; | A Novel Framework for the Identification of Reference DNA Methylation Libraries for Reference-Based Deconvolution of Cellular Mixtures | Frontiers in bioinformatics | 35419567 | Cell Mixture Reconstruction Experiment Purified cells taken from normal human subjects were purchased from AllCells LLC (Emeryville, CA). Namely, granulocytes, monocytes, CD4T, Save | Full Paper |
2022 | Shui, S;Wang, S;Liu, J; | Systematic Investigation of the Effects of Multiple SV40 Nuclear Localization Signal Fusion on the Genome Editing Activity of Purified SpCas9 | Bioengineering (Basel, Switzerland) | 35200436 | s medium (DMEM) supplemented with 10% (v/v) FBS, 100 U/mL penicillin and 100 U/mL streptomycin. The medium of EGFP reporter contained an additional 50 U/mL hygromycin. Human dermal fibroblasts (hDF, AllCells) were acquired from Cell Applications (Lot | Full Paper |
2022 | Li, L;Xu, H;Gao, L; | Doxorubicin-Loaded Black Phosphorus Multifunctional Nanodelivery System Combined with Photothermal Therapy Promotes Immunogenic Death of Prostate Cancer PC-3 Cells | SSRN Electronic Journal | Beijing, China). Dendritic cells (DCs) were 197obtained from AllCells (San Francisco, USA). FITC anti198human CD11c Antibody, Alexa Fluor® 647 anti-human 199CD80 Antibody, PE anti-human CD86 Antibody, and 200PerCP/Cyanine5.5 anti-human HLA-DR Antibod | Full Paper | |
2022 | Calderon, A;Kim, Y;Favaro, P;Baskar, R;Valainis, J;Reynolds, W;Borges, L;Glass, D;Tsai, A;Bendall, S; | Multi-Omic Single Cell Identification of Lin- CD34- Natural Killer Cell Progenitors in Human Hematopoiesis | SSRN Electronic Journal | Deidentified human blood (n=5) and BM (n=7) were obtained from healthy adult donors (Stanford Blood Center, Allcells). All samples were obtained under informed consent and in Save | Full Paper | |
2022 | Lee, J;Jonus, H;Sadanand, A;Branella, G;Maximov, V;Suttapitugsakul, S;Schniederjan, M;Shim, J;Parwani, K;Fedanov, A;Pilgrim, A;Silva, J;Doering, C;Wu, R;Spencer, H;Goldsmith, K; | Identification and Targeting of Protein Tyrosine Kinase 7 (PTK7) as an Immunotherapy Candidate for Neuroblastoma Cellular Therapy | SSRN Electronic Journal | GD2-targeted immunotherapy improves survival for pediatric patients with neuroblastoma (NB). However, toxicities associated with on-target, off-tumor activity occur. Furthermore, GD2 Save | Full Paper | |
2022 | O'Brien, G;Cecotka, A;Manola, K;Pagoni, M;Polańska, J;Badie, C; | Epigenetic Signature of Ionising Radiation In Therapy-Related AML Patients | SSRN Electronic Journal | Bone marrow aspirate samples were also obtained from 5 healthy normal donors (4 males, 1 female, age 21-33) from AllCells® (Alamada, USA). The project was in accordance with the declaration of Helsinki. Informed consent was provided from patients and | Full Paper | |
2022 | Qian, T;Qi, B;Fei, Y;Li, J;Luo, L;Song, Y;Sheng, S;Lv, B;Huang, X;Wang, X; | Deletion of PLD2 Alleviates LPS Induced Acute Lung Injury by Inhibiting STAT3 Phosphorylation and Regulating Endothelial Tight Junctions | Research Square | HUVECs were purchased from the Shanghai cell bank and cultured in a 5% CO2 incubator at 37oC in a complete culture medium (AllCells, Shanghai, China). Cells were cultured to 85- Save | Full Paper | |
2022 | Li, W;Li, J;Hu, X;Xu, L;Liu, X;Qian, Z;Jin, L;Zhang, Y;Wei, J;Liu, X; | Tumor suppression by Chinese cordyceps extract via anti-angiogenesis | Research Square | Human umbilical vein endothelial cells (HUVECs) were purchased from Allcells (Shanghai, China) and cultured in special medium for HUVEC cells at 37C with 5% CO2. CCE was Save | Full Paper | |
2022 | Li, L;Chen, X;Li, Y;Lou, L; | Pharmacological characterization of GR1803, a novel BCMA × CD3 bispecific antibody for multiple myeloma treatment | Research Square | The MM cell lines NCI-H929, MM.1S, RPMI-8226, and U266 were obtained from the American Type Culture Collection (Manassas, VA, USA). Fresh peripheral blood mononuclear cells (PBMCs) were obtained from AllCells Co. (Shanghai, China). Natural killer (NK | Full Paper | |
2022 | Yan, F;Luo, B;Chen, C;Tan, B;Cui, D;Wang, M;Qian, J; | Inhibiting PHD2 in bone marrow mesenchymal stem cells in an inflammatory microenvironment facilitates periodontal repair in SD rats | Research Square | Primary BMMSCs of SD rats were isolated and puri ed by AllCells (Alameda, CA, USA), and their phenotype was identi ed. The cells were recovered and cultured in low glucose Save | Full Paper | |
2022 | Guedes, F;Branquinho, M;Biscaia, S;Alvites, R;Sousa, A;Lopes, B;Sousa, P;Rêma, A;Amorim, I;Faria, F;Patrício, T;Bugalho, A;Alves, N;Maurício, A; | Gamma Irradiation Processing on 3D PCL Devices - A Preliminary Biocompatibility Assessment | preprints | Human Dental Pulp stem/stromal cells (hDPSCs) obtained from AllCells, LLC (Cat. DP0037F, Lot Nº DPSC090411-01) were maintained in MEM α, GlutaMAX™ Supplement, no nucleosides (Gibco, 32561029), supplemented with 10% (v/v) fetal bovine serum (FBS) (Gib | Full Paper | |
2022 | Tokatlian, T;Asuelime, G;Naradikian, M;Mock, J;Daris, M;Martin, A;Toledo Warshaviak, D;Kamb, A;Hamburger, A; | Chimeric Antigen Receptors Directed at Mutant KRAS Exhibit an Inverse Relationship Between Functional Potency and Neoantigen Selectivity | Cancer Research Communications | Peripheral blood mononuclear cells (PBMC) from healthy donors were obtained from AllCells. PBMC collection and donor written informed consent were approved by an Institutional Save | Full Paper | |
2022 | Boccacci, Y;Dumont, N;Doyon, Y;Laganière, J; | Accessory-cell-free differentiation of hematopoietic stem and progenitor cells into mature red blood cells | bioRxiv | The culture and ex vivo engineering of red blood cells (RBCs) can help characterize genetic variants, model diseases, and may eventually spur the development of applications in Save | Full Paper | |
2022 | Checkley, M;Luttge, B;Dobrowolski, C;Wald, D;McMahon, D;Haidar, G;Sobolewski, M;Enick, P;Cyktor, J;Mellors, J;Karn, J; | Reduction of the HIV-1 reservoir in T cells from persons with HIV-1 on suppressive antiretroviral therapy using expanded natural killer cells ex vivo | bioRxiv | For this study leukapheresis packs from 5 HIV-1-negative donors were purchased from AllCells. 437 For HIV+ participants, PBMCs from well-suppressed ART-treated patients from the Save | Full Paper | |
2022 | Shabaneh, T;Moffett, H;Stull, S;Derezes, T;Tait, L;Park, S;Riddell, S;Lajoie, M; | Safety switch optimization enhances antibody-mediated elimination of CAR T cells | bioRxiv | Natural killer cells were isolated from cryopreserved, T cell depleted (CD4-/CD8-) PBMC (AllCells) by negative selection using the EasySep Human NK Cell Kit (Stemcell) according to the manufacturer’s protocol. To activate their cytolytic function, is | Full Paper | |
2022 | Wisdom, K;Suijker, J;van den Broek, L;Sridharan, B;Grandhi, T;Cheng, A;Lamb, M;Titus, S;Gehman, A;Poore, D;Shah, N;Cheng, S;Kim, E;Griffin, S;Ekert, J; | Lung Tumor Microphysiological System with 3D Endothelium to Evaluate Modulators of T-Cell Infiltration | bioRxiv | AllCells and shipped to the MIMETAS research facility, or they 653 were isolated from AllCells For this, T-cells were isolated from full 654 fresh leukopaks (AllCells). Leukopaks were Save | Full Paper | |
2022 | Dogan, M;Karhan, E;Kozhaya, L;Placek, L;Chen, X;Yigit, M;Unutmaz, D; | Engineering human Mucosal Associated Invariant T (MAIT) cells with chimeric antigen receptors for cancer immunotherapy1 | bioRxiv | Healthy adult blood was obtained from AllCells Quincy, MA. PBMCs were isolated using Ficoll- 100 paque plus (GE Health care). CD4+ T, CD8+ T, CD19+ B cells, CD14+ monocytes Save | Full Paper | |
2022 | Swift, M;Horns, F;Quake, S; | Fate Bias and Transcriptional Memory of human B cells | bioRxiv | from a healthy male aged 50-55 were obtained from AllCells. Mononuclear cells were isolated using Ficoll gradient and Red Blood Cell Lysis. Plasma cells from the bone marrow were isolated using StemCell EasySepEasySep™ Human CD138 Positive Selection | Full Paper | |
2022 | White, B;de Reyniès, A;Newman, A;Waterfall, J;Lamb, A;Petitprez, F;Valdeolivas, A;Lin, Y;Li, H;Xiao, X;Wang, S;Zheng, F;Yang, W;Yu, R;Guerrero-Gimenez, M;Catania, C;Lang, B;Domanskyi, S;Bertus, T;Piermarocchi, C;Monaco, G;Caruso, F;Ceccarelli, M;Yu, T;Guo, X;Coller, J;Maecker, H;Duault, C;Shokoohi, V;Patel, S;Liliental, J;Simon, S;Saez-Rodriguez, J;Heiser, L;Guinney, J;Gentles, A;Tumor Deconvolution DREAM Challenge consortium, ; | Community assessment of methods to deconvolve cellular composition from bulk gene expression | bioRxiv | Immune and stromal cells provided by StemExpress and AllCells were isolated according to ) and the rest assigned immune cells from AllCells wherever availability allowed (Tables S5 Save Cached | Full Paper | |
2022 | Simmons, S;Lithwick-Yanai, G;Adiconis, X;Oberstrass, F;Iremadze, N;Geiger-Schuller, K;Thakore, P;Frangieh, C;Barad, O;Almogy, G;Rozenblatt-Rosen, O;Regev, A;Lipson, D;Levin, J; | Single cell RNA-seq by mostly-natural sequencing by synthesis | bioRxiv | We purchased 9 cryopreserved human PMBC samples (AllCells). We thawed PBMC vials in a 37C water bath for ∼2 minutes. A quick counting revealed high viability (>90%) in all Save | Full Paper | |
2022 | Seenappa, L;Jakubowski, A;Steinbuck, M;Palmer, E;Haqq, C;Carter, C;Fontenot, J;Villinger, F;McNeil, L;DeMuth, P; | Programming the lymph node immune response with Amphiphile-CpG induces potent cellular and humoral immunity following COVID-19 subunit vaccination in mice and non-human primates | bioRxiv | who had recovered from SARS-CoV-2 infection (COVID-19) were obtained from US Biolab (Rockville, MD) and ALLCELLS (Alameda, CA). All samples were received and stored frozen at −80°C until analysis | Full Paper | |
2022 | Lutter, L;ter Linde, J;Brand, E;van Konijnenburg, D;Roosenboom, B;Talabur-Horje, C;Oldenburg, B;van Wijk, F; | Compartment-driven imprinting of intestinal CD4 (regulatory) T cells in inflammatory bowel disease and homeostasis | bioRxiv | Cluster 1 (18.6% of allcells) was characterized by KLF2, SELL, CCR7, TCF7 and LEF1, and thus resembled recently migrated/recirculating T cells (figure 4A). This cluster contained both intraepithelial and lamina propria T cells (figure 4E). Similarly, | Full Paper | |
2022 | Jaffe, D;Shahi, P;Adams, B;Chrisman, A;Finnegan, P;Raman, N;Royall, A;Tsai, F;Vollbrecht, T;Reyes, D;McDonnell, W; | Functional antibodies exhibit light chain coherence | bioRxiv | We titrated and developed the B cell fractionation panel using 20 million fresh PBMCs (AllCells, catalog # 3050363) from a healthy human donor whose cells were not used to generate Save | Full Paper | |
2022 | Persad, S;Choo, Z;Dien, C;Masilionis, I;Chaligné, R;Nawy, T;Brown, C;Pe’er, I;Setty, M;Pe’er, D; | SEACells: Inference of transcriptional and epigenomic cellular states from single-cell genomics data | bioRxiv | Cryopreserved bone marrow stem/progenitor CD34+ cells from a healthy donor were purchased from AllCells, LLC. (catalog no. ABM022F) and stored in vapor phase nitrogen. Vial was removed from the storage and immediately thawed at 37 °C in a water bath | Full Paper | |
2022 | Stuart, T;Hao, S;Zhang, B;Mekerishvili, L;Landau, D;Maniatis, S;Satija, R;Raimondi, I; | Nanobody-tethered transposition allows for multifactorial chromatin profiling at single-cell resolution | bioRxiv | Cryopreserved healthy donor PBMCs were isolated from mobilized peripheral blood, BMMCs were purchased from AllCells. After thawing into DMEM with 10% FBS, the cells were spun Save | Full Paper | |
2022 | MacMullan, M;Dunn, Z;Qu, Y;Wang, P;Graham, N; | Phospho-proteomic analysis of CAR-T cell signaling following activation by antigen-presenting cancer cells | bioRxiv | cDNAs from BM CD34+, PB CD34+, BM MNCs, PB MNCs and BM MSCs purchased from AllCells (Emeryville, CA, USA) was obtained from a population of positive cells (purity exceeding 95%) collected from five individual donors. The level of cognate cDNA was mea | Full Paper | |
2022 | Dogan, M;Kozhaya, L;Placek, L;Karabacak, F;Yigit, M;Unutmaz, D; | Targeting SARS-CoV-2 infection through CAR-T like bispecific T cell engagers incorporating ACE2 | bioRxiv | Healthy adult blood was obtained from AllCells. PBMCs were isolated using Ficoll-paque plus (GE Health care). CD8 T cells were purified using Dynal CD8 Positive Isolation Kit (from Save | Full Paper | |
2022 | Yashar, W;Curtiss, B;Coleman, D;Van-Campen, J;Kong, G;Macaraeg, J;Estabrook, J;Demir, E;Long, N;Bottomly, D;McWeeney, S;Tyner, J;Druker, B;Maxson, J;Braun, T; | Disruption of the MYC Super-Enhancer Complex by Dual Targeting of FLT3 and LSD1 in Acute Myeloid Leukemia | bioRxiv | Whole bone marrow was obtained (AllCells) and CD34+ cells were selected using CD34 MicroBead Kit (Miltenyi Biotec) according to manufacturer’s instructions. For the colony assay, 500 CD34+ cells were used per replicate and plated in MethoCult™ H4435 | Full Paper | |
2022 | Aksöz, M;Gafencu, G;Stoilova, B;Buono, M;Meng, Y;Jakobsen, N;Metzner, M;Clark, S;Beveridge, R;Thongjuea, S;Vyas, P;Nerlov, C; | Identification and Age-dependent Increase of Platelet Biased Human Hematopoietic Stem Cells | bioRxiv | Fresh BM from healthy young volunteers (21 to 34 years old males) were purchased from AllCells (Berkeley, CA) or Lonza (Lonza Bioscience, Basel, Switzerland). Bone marrow from older donors was obtained from orthoplastic surgery after | Full Paper | |
2022 | Xiang Ping, M;Zhi, H;Aziz, N;Hadri, N;Ghazalli, N;Yusop, N; | Optimization of agarose-alginate hydrogel bead components for encapsulation and transportation of stem cells | Journal of Taibah University Medical Sciences | Stem cells from human exfoliated deciduous teeth (SHED) purchased from AllCells USA were revived from the cryovial and maintained in culture before encapsulation. SHED from Save | Full Paper | |
2022 | Marcisak, EF; | Leveraging single-cell genomics to uncover clinical and preclinical responses to cancer immunotherapy | Thesis | GFP due to transduction with pBMN-IRES-EGFP containing the FcγRIIIA construct. All NK cell lines were cultured as previously described[231]. Fresh healthy donor NK cells were purchased from AllCells (PB012-P). These NK cells were positively selected | Full Paper | |
2022 | Nesterenko, PA; | Characterizing the T cell immune response through the receptor-ligand interaction | Thesis | Cell culture: Cryo preserved peripheral blood mononuclear cells (PBMCs) were commercially purchased (Allcells and Hemacare). PBMCs were thawed in a water bath set to 37C, transferred to 50 mL conical tube, 1 mL of warm R10 media was added drop wise a | Full Paper | |
2022 | Chu, J; | Ligament tissue engineering: assessing differentiation potential of dental follicle cells in a self-assembly three-dimensional organoid model. | Thesis | according to AllCells company regulations, further donor information such gender and exact age was not provided to the purchaser). The PDL-hTERT immortal cell line has already Save | Full Paper | |
2022 | Plasek, LM; | Self-Silencing: An HIV Induced Mechanism for T Cell Quiescence and HIV Latency | Thesis | Peripheral blood mononuclear cells from HIV negative donors were purchased from AllCells. Naive CD4+ T cells were isolated using the EasySepTM Human Naive CD4+ T Cell Save | Full Paper | |
2022 | BOSYKH, D; | Mechanisms and Biological Consequences of Mutual Reprogramming by Melanoma Cells and Normal Dermal Fibroblasts | Thesis | Cell lines and medium Primary human neonatal dermal fibroblasts (NDFs; AllCells, LLC) were combined from three individual donors. NDFs were routinely tested for mycoplasma and confirmed to be negative using the MycoAlert mycoplasma detection kit (Lon | Full Paper | |
2022 | Oostindie, SC;Rinaldi, DA;Zom, GG;Wester, MJ;Paulet, D;Al-Tamimi, K;van der Meijden, E;Scheick, JR;Wilpshaar, T;de Jong, B;Hoff-van den Broek, M;Grattan, RM;Oosterhoff, JJ;Vignau, J;Verploegen, S;Boross, P;Beurskens, FJ;Lidke, DS;Schuurman, J;de Jong, RN; | Logic-gated antibody pairs that selectively act on cells co-expressing two antigens | Nature biotechnology | 35879362 | PBMCs derived from patients with CLL were commercially obtained from Discovery Life Sciences. Characteristics of patients with CLL are summarized in Supplementary Save | Full Paper |
2022 | Schuler, M;Cuppens, K;Ploenes, T;Vanbockrijck, M;Wiesweg, M;Darwiche, K;Schramm, A;Maes, B;Hegedus, B;Schildhaus, H;Hautzel, H;Theegarten, D;Baas, P;Hartemink, K;Du Pont, B;Aigner, C; | LBA37 A randomized, multicentric phase II study of preoperative nivolumab plus relatlimab or nivolumab in patients with resectable non-small cell lung cancer (NEOpredict-Lung) | Annals of Oncology | cology, AstraZeneca, Eisai, Takeda, ZytoVision, Zytomed Systems, Molecular Health; Financial Interests, Institutional, Research Grant: Novartis Oncology; Financial Interests, Personal, Full or part-time Employment: Targos Molecular Pathology Inc.. H. | Full Paper | |
2022 | Baraibar Argota, I;Garcia Rodriguez, A;Salvà Ballabrera, F;Ros Montana, F;Saoudi Gonzalez, N;Comas, R;Castillo, G;Sanchis, M;Hernando Cubero, J;García-Alvarez, A;Capdevila Castillon, J;Martí, M;Landolfi, S;Espin, E;Nuciforo, P;Vivancos, A;Tabernero, J;Elez Fernandez, M; | 332P Impact of the COVID-19 pandemic in the early-onset colorectal cancer (EOCRC) | Annals of Oncology | ersonal, Invited Speaker: Novartis; Financial Interests, Personal, Advisory Board: MSD Oncology, Bayer; Financial Interests, Personal, Other, Consultant: Targos Molecular Pathology GmbH. A. Vivancos: Financial Interests, Personal, Advisory Board: Roc | Full Paper | |
2022 | Lau, D;Khare, S;Stein, MM;Jain, P;Gao, Y;BenTaieb, A;Rand, TA;Salahudeen, AA;Khan, AA; | Integration of tumor extrinsic and intrinsic features associates with immunotherapy response in non-small cell lung cancer | Nature communications | 35831288 | Samples for single-cell multi-omic sequencing were previously frozen dissociated tumor cells (DTCs) (Discovery Life Sciences, Huntsville, AL). DTCs were thawed and Save;xpression analyses were performed on log10-transformed counts. Single-cell mul | Full Paper |
2022 | Leung, DH;Devaraj, S;Goodrich, NP;Chen, X;Rajapakshe, D;Ye, W;Andreev, V;Minard, CG;Guffey, D;Molleston, JP;Bass, LM;Karpen, SJ;Kamath, BM;Wang, KS;Sundaram, SS;Rosenthal, P;McKiernan, P;Loomes, KM;Jensen, MK;Horslen, S;Bezerra, JA;Magee, JC;Merion, RM;Sokol, RJ;Shneider, BL;For ChiLDReN, ; | Serum Biomarkers Correlated with Liver Stiffness Assessed in a Multi-center Study of Pediatric Cholestatic Liver Disease | Hepatology (Baltimore, Md.) | 36069569 | similar distributions of age- and sex-matched children with normal liver biochemistries and without known liver disease served as case controls (Discovery Life Sciences, Save | Full Paper |
2022 | Yap, TA;Gainor, JF;Callahan, MK;Falchook, GS;Pachynski, RK;LoRusso, P;Kummar, S;Gibney, GT;Burris, HA;Tykodi, SS;Rahma, OE;Seiwert, TY;Papadopoulos, KP;Blum Murphy, M;Park, H;Hanson, A;Hashambhoy-Ramsay, Y;McGrath, L;Hooper, E;Xiao, X;Cohen, H;Fan, M;Felitsky, D;Hart, C;McComb, R;Brown, K;Sepahi, A;Jimenez, J;Zhang, W;Baeck, J;Laken, H;Murray, R;Trehu, E;Harvey, CJ; | First-in-Human Phase I/II ICONIC Trial of the ICOS Agonist Vopratelimab Alone and with Nivolumab: ICOS-High CD4 T-Cell Populations and Predictors of Response | Clinical cancer research : an official journal of the American Association for Cancer Research | 35511938 | Full Paper | |
2022 | Shalev, TJ;Gamal El-Dien, O;Yuen, MMS;Shengqiang, S;Jackman, SD;Warren, RL;Coombe, L;van der Merwe, L;Stewart, A;Boston, LB;Plott, C;Jenkins, J;He, G;Yan, J;Yan, M;Guo, J;Breinholt, JW;Neves, LG;Grimwood, J;Rieseberg, LH;Schmutz, J;Birol, I;Kirst, M;Yanchuk, AD;Ritland, C;Russell, JH;Bohlmann, J; | The western redcedar genome reveals low genetic diversity in a self-compatible conifer | Genome research | 36109148 | University of British Columbia; tal.shalev@msl.ubc.ca.++University of British Columbia.++University of British Columbia.++Department of Energy Joint Genome Institute.++Canada's Michael Smith Genome Sciences Centre.++Canada's Michael Smith Genome Scie | Full Paper |
2022 | Cramer, DAT;Franc, V;Caval, T;Heck, AJR; | Charting the Proteoform Landscape of Serum Proteins in Individual Donors by High-Resolution Native Mass Spectrometry | Analytical chemistry | 36074704 | ditions. Experimental Procedures Individual serum samples from six healthy donors were provided by Sanquin Research (Amsterdam, The Netherlands). Serum samples of diseased donors were purchased from Discovery Life Sciences (Columbus, OH, USA). Furth | Full Paper |
2022 | Pawley, DC;Dikici, E;Deo, SK;Raccamarich, P;Fischl, MA;Alcaide, M;Daunert, S; | Rapid Point-of-Care Test Kit for Bacterial Vaginosis: Detection of Vaginolysin and Clue Cells Using Paper Strips and a Smartphone | Analytical chemistry | 35943181 | Purchased patient samples from Discovery Life Sciences confirmed positive for BV were also tested. All patient samples tested showed elevated levels of VLY, indicating a Save | Full Paper |
2022 | Nuti, S;Zhang, Y;Zerrouki, N;Roach, C;Bänfer, G;Kumar, GL;Manna, E;Diezko, R;Kersch, K;Rüschoff, J;Jasani, B; | High interobserver and intraobserver reproducibility among pathologists assessing PD-L1 CPS across multiple indications | Histopathology | 35993150 | Diezko is an employee of Targos Molecular Pathology GmbH, which performed pharmaceutical industry-sponsored professional training for pathologists and clinical trial Save;Biomarkers and Diagnostics, Oncology, Global Medical and Scientific Affairs, | Full Paper |
2022 | Loibl, S;Huang, CS;Mano, MS;Mamounas, EP;Geyer, CE;Untch, M;Thery, JC;Schwaner, I;Limentani, S;Loman, N;Lübbe, K;Chang, JC;Hatschek, T;Tesarowski, D;Song, C;Lysbet de Haas, S;Boulet, T;Lambertini, C;Wolmark, N; | Adjuvant trastuzumab emtansine in HER2-positive breast cancer patients with HER2-negative residual invasive disease in KATHERINE | NPJ breast cancer | 36117201 | es obtained from the pretreatment primary tumor biopsy material (or residual tumor tissue from definitive surgery post-NAST). HER2 status of all samples was centrally assessed in the same laboratory (Targos Molecular Pathology, GmbH [Kassel, Germany] | Full Paper |
2022 | Seok, Y;Yin, Q;Li, R;Mauk, M;Bai, H;Bau, H; | Manually-operated, slider cassette for multiplexed molecular detection at the point of care | Sensors and Actuators B: Chemical | HCV genotype 1 plasma sample (CV900106678051314DD, 69,000,000 IU/mL) for clinical research was purchased from Discovery life science Inc. (Huntsville, AL, USA) | Full Paper | |
2022 | Singampalli, KL;Li, J;Lillehoj, PB; | Rapid magneto-enzyme-linked immunosorbent assay for ultrasensitive protein detection | Analytica chimica acta | 36038242 | falciparum infection obtained in Uganda under IRB/EC approval for general research use were purchased from Discovery Life Sciences. All human samples were de- Save; Blood samples from donors with P. falciparum infection obtained in Uganda under IRB/ | Full Paper |
2022 | Koehler, VF;Adam, P;Fuss, CT;Jiang, L;Berg, E;Frank-Raue, K;Raue, F;Hoster, E;Knösel, T;Schildhaus, HU;Negele, T;Siebolts, U;Lorenz, K;Allelein, S;Schott, M;Spitzweg, C;Kroiss, M;German Study Group for Rare Malignant Tumors of the Thyroid and Parathyroid Glands, ; | Treatment of RET-Positive Advanced Medullary Thyroid Cancer with Multi-Tyrosine Kinase Inhibitors-A Retrospective Multi-Center Registry Analysis | Cancers | 35884466 | US is an employee of Targos Molecular Pathology, Inc., and received honoraria from or served as an advisory board member at Roche, Novartis Oncology, MSD, BMS, Save Cached | Full Paper |
2022 | Molina, SA;Davies, SJ;Sethi, D;Oh, S;Durand, N;Scott, M;Davies, LC;Wormuth, K;Clarke, D; | Particulates are everywhere, but are they harmful in cell and gene therapies? | Cytotherapy | 36175323 | International Society for Cell & Gene Therapy Process Development, Manufacturing, and Analytics Committee, Vancouver, Canada. Electronic address: sam.molina@gmail.com.++International Society for Cell & Gene Therapy Process Development, Manufacturing, | Full Paper |
2022 | Ren, Z;Chen, S;Qin, X;Li, F;Guo, L; | Study of the roles of cytochrome P450 (CYPs) in the metabolism and cytotoxicity of perhexiline | Archives of toxicology | 36083301 | Perhexiline is a prophylactic antianginal agent developed in the 1970s. Although, therapeutically, it remained a success, the concerns of its severe adverse effects Save;- Primary human hepatocytes (pooled from 10 donors) were obtained from Disc | Full Paper |
2022 | Cheng, LY;Dai, P;Wu, LR;Patel, AA;Zhang, DY; | Direct capture and sequencing reveal ultra-short single-stranded DNA in biofluids | iScience | 36147958 | N = 6 plasma samples from diseased individuals (3 from Type 1 Diabetes (T1D) patients and 3 from Alzheimer’s disease (AD) patients) were acquired from BioIVT’s biorepository and shipped frozen. Animal total blood samples were purchased from Discovery | Full Paper |
2022 | Kemper, K;Gielen, E;Boross, P;Houtkamp, M;Plantinga, T;de Poot, S;Burm, S;Janmaat, M;Koopman, L;van den Brink, E;Rademaker, R;Verzijl, D;Engelberts, P;Satijn, D;Sasser, A;Breij, E; | Mechanistic and pharmacodynamic studies of DuoBody-CD3x5T4 in preclinical tumor models | Life Science Alliance | Dissociated tumor cells (DTCs) were procured from commercial vendors (Prisma Health/KIYATEC Biorepository or Discovery Life Sciences) who maintain strict ethical compliance, including fully | Full Paper | |
2022 | Rüschoff, J;Friedrich, M;Nagelmeier, I;Kirchner, M;Andresen, LM;Salomon, K;Portier, B;Sredni, ST;Schildhaus, HU;Jasani, B;Grzelinski, M;Viale, G; | Comparison of HercepTest™ mAb pharmDx (Dako Omnis, GE001) with Ventana PATHWAY anti-HER-2/neu (4B5) in breast cancer: correlation with HER2 amplification and HER2 low status | Virchows Archiv : an international journal of pathology | 35970977 | in HER2 evaluation, having served over the past 20 years as readers in most of the trastuzumab, pertuzumab, and T-DM1 approval BC studies by Targos GmbH (Kassel, Save;Targos - A Discovery Life Sciences Company, Germaniastraße 7, 34119, Kassel, Germ | Full Paper |
2022 | Suwa, R;Kume, Y;Kawase, M;Chishiki, M;Ono, T;Norito, S;Sato, K;Okamoto, M;Kumaki, S;Nagai, Y;Hosoya, M;Takeda, M;Nishimura, H;Hashimoto, K;Shirato, K; | Practical Validation of United States Centers for Disease Control and Prevention Assays for the Detection of Human Respiratory Syncytial Virus in Pediatric Inpatients in Japan | Pathogens (Basel, Switzerland) | 35889999 | To confirm amplification specificity, we used pharyngeal, nasopharyngeal, and nasal swabs from Discovery Life Sciences (Los Osos, CA, USA) that were obtained for the Save Cached | Full Paper |
2022 | Rodrigues, D;van Kampen, R;van Bodegraven, AA;Kleinjans, JCS;Jennen, DGJ;de Kok, TM; | Gene expression responses reflecting 5-FU-induced toxicity: Comparison between patient colon tissue and 3D human colon organoids | Toxicology letters | 36183961 | All patients provided written informed consent. Human colon tissue samples were obtained by Boehringer Ingelheim Pharmaceuticals Inc. (Ridgefield, Connecticut, USA) from Discovery Life Sciences (Huntsville, Alabama, USA; formerly, Conversant Biologic | Full Paper |
2022 | Cao, L;Ledeboer, A;Pan, Y;Lu, Y;Meyer, K; | Clinical enrollment assay to detect preexisting neutralizing antibodies to AAV6 with demonstrated transgene expression in gene therapy trials | Gene therapy | 35778500 | Individual human serum samples were purchased from BioIVT (Westbury, NY, USA), Discovery Life Sciences (Los Osos, CA, USA), and Golden West Biologicals (Temecula, CA, USA) | Full Paper |
2022 | Zhang, L;Wang, Y;Homan, KT;Gaudette, SM;McCluskey, AJ;Chan, Y;Murphy, J;Abdalla, M;Nelson, CM;Sun, VZ;Erickson, JE;Knight, HL;Clabbers, A;Sterman, AJS;Mitra, S; | Imaging the Alternatively Spliced D Domain of Tenascin C in a Preclinical Model of Inflammatory Bowel Disease | Molecular imaging and biology | 35906512 | Clinical IBD colon was evaluated using a biotinylated anti-TNC D antibody. Frozen human tissue was obtained from CHTN (National Cancer Institute, Bethesda, MD), Folio Biosciences (Columbus, OH), and UMASS Memorial Gastroenterology (Worcester, MA) | Full Paper |
2022 | Holmberg, JA;Henry, SM;Burnouf, T;Devine, D;Marschner, S;Boothby, TC;Burger, SR;Chou, ST;Custer, B;Blumberg, N;Siegel, DL;Spitalnik, SL; | National Blood Foundation 2021 Research and Development summit: Discovery, innovation, and challenges in advancing blood and biotherapies | Transfusion | 36169155 | consulting firm, and one of our clients is Discovery Life Sciences, an, apheresis services provider. My advice to DLS is the same as what I say in this manuscript. HemaCare Save | Full Paper |
2022 | Edmonds, NL;Flores, SE;Mahmutovic, A;Young, SJ;Mauldin, IS;Slingluff, CL; | CD103 and periplakin are potential biomarkers for response of metastatic melanoma to pembrolizumab | Melanoma research | 36169985 | QualTek provided a modified proportion score indicating the percent of PD-L1 Qualtek also reported an overall estimate of the presence/absence of tumor-infiltrating Save | Full Paper |
2022 | Kandi, S;Savaryn, JP;Ji, QC;Jenkins, GJ; | Use of In-Sample Calibration Curve approach for quantification of peptides with high resolution Mass Spectrometry | Rapid communications in mass spectrometry : RCM | 35940586 | Human Peripheral Blood Mononuclear Cells (hPBMCs) were purchased from Discovery Life Sciences (Newtown, PA, USA) | Full Paper |
2022 | Boillat, MA;Hauser, PC; | CO2-measuring dongle | HardwareX | 35873734 | 11 2.11 Mouser.com semiconductor U4 Sensirion SCD41-D-R1 1 45.66 45.66 Mouser.com CO2-sensor J1 GCT USB3505-30-A-KIT 1 2.35 2.35 Mouser.com Micro B USB 2.0 socket Qualtek 3025033-1 1 2.97 2.97 Mouser.com | Full Paper |
2022 | Schöniger, S;Rüschoff, J; | Mismatch Repair Deficiency and Microsatellite Instability | Encyclopedia | Targos—A Discovery Life Sciences Company, Germaniastrasse 7, 34119 Kassel, Germany | Full Paper | |
2022 | Li, W;Li, Y;Xu, J;Chen, C;Gu, Y;Lu, Z;Li, D;Li, J;Sorg, A;Roberts, C;Mahajan, S;Gallant, M;Taggart, D; | Multimodal Epigenetic Sequencing Analysis (MESA) of Cell-free DNA for Non-invasive Cancer Detection | Research Square | Cohort 1 subjects were recruited at clinical sites within the United States through the ELITE Study (NCT05181826) or were obtained through the following contract research organizations: BioIVT (Westbury, NY), BioOptions (Brea, CA), Discovery Life Sci | Full Paper | |
2022 | Koerner, L;Yang, T;Schmiel, M;Peifer, M;Buettner, R;Pasparakis, M; | NEMO- and RelA-dependent NF-?B Signaling Promotes Small Cell Lung Cancer | bioRxiv | Small cell lung cancer (SCLC) is an aggressive type of lung cancer driven by combined loss of the tumor suppressors RB1 and TP53. SCLC is highly metastatic and Save Cached | Full Paper | |
2022 | Hebda-Bauer, E;Hagenauer, M;Blandino, P;Meng, F;Chitre, A;Ozel, A;Arakawa, K;Flagel, S;Watson, S;Palmer, A;Li, J;Akil, H; | Transcriptional Profiling of the Hippocampus in an F2 Cross of a Genetic Rat Model of Internalizing vs. Externalizing Behavior and Addiction Liability | bioRxiv | HudsonAlpha Discovery provided a variety of metrics for evaluating sample RNA quality, including RNA concentration (RNAconc), RNA integrity number (RIN), the Save Cached | Full Paper | |
2022 | Chitre, A;Hebda-Bauer, E;Blandino, P;Bimschleger, H;Nguyen, K;Maras, P;Li, F;Ozel, A;Polysskaya, O;Cheng, R;Flagel, S;Watson, S;Li, J;Akil, H;Palmer, A; | Genome-Wide Association Study in a Rat Model of Temperament Identifies Multiple Loci for Exploratory Locomotion and Anxiety-Like Traits | bioRxiv | For these 20 rats, liver tissue was sent to HudsonAlpha Discovery (Discovery Life Sciences) for HMW genomic DNA extraction and long-range and deep sequencing. Save | Full Paper | |
2022 | Dejanovic, B;Wu, T;Tsai, M;Graykowski, D;Gandham, V;Rose, C;Bakalarski, C;Ngu, H;Wang, Y;Pandey, S;Rezzonico, M;Friedman, B;Edmonds, R;De Mazière, A;Rakosi-Schmidt, R;Singh, T;Klumperman, J;Foreman, O;Chang, M;Xie, L;Sheng, M;Hanson, J; | Complement C1q-dependent excitatory and inhibitory synapse elimination by astrocytes and microglia in Alzheimer’s disease mouse models | Nature Aging | CSF from patients with AD and healthy controls was obtained from Folio Biosciences and Precision Medicine with ethics committee approval and written informed consent | Full Paper | |
2022 | Cady, J;Greytak, E; | Whole-genome sequencing of degraded DNA for investigative genetic genealogy | Forensic Science International: Genetics Supplement Series | Samples were submitted to either HudsonAlpha Discovery or Arbor Biosciences for library preparation and sequencing. For each sample, a small amount of the prepared Save | Full Paper | |
2022 | Newman, L;Useckaite, Z;Rowland, A; | Addressing MISEV guidance using targeted LC?MS/MS: A method for the detection and quantification of extracellular vesicle?enriched and contaminant protein markers from blood | Journal of Extracellular Biology | Serum and plasma samples from patients with non-alcoholic fatty liver disease (NAFLD) were purchased from Discovery Life Sciences (Hunstville, AL, USA). Save | Full Paper | |
2022 | D'ANTONIO, L; | Esposizione a paracetamolo e acido sulfosalicilico: effetti biologici nel bivalve Mytilus spp. | Thesis | Francisca Piedade, Sofia Bio, Bruno Nunes. 2020 Effects of common pharmaceutical drugs | Full Paper | |
2022 | Wagner, RS; | Environmental Factors Affecting Rhizophydiales Sp. Infecting Planktothrix Spp. | Thesis | were then sent to HudsonAlpha Discovery Life Sciences (Hudson, AL USA) for sequencing. Sequencing and QC was done at HudsonAlpha Discovery Life Sciences using Save;- then sent to HudsonAlpha Discovery Life Sciences (Hudson, AL USA) for sequencin | Full Paper | |
2022 | Ferreira Garcia Rodrigues, D; | Gut feelings | maastricht university | Human healthy colon organoids were derived from a tissue biopsy collected from a healthy male donor (67 years old) and kindly provided by Boehringer Ingelheim Pharmaceuticals Inc. (Ridgefield, USA), who purchased tissue biopsies from Discovery Life S | Full Paper | |
2022 | Fang, G; | The use of perfusion MRI using ferumoxytol and small molecular weight gadolinium (Gd) agents to assess response to pembrolizumab in brain metastases and systemic lesions in NSCLC: A comparison of imaging modalities to address brain metastases, pseudoprogression and systemic lesion tumor flare (neuro-check pilot) | Thesis | Tissue samples will be sent to QualTek Molecular Laboratories for PD-L1 biomarker Brain Tissue samples will also be sent to QualTek Molecular Laboratories for PD-1 Save | Full Paper | |
2022 | Isakoff, SJ; | DF/HCC Protocol#: 17-328 TITLE: A Phase 1b Study of Safety and Immune Response to PVX-410 Vaccine Alone and in Combination with Pembrolizumab | webctportal.partners.org | Primary tumor slides will be evaluated for expression of PD-L1 using the Merck Preferred Vendor QualTek according to their standard procedures. A | Full Paper | |
2022 | Frankovi?, J; | Koncerti hrvatskih autora za violon?elo i orkestar | Thesis | Makedonskog teatra te je osniva? komornog ansambla za suvremenu glazbu „Sveta Sofia“. Bio je jedan od najplodnijih jugoslavenskih skladatelja srednje generacije te se okušao u svim stvarala?kim sferama | Full Paper | |
2022 | Yang, SYC; | The Molecular Determinants of Response to Immune Checkpoint Therapy in Solid Tumors | Thesis | on 4-5?m sections mounted on positively charged ProbeOn slides (QualTek, Goleta, CA). QualTek provided a modified proportion score (MPS) indicating the proportion of Save | Full Paper | |
2022 | Shen, Y;Guo, K;Ma, A;Huang, Z;Du, J;Chen, J;Lin, Q;Wei, C;Wang, Z;Zhang, F;Zhang, J;Lin, W;Feng, N;Ma, W; | Mitochondrial toxicity evaluation of traditional Chinese medicine injections with a dual in vitro approach | Frontiers in pharmacology | 36408232 | and Health Sciences, Wuyi University, Jiangmen, China 3 Antibody Engineering Laboratory, School of Life Science & Technology, China Pharmaceutical University, Nanjing, China Edited by: Albert P. Li, In Vitro ADMET Laboratories, United States Review | Full Paper |
2022 | Tiu, C;Lopez, J; | Lisavanbulin. Microtubule destabilizer (tubulin polymerization inhibitor), Tumor checkpoint controller, Treatment of advanced glioblastoma multiforme | Drugs of the Future | Assessment of 108 clinical trial samples from NCT02490800, using a CE-marked immunohistochemistry Clinical Trial Assay (CTA; Targos Molecular Pathology GmbH, Save | Full Paper | |
2022 | Drapkin, R;Jung, E;Bradshaw, C;Demars, L;Mosher, R; | EP014/#408?Evaluation of NAPI2B expression in a well annotated longitudinal tissue series of ovarian serous carcinomas | E-Posters | IHC analyses were performed by QualTek Molecular Laboratories (Discovery Life Sciences). Editorial support for this poster was provided by BluPrint Oncology. Save | Full Paper | |
2022 | Korner, LK; | Cell death and inflammation in skin homeostasis and small cell lung cancer | Thesis | R.B. is an employee of Targos Molecular Pathology. The other authors declare no competing interests | Full Paper | |
2022 | Weng, H;Huang, F;Yu, Z;Chen, Z;Prince, E;Kang, Y;Zhou, K;Li, W;Hu, J;Fu, C;Aziz, T;Li, H;Li, J;Yang, Y;Han, L;Zhang, S;Ma, Y;Sun, M;Wu, H;Zhang, Z;Wunderlich, M;Robinson, S;Braas, D;Hoeve, JT;Zhang, B;Marcucci, G;Mulloy, JC;Zhou, K;Tao, HF;Deng, X;Horne, D;Wei, M;Huang, H;Chen, J; | The m6A reader IGF2BP2 regulates glutamine metabolism and represents a therapeutic target in acute myeloid leukemia | Cancer cell | 36306790 | Bone marrow (BM) cells were collected from 5- to 7-week-old wild-type, Mettl14fl/flCreERT, or Igf2bp2fl/fl mice, and BM progenitor (HSPC, i.e., Lin- or c-kit+) cells were enriched with the Mouse Lineage Cell Depletion Kit or the CD117 microbeads (Mil | Full Paper |
2022 | Wei, J;Montalvo-Ortiz, W;Yu, L;Krasco, A;Olson, K;Rizvi, S;Fiaschi, N;Coetzee, S;Wang, F;Ullman, E;Ahmed, HS;Herlihy, E;Lee, K;Havel, L;Potocky, T;Ebstein, S;Frleta, D;Khatri, A;Godin, S;Hamon, S;Brouwer-Visser, J;Gorenc, T;MacDonald, D;Hermann, A;Chaudhry, A;Sirulnik, A;Olson, W;Lin, J;Thurston, G;Lowy, I;Murphy, AJ;Smith, E;Jankovic, V;Sleeman, MA;Skokos, D; | CD22-targeted CD28 bispecific antibody enhances antitumor efficacy of odronextamab in refractory diffuse large B cell lymphoma models | Science translational medicine | 36350988 | For the NALM6-luc tumor experiments, 12-week-old female immunodeficient NSG mice (Jackson Laboratory, 005557) were engrafted with 4 × 10 6 human PBMCs (ReachBio), and Save | Full Paper |
2022 | Devoucoux, M;Fort, V;Khelifi, G;Xu, J;Alerasool, N;Galloy, M;Wong, N;Bourriquen, G;Fradet-Turcotte, A;Taipale, M;Hope, K;Hussein, SMI;Côté, J; | Oncogenic ZMYND11-MBTD1 fusion protein anchors the NuA4/TIP60 histone acetyltransferase complex to the coding region of active genes | Cell reports | 35705031 | Recombinant Mouse TPO PeproTech Cat# AF-315-14 Recombinant Mouse IL-3 R&D Systems Cat# 403-ML-050 Recombinant Mouse IL-6 R&D Systems Cat# 406-ML-025 ColonyGEL, Mouse Complete Medium ReachBio Cat# 1202 SFEM II Media STEMCELL Technologies Cat# 09655 | Full Paper |
2022 | Peterson, CW;Venkataraman, R;Reddy, SS;Pande, D;Enstrom, MR;Radtke, S;Humbert, O;Kiem, HP; | Intracellular RNase activity dampens zinc finger nuclease-mediated gene editing in hematopoietic stem and progenitor cells | Molecular therapy. Methods & clinical development | 34977270 | nces, San José, CA) into D-PBS, followed by total genomic DNA extraction and NGS. Colony-forming assays ZFN- or CRISPR/Cas9-treated NHP cells (1.2 × 103) were plated in 3.6 mL of ColonyGEL 1402 (ReachBio, Seattle, WA). For colony-forming assays util | Full Paper |
2022 | Liu, L;Li, H;Patterson, AM;Plett, PA;Sampson, CH;Mohammad, KS;Capitano, ML;Singh, P;Yao, C;Orschell, CM;Pelus, LM; | Upregulation of SIRT1 Contributes to dmPGE2-dependent Radioprotection of Hematopoietic Stem Cells | Stem cell reviews and reports | 35318613 | Colony forming cells were analyzed as described [20]. Total nucleated BM cells from non-irradiated mice were plated at 2 × 104 per dish in Mouse Complete Colony Gel media (Reach Bio, Seattle, WA). BM cells from irradiated C57BL/6 mice were plated at | Full Paper |
2022 | Canals Hernaez, D;Hughes, MR;Li, Y;Mainero Rocca, I;Dean, P;Brassard, J;Bell, EM;Samudio, I;Mes-Masson, AM;Narimatsu, Y;Clausen, H;Blixt, O;Roskelley, CD;McNagny, KM; | Targeting a Tumor-Specific Epitope on Podocalyxin Increases Survival in Human Tumor Preclinical Models | Frontiers in oncology | 35600398 | Linker stability was independently assessed by ReachBio Research Labs (RRL, www.reachbio.com) using an in vitro neutrophil differentiation killing assay, where extracellular Save;Emer Clarke at ReachBio Research Labs (www.reachbio.com) for providin | Full Paper |
2022 | Lefavor, R;Clarke, E; | The Effect of Various Stimulants on Cytokine Secretion Profiles in Freshly Isolated Peripheral Blood Mononuclear Cells (PBMC) | The Journal of Immunology | 1ReachBio Research Labs++1ReachBio Research Labs | Full Paper | |
2022 | Gu, Q;Palani, CD;Smith, A;Li, B;Amos-Abanyie, EK;Ogu, U;Lu, L;Pace, BS;Starlard-Davenport, A; | MicroRNA29B induces fetal hemoglobin via inhibition of the HBG repressor protein MYB in vitro and in humanized sickle cell mice | Frontiers in medicine | 36507536 | kville, MD, USA) was used alone or co-transfected with MIR29B. Erythroid differentiation of human CD34+ stem cells and microRNA29B co-electroporation with MYB DNA Human bone marrow CD34+ stem cells (ReachBio, Seattle, WA, USA) were cultured in a mod | Full Paper |
2022 | Balk, R;Esper, A;Martin, G;Miller, R;Lopansri, B;Burke, J;Levy, M;Opal, S;Rothman, R;D'Alessio, F;Sidhaye, V;Aggarwal, N;Greenberg, J;Yoder, M;Patel, G;Gilbert, E;Parada, J;Afshar, M;Kempker, J;van der Poll, T;Schultz, M;Scicluna, B;Klein Klouwenberg, P;Liebler, J;Blodget, E;Kumar, S;Navalkar, K;Yager, T;Sampson, D;Kirk, J;Cermelli, S;Davis, R;Brandon, R; | Validation of SeptiCyte RAPID to discriminate sepsis from non-infectious systemic inflammation | medRxiv | The authors thank the clinical study coordinators of the NEPTUNE study: Joyce D. Brown (Rush University), Liliacna Jara (University of Southern California), Leona Wells and Maya C. Whaley (Grady Memorial Hospital). The authors also thank the laborato | Full Paper | |
2022 | Vujovic, A;de Rooij, L;Chahi, A;Chen, H;Yee, B;Loganathan, S;Liu, L;Chan, D;Tajik, A;Tsao, E;Moreira, S;Joshi, P;Xu, J;Wong, N;Zandi, S;Aigner, S;Dick, J;Minden, M;Schramek, D;Yeo, G;Hope, K; | A two-step in vivo CRISPR screen unveils pervasive RNA binding protein dependencies for leukemic stem cells and identifies ELAVL1 as a therapeutic target | bioRxiv | Thawed primary AML samples were counted and plated in a methylcellulose-based hematopoietic colony formation medium (Colony Gel, ReachBio), supplemented with DMSO or 1.1uM DHTS. Colonies were scored on days 10-14. Human CB samples were | Full Paper | |
2022 | Keyvani Chahi, A; | CHARACTERIZING THE ROLE OF THE TRANSCRIPTION FACTOR PLAG1 IN HUMAN HEMATOPOIETIC STEM AND PROGENITOR CELLS | Thesis | Rapamycin 50nM Cedarlane/MedChemExpr ess HY-10219 ColonyGEL™ 1102 1X Reachbio 1102 Sterile, Blunt-End Needles, 16 Gauge with Luer Lock NA StemCell Technologies 28110 | Full Paper | |
2022 | Stuart, WR; | Inhibition of Embryonic Ectoderm Development as a Novel Mechanism for Fetal Hemoglobin Induction in Sickle Cell Disease | Thesis | Gating and analysis were performed on FlowJo. Single cells were gated using FSC H vs FSC A. CD235a vs CD71 double positive cells were used for HbF analysis through recommendation from ReachBio as these are the hemoglobin expressing cells within the p | Full Paper | |
2021 | Schneider, BP;Jiang, G;Ballinger, TJ;Shen, F;Chitambar, C;Nanda, R;Falkson, C;Lynce, FC;Gallagher, C;Isaacs, C;Blaya, M;Paplomata, E;Walling, R;Daily, K;Mahtani, R;Thompson, MA;Graham, R;Cooper, ME;Pavlick, DC;Albacker, LA;Gregg, J;Solzak, JP;Chen, YH;Bales, CL;Cantor, E;Hancock, BA;Kassem, N;Helft, P;O'Neil, B;Storniolo, AMV;Badve, S;Miller, KD;Radovich, M; | BRE12-158: A Postneoadjuvant, Randomized Phase II Trial of Personalized Therapy Versus Treatment of Physician's Choice for Patients With Residual Triple-Negative Breast Cancer | Journal of clinical oncology : official journal of the American Society of Clinical Oncology | 34910554 | Speakers' Bureau: Genomic Health, Targos Molecular Pathology, Agilent | Full Paper |
2021 | Vergote, I;González-Martín, A;Ray-Coquard, I;Harter, P;Colombo, N;Pujol, P;Lorusso, D;Mirza, MR;Brasiuniene, B;Madry, R;Brenton, JD;Ausems, MGEM;Büttner, R;Lambrechts, D;European experts’ consensus group, ; | European experts consensus: BRCA/homologous recombination deficiency testing in first-line ovarian cancer | Annals of oncology : official journal of the European Society for Medical Oncology | 34861371 | Testifying Advisor for MSD in GBA-assessment for Pembrolizumab, Advisor for Durvalumab. Co-Founder and CSO for Targos Molecular Pathology, Kassel/Germany until April 2021. DL: Consulting (2019-2021): AstraZeneca (2019-2021); BMS (2019); | Full Paper |
2021 | Voors-Pette, C;Aalders, W;Brill, M;Ferrari, D;Annis, A;Steidl, U;Aivado, M;Vukovic, V; | 1791P A phase I pharmacology study of the dual MDMX/MDM2 inhibitor, ALRN 6924, in healthy volunteers | Annals of Oncology | We thank the subjects who participated in these studies; Discovery Life Sciences in Newtown, PA; and Eric Smith for graphical assistance | Full Paper | |
2021 | Han, GR;Jang, H;Ki, H;Lee, H;Kim, MG; | Reagent Filming for Universal Point-of-Care Diagnostics | Small methods | 34928024 | A/B were purchased from Discovery Life Sciences (Los Osos, CA). T | Full Paper |
2021 | de Klerk, LK;Patel, AK;Derks, S;Pectasides, E;Augustin, J;Uduman, M;Raman, N;Akarca, FG;McCleary, NJ;Cleary, JM;Rubinson, DA;Clark, JW;Fitzpatrick, B;Brais, LK;Cavanaugh, ME;Rode, AJ;Jean, MG;Lizotte, PH;Nazzaro, MJ;Severgnini, M;Zheng, H;Fuchs, CS;Enzinger, PC;Bass, AJ; | Phase II study of pembrolizumab in refractory esophageal cancer with correlates of response and survival | Journal for immunotherapy of cancer | 34593617 | PD-L1 immunohistochemistry was performed on pretreatment FFPE tissue slides using a laboratory developed assay (QualTek Molecular Laboratories, Newtown, Pennsylvania, USA) with the anti-PD-L1 22C3 antibody (Merck & Co, Palo Alto, California, USA). | Full Paper |
2021 | Vowell, K;Conner, M;Perrin, F;Bojczuk, P;Hance, K;Roth, I;Donahue, C;Smothers, J;Waight, J; | 662 Dissecting the CD226 immune axis in the tumor microenvironment using CyTOF-based high-dimensional immunophenotyping | Journal for ImmunoTherapy of Cancer | Ethics Approval All samples were purchased from Discovery Life Sciences (DLS). DLS represents and warrants that it has ownership of all Products available for sale and has properly obtained, where required under HHS/OHRP 45 CFR 46.102 (d) (f), IRB | Full Paper | |
2021 | Binnewies, M;Pollack, JL;Rudolph, J;Dash, S;Abushawish, M;Lee, T;Jahchan, NS;Canaday, P;Lu, E;Norng, M;Mankikar, S;Liu, VM;Du, X;Chen, A;Mehta, R;Palmer, R;Juric, V;Liang, L;Baker, KP;Reyno, L;Krummel, MF;Streuli, M;Sriram, V; | Targeting TREM2 on tumor-associated macrophages enhances immunotherapy | Cell reports | 34686340 | Human tumor samples used for both flow cytometry and single-cell RNA sequencing were acquired from Discovery Life Sciences. 49 human tumor samples were used for flow cytometric analysis of immune composition and TREM2 surface levels. 10 human tumor | Full Paper |
2021 | Ma, J;Tan, X;Kwon, Y;Delgado, ER;Zarnegar, A;DeFrances, MC;Duncan, AW;Zarnegar, R; | A Novel Humanized Model of NASH and Its Treatment With META4, A Potent Agonist of MET | Cellular and molecular gastroenterology and hepatology | 34756982 | Background & Aims Nonalcoholic fatty liver disease is a frequent cause of hepatic dysfunction and is now a global epidemic. This ailment can progress to an advanced form called nonalcoholic steatohepatitis (NASH) and end-stage liver disease. Curren | Full Paper |
2021 | Bassez, A;Vos, H;Van Dyck, L;Floris, G;Arijs, I;Desmedt, C;Boeckx, B;Vanden Bempt, M;Nevelsteen, I;Lambein, K;Punie, K;Neven, P;Garg, AD;Wildiers, H;Qian, J;Smeets, A;Lambrechts, D; | A single-cell map of intratumoral changes during anti-PD1 treatment of patients with breast cancer | Nature medicine | 33958794 | combined with an intensity score, which represents the average intensity of positive tumor cells (0, none; 1, weak, 2, intermediate; 3, strong). PD-L1 (Merck 22C3 antibody) immunohistochemistry was performed by Qualtek Molecular Laboratories as per a | Full Paper |
2021 | Yuki, S;Nakamura, Y;Taniguchi, H;Denda, T;Nishina, T;Hamamoto, Y;Hara, H;Esaki, T;Kawakami, H;Takashima, A;Satoh, T;Sunakawa, Y;Masuishi, T;Shinozaki, E;Moriwaki, T;Miki, I;Shitara, K;Yoshino, T; | Expression of PD-L1 and PD-L2 in colorectal cancer (CRC): A post-hoc integrated analysis of SCRUM-Japan GI-SCREEN CRC. | Journal of Clinical Oncology | Patients (Pts) with MSI-H or BRAF V600E mutant tumors were prioritized to be included. PD-L1 (22C3) and PD-L2 expressions were centrally assessed using immunohistochemical assays at QualTek and NeoGenomics, respectively | Full Paper | |
2021 | Ho, CSL;Tüns, AI;Schildhaus, HU;Wiesweg, M;Grüner, BM;Hegedus, B;Schuler, M;Schramm, A;Oeck, S; | HER2 mediates clinical resistance to the KRASG12C inhibitor sotorasib, which is overcome by co-targeting SHP2 | European journal of cancer (Oxford, England : 1990) | 34715459 | HUS is an employee of Targos Molecular Pathology, Inc.; received research grants (outside this study) from Novartis Oncology; and received honoraria and advisory board services from MSD, BMS, Roche Pharma, Novartis Oncology, ZytoVision, Eisai and P | Full Paper |
2021 | Israeli, S;Golden, A;Atalig, M;Mekki, N;Rais, A;Storey, H;Barbouche, MR;Peck, R; | A Novel Point-of-Care Rapid Diagnostic Test for Screening Individuals for Antibody Deficiencies | Journal of clinical immunology | 34839430 | These thirty-three specimens were acquired from Discovery Life Sciences (Los Osos, CA, USA) with IgG concentration characterized by Siemens BN II System nephelometer (Siemens Healthcare GmbH, Erlangen, Germany). IgG levels in the chosen samples Sa | Full Paper |
2021 | Cheng, Y;Hall, TR;Xu, X;Yung, I;Souza, D;Zheng, J;Schiele, F;Hoffmann, M;Mbow, ML;Garnett, JP;Li, J; | Targeting uPA-uPAR interaction to improve intestinal epithelial barrier integrity in inflammatory bowel disease | EBioMedicine | 34933179 | anoids isolation and culture Isolation and culture of primary intestinal organoids was performed as previously described.2223 Briefly, human small intestinal tissues (obtained from Coversant Bio, now Discovery Life Sciences, https://www.dls.com/biosp | Full Paper |
2021 | Cheng, L;Creasy, T;Pilataxi, F;Greenlees, L;Vence, L;Sridhar, S;Streicher, K; | Effects of combination treatment with durvalumab plus tremelimumab on the tumor microenvironment in non-small-cell lung carcinoma | Cancer immunology, immunotherapy : CII | 34623465 | Frozen NSCLC tumor digests (untreated patients, three squamous cell carcinomas and one adenocarcinoma) were purchased from Discovery Life Sciences and cultured in 96-well plates in a medium containing low-dose interleukin 2 (IL-2) plus 20 µg/mL D a | Full Paper |
2021 | Bröske, AE;Korfi, K;Belousov, A;Wilson, S;Ooi, CH;Bolen, CR;Canamero, M;Alcaide, EG;James, I;Piccione, EC;Carlile, DJ;Dimier, N;Umaña, P;Bacac, M;Weisser, M;Dickinson, M; | Pharmacodynamics and molecular correlates of response to glofitamab in relapsed/refractory non-Hodgkin lymphoma | Blood advances | 34941996 | Biopsies were sent to the central pathology laboratory (Targos Molecular Pathology GmbH, Kassel, Germany) and fresh tissues were embedded on receipt. All biopsies were quality checked by a pathologist on hematoxylin and eosin (H&E) staining | Full Paper |
2021 | Howard, FM;Villamar, D;He, G;Pearson, AT;Nanda, R; | The emerging role of immune checkpoint inhibitors for the treatment of breast cancer | Expert opinion on investigational drugs | 34569400 | PD-L1 status was initially assessed with the QualTek PD-L1 assay and subsequently with the Dako 22C3 PD-L1 assay (with With re-analysis of PD-L1 status, seven patients who had tested positive with the QualTek assay were negative by the 22C3 assay | Full Paper |
2021 | Manos, J;Preiss, C;Venkat, N;Tamm, J;Reinhardt, P;Kwon, T;Wu, J;Winter, A;Jahn, T;Yanamandra, K;Titterton, K;Karran, E;Langlois, X; | UNCOVERING SPECIFICITY OF ENDOGENOUS TAU AGGREGATION IN A HUMAN IPSC-NEURON TAU SEEDING MODEL | iScience | (Braak stage V/VI) and non-AD (Braak stage 0/I) male and female donors used in preparing sarkosyl-insoluble tau seeds were generously provided by the Massachusetts Alzheimer's Disease Research Center or purchased from Folio (now Discovery Life Scie | Full Paper | |
2021 | Da Mesquita, S;Papadopoulos, Z;Dykstra, T;Brase, L;Farias, FG;Wall, M;Jiang, H;Kodira, CD;de Lima, KA;Herz, J;Louveau, A;Goldman, DH;Salvador, AF;Onengut-Gumuscu, S;Farber, E;Dabhi, N;Kennedy, T;Milam, MG;Baker, W;Smirnov, I;Rich, SS;Dominantly Inherited Alzheimer Network, ;Benitez, BA;Karch, CM;Perrin, RJ;Farlow, M;Chhatwal, JP;Holtzman, DM;Cruchaga, C;Harari, O;Kipnis, J; | Meningeal lymphatics affect microglia responses and anti-Aβ immunotherapy | Nature | 33911285 | FC-404-2001) cartridges. Processing of total RNA extracted from mouse meningeal LECs (including linear RNA amplification and cDNA library generation) and RNA-seq was performed by HudsonAlpha Genomic Services Laboratory. For bulk RNA-seq experiments w | Full Paper |
2021 | Matusz-Fisher, A;Tan, AR; | Combination of HER2-targeted agents with immune checkpoint inhibitors in the treatment of HER2-positive breast cancer | Expert opinion on biological therapy | 34806498 | PD-L1-positivity was defined as staining in ≥ 1% of tumor cells or any staining in the stroma using the QualTek immunohistochemistry (IHC) assay. Of note, the assay was changed to the Dako IHC 22C3 pharmDx Q 2 Solutions assay mid-trial due to the p | Full Paper |
2021 | Luk, KC;Gersch, J;Harris, BJ;Holzmayer, V;Mbanya, D;Sauleda, S;Rodgers, MA;Cloherty, G; | More DNA and RNA of HBV SP1 splice variants are detected in genotypes B and C at low viral replication | Scientific reports | 34903774 | genotyping through the Abbott Global Surveillance Program38. All other plasma specimens sourced from France, Germany, Italy, Spain and Vietnam with known viral loads and genotypes were purchased from Discovery Life Sciences (Huntsville, AL). HBV DNA | Full Paper |
2021 | Connolly, P;Stapleton, S;Mosoyan, G;Fligelman, I;Tonar, YC;Fleming, F;Donovan, MJ; | Analytical validation of a multi-biomarker algorithmic test for prediction of progressive kidney function decline in patients with early-stage kidney disease | Clinical proteomics | 34789168 | one specimens collected from patients receiving treatment with biologic therapeutic TNF-α inhibitors used to treat rheumatoid and psoriatic arthritis and other auto-immune diseases were sourced from Discovery Life Sciences (Huntsville, AL). Specimens | Full Paper |
2021 | Jöhrens, K;Rüschoff, J; | The Challenge to the Pathologist of PD-L1 Expression in Tumor Cells of Non-Small-Cell Lung Cancer-An Overview | Current oncology (Toronto, Ont.) | 34940076 | Institute of Pathology, Carl Gustav Carus University Hospital Dresden, 01307 Dresden, Germany.++Targos Molecular Pathology GmbH, 34119 Kassel, Germany | Full Paper |
2021 | Hou, X;Wang, G;Fan, W;Chen, X;Mo, C;Wang, Y;Gong, W;Wen, X;Chen, H;He, D;Mo, L;Jiang, S;Ou, M;Guo, H;Liu, H; | T-cell receptor repertoires as potential diagnostic markers for patients with COVID-19 | International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases | 34688948 | ad recovered from COVID-19. In the COVID-19-BWNW group, whole blood samples were collected at Bloodworks Northwest (Seattle, WA, USA). In the COVID-19-DLS group, whole blood samples were collected at Discovery Life Sciences (Huntsville, AL, USA). In | Full Paper |
2021 | Brosius, C;Caron, K;Sosnoff, C;Blount, B;Wang, L; | Rapid Development and Validation of a Liquid Chromatography-Tandem Mass Spectrometry Method to Measure Cannabinoids in Bronchoalveolar-Lavage Fluid of Patients with e-Cigarette, or Vaping, Product Use-Associated Lung Injury | ACS Omega | BAL pools were created using anonymous BAL samples acquired commercially from Discovery Life Sciences (Huntsville, AL). They were shipped frozen on dry ice and then stored in −70 C freezers until analyzed. Ten individual BAL fluids were screened fo | Full Paper | |
2021 | Sun, Q;Pastor, L;Du, J;Powell, MJ;Zhang, A;Bodmer, W;Wu, J;Zheng, S;Sha, MY; | A novel xenonucleic acid-mediated molecular clamping technology for early colorectal cancer screening | PloS one | 34610014 | give an average DNA fragment length of about 150 bp, which mimics the size of cfDNA fragments, justifying their use as cfDNA references. Except for the 10 CRC whole blood samples were purchased from Discovery Life Sciences (Huntsville, AL, US), All | Full Paper |
2021 | Pound, H;Gann, E;Wilhelm, S; | A comparative study of metatranscriptomic assessment methods to characterize Microcystis blooms | Limnology and Oceanography: Methods | Extracted RNA was processed using a Illumina Stranded Total RNA Prep, Ligation with Ribo-Zero Plus and then 50-million 100-bp paired-end reads were generated on the Illumina NovaSeq platform at Hudson Alpha Discovery Life Sciences (Huntsville, Sa | Full Paper | |
2021 | Miao, LY;Kim, HJ;Whitlatch, K;Jaiswal, D;Navarro, A;Egan, R;Olivo, PD; | A rapid homogenous bioassay for detection of thyroid-stimulating antibodies based on a luminescent cyclic AMP biosensor | Journal of immunological methods | 34871593 | TSI-positive serum samples were a kind gift of Dr. George Kahaly. Anti-thyroid peroxidase (TPO) antibody-positive human serum samples and nonthyroidal autoimmune disease state human serum samples were obtained from Discovery Life Science (Los Osos, C | Full Paper |
2021 | Nuovo, G;Suster, D;Tili, E;Awad, H;Magro, C; | A Standardization Protocol for the In Situ Detection of SARS-CoV2 RNA and Proteins | Applied Immunohistochemistry & Molecular Morphology | vid MD‡; Tili, Esmerina PhD§; Awad, Hamdy MD§; Magro, Cynthia MD∥ Author Information __ *Ohio State University Comprehensive Cancer Center §Ohio State University Medical Center, Columbus †Discovery Life Sciences, Powell, OH ‡Department of Patholo | Full Paper | |
2021 | Nguyen, M;Gary, J;Sonoda, J;Low, M;Ring, C;Bishop, J; | Feasibility of Lateral Flow Assays for Urinary Biomarkers to Nicotine Delivery Products | OSF PREPRINTS2021 | A prospective collection of 212 individual urine specimens from users and non-nicotine users was completed between July 2020 and April 2021 by Discovery Life Sciences (Los Osos, CA). All enrollees selfidentified as non-users (112 samples) or single | Full Paper | |
2021 | Zhang, L;Pohl, C;Homan, K;Sun, V;Gaudette, S;Nelson, C;Erickson, J;Knight, H;Bose, S;Lynch, G;McRae, B;Sterman, A;Mitra, S; | Imaging the Alternatively Spliced D Domain of Tenascin C in Preclinical Models of Inflammatory Bowel Disease | Research Square | Clinical IBD and diseased cynomolgus macaque colon were evaluated using a biotinylated anti-TNC D antibody. Frozen human tissue was obtained from CHTN (National Cancer Institute, Bethesda, MD), Folio Biosciences (Columbus, OH), and UMASS Memorial Gas | Full Paper | |
2021 | Kehl, F;Cretu, V;Willis, P; | Open-source lab hardware: Driver and temperature controller for high compliance voltage, fiber-coupled butterfly lasers | HardwareX | We recommend applying 12 VDC at the voltage input (VIN), eg, by connecting a wall adapter with sufficient power such as the Qualtek QFWB-65-12-US01, which can provide up to 5 A at 12 VDC. The input voltage is directly fed into a voltage regulator ( | Full Paper | |
2021 | Lockhart, JW;Jacobs, AZ; | Scientific Argument with Supervised Learning | NeurIPS 2021 AI for Science Workshop | ML for scientific discovery Life sciences often advance through creating and testing taxonomies or classifications of entities. Statistical methods to evaluate the theorized differences between groups offer the opportunity to validate such classifi | Full Paper | |
2021 | Hair, J;Robinson, MJ;Wilkinson, RW;Dovedi, SJ; | Deep phenotyping of surface stimulatory and inhibitory co-receptors on cancer-resident T and NK cells reveals cell subsets within the tumor-reactive CTL population that are uniquely defined by NKG2A expression | SLAS Discovery | Disaggregated tumor cells (DTC; Discovery Life Sciences), which are a single-cell suspension of enzymatically-dissociated tumor tissue, from NSCLC (n=13), RC (n=10) and melanoma (n=10) patients were used. Detailed per-patient disease classification | Full Paper | |
2021 | Edmund, M; | RISING STARS | Quality Progress | Quality associate, lead auditor, Discovery Life Sciences (DLS), Powell, OH | Full Paper | |
2021 | Valle, J;Kelley, R;Nervi, B;Oh, D;Zhu, A; | Biliary tract cancer | The Lancet | In KEYNOTE-028 PD-L1 positivity was defined as membranous PD-L1 expression in at least 1% of tumour and associated inflammatory cells, or positive staining in stroma (immunohistochemistry assay, QualTek, Goleta, CA, USA), and all patients were PD-L1 | Full Paper | |
2021 | Tiu, C;Derby, S;Haris, N;Welsh, L;Stansfeld, A;Hundsberger, T;Roth, P;König, F;Eisner, J;Kleinschmidt, M;Anderson, S;Bachmann, F;Lane, H;Engelhardt, M;Kaindl, T;Litherland, K;Stan, A;Evans, T;Plummer, E;Lopez, J; | The potential utility of end-binding protein 1 (EB1) as response-predictive biomarker for lisavanbulin: A phase 2 study of lisavanbulin (BAL101553) in adult patients with recurrent glioblastoma. | Journal of Clinical Oncology | Gallen, Switzerland; Department of Neurology, University Hospital Zurich, Zurich, Switzerland; Targos Molecular Pathology GmbH, Kassel, Germany; GeneCentric Therapeutics, Inc., Research Triangle Park, NC; Basilea Pharmaceutica International Ltd., Bas | Full Paper | |
2021 | Skowronska, M;Tiu, C;Tzankov, A;König, F;Lewis, J;Vivanco, I;Kleinschmidt, M;Beebe, K;Anderson, S;Bachmann, F;Engelhardt, M;Lane, H;Kaindl, T;Stan, A;Plummer, E;Evans, T;Zlobec, I;Lopez, J; | Expression of end-binding protein 1 (EB1), a potential response-predictive biomarker for lisavanbulin, in glioblastoma and various other solid tumor types. | Journal of Clinical Oncology | for articles by this author. Show More Institute of Pathology, University of Bern, Bern, Switzerland; The Royal Marsden NHS Foundation Trust, Sutton, United Kingdom; Institute of Pathology, University Hospital Basel, Basel, Switzerland; Targos Molecu | Full Paper | |
2021 | Pratto, F;Brick, K;Cheng, G;Lam, KG;Cloutier, JM;Dahiya, D;Wellard, SR;Jordan, PW;Camerini-Otero, RD; | Meiotic recombination mirrors patterns of germline replication in mice and humans | Cell | 34260899 | Human testicular biopsy from cancer patient (Normal adjacent tissue) Folio Biosciences now Discovery Life Sciences biospecimen bank https://www.dls.com | Full Paper |
2021 | Scoazec, J;Bauchet, A;Adam, J;Rochaix, P;MacGrogan, G;Kim, J;Nuciforo, P;López-Rios, F;Frisman, D;Cesarone, G;Bernstein, S;Lee, J;Henry, C;Ozoux, M;Lefebvre, A; | 1313P Carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) tumor expression in a phase I/II study of tusamitamab ravtansine (SAR408701) in patients (pts) with advanced non-small cell lung cancer (NSCLC) | Annals of Oncology | articles by this author. D. Frisman D. Frisman. Affiliations Discovery Life Sciences, Goleta, CA, USA. Search for articles by this author. G. Cesarone G. Cesarone. Affiliations Discovery Life Sciences, Goleta, CA, USA. Search for articles | Full Paper | |
2021 | Salgado, R;Peg, V;Rüschoff, J;Vincent-Salomon, A;Castellano, I;Perner, S;Van de Vijver, K;Quinn, CM;Varga, Z; | Gene expression signatures for tailoring adjuvant chemotherapy of luminal breast cancer: the pathologists' perspective | Annals of oncology : official journal of the European Society for Medical Oncology | 34461263 | Department of Pathology, GZA-ZNA Hospitals, Antwerp, Belgium; Division of Research, Peter MacCallum Cancer Centre, Melbourne, Australia. Electronic address: roberto@salgado.be.++Universidad Autónoma de Barcelona, Barcelona, Spain; Department of Patho | Full Paper |
2021 | Keenan, TE;Guerriero, JL;Barroso-Sousa, R;Li, T;O'Meara, T;Giobbie-Hurder, A;Tayob, N;Hu, J;Severgnini, M;Agudo, J;Vaz-Luis, I;Anderson, L;Attaya, V;Park, J;Conway, J;He, MX;Reardon, B;Shannon, E;Wulf, G;Spring, LM;Jeselsohn, R;Krop, I;Lin, NU;Partridge, A;Winer, EP;Mittendorf, EA;Liu, D;Van Allen, EM;Tolaney, SM; | Molecular correlates of response to eribulin and pembrolizumab in hormone receptor-positive metastatic breast cancer | Nature communications | 34548479 | Tumors from 65/88 (74%) patients underwent PD-L1 testing assessed centrally by QualTek using the 22C3 antibody | Full Paper |
2021 | Brägelmann, J;Lorenz, C;Borchmann, S;Nishii, K;Wegner, J;Meder, L;Ostendorp, J;Ast, DF;Heimsoeth, A;Nakasuka, T;Hirabae, A;Okawa, S;Dammert, MA;Plenker, D;Klein, S;Lohneis, P;Gu, J;Godfrey, LK;Forster, J;Trajkovic-Arsic, M;Zillinger, T;Haarmann, M;Quaas, A;Lennartz, S;Schmiel, M;D'Rozario, J;Thomas, ES;Li, H;Schmitt, CA;George, J;Thomas, RK;von Karstedt, S;Hartmann, G;Büttner, R;Ullrich, RT;Siveke, JT;Ohashi, K;Schlee, M;Sos, ML; | MAPK-pathway inhibition mediates inflammatory reprogramming and sensitizes tumors to targeted activation of innate immunity sensor RIG-I | Nature communications | 34535668 | M.L.S. is a founder and shareholder of PearlRiver Bio (now part of Centessa Pharmaceuticals) and received consulting honoraria from PearlRiver Bio. M.L.S. receives research funding from PearlRiver Bio and Novartis. R.B. is an employee of Targos Molec | Full Paper |
2021 | Ny, L;Jespersen, H;Karlsson, J;Alsén, S;Filges, S;All-Eriksson, C;Andersson, B;Carneiro, A;Helgadottir, H;Levin, M;Ljuslinder, I;Olofsson Bagge, R;Sah, VR;Stierner, U;Ståhlberg, A;Ullenhag, G;Nilsson, LM;Nilsson, JA; | The PEMDAC phase 2 study of pembrolizumab and entinostat in patients with metastatic uveal melanoma | Nature communications | 34453044 | st was used to assess associations between immunohistochemical analyses (PD-L1 and TILs) and clinical benefit. Immunohistochemical analyses Tumor PD-L1 testing was performed at a central laboratory (QualTek Molecular Laboratories, Newtown, Pennsylva | Full Paper |
2021 | Cindy Yang, SY;Lien, SC;Wang, BX;Clouthier, DL;Hanna, Y;Cirlan, I;Zhu, K;Bruce, JP;El Ghamrasni, S;Iafolla, MAJ;Oliva, M;Hansen, AR;Spreafico, A;Bedard, PL;Lheureux, S;Razak, A;Speers, V;Berman, HK;Aleshin, A;Haibe-Kains, B;Brooks, DG;McGaha, TL;Butler, MO;Bratman, SV;Ohashi, PS;Siu, LL;Pugh, TJ; | Pan-cancer analysis of longitudinal metastatic tumors reveals genomic alterations and immune landscape dynamics associated with pembrolizumab sensitivity | Nature communications | 34446728 | ary Fig. 9A. PD-L1 immunohistochemistry Immunohistochemical (IHC) staining for PD-L1 using the mouse monoclonal anti-PD-L1 antibody (clone 22C3 at 2 μg/mL, Merck, Palo Alto, CA) was performed by Qualtek Molecular Laboratories (Newtown, PA, USA). The | Full Paper |
2021 | Fowler, TW;Mitchell, TL;Janda, CY;Xie, L;Tu, S;Chen, H;Zhang, H;Ye, J;Ouyang, B;Yuan, TZ;Lee, SJ;Newman, M;Tripuraneni, N;Rego, ES;Mutha, D;Dilip, A;Vuppalapaty, M;Baribault, H;Yeh, WC;Li, Y; | Development of selective bispecific Wnt mimetics for bone loss and repair | Nature communications | 34059688 | The following method was used for human and mouse femur bone (Fig. 1d, e). Fresh human cadaveric femur tissue was purchased from vendor (Folio Conversant). Femur heads were shipped on wet ice within 24 h of death and tissue used immediately upon rece | Full Paper |
2021 | Butler, D;Mozsary, C;Meydan, C;Foox, J;Rosiene, J;Shaiber, A;Danko, D;Afshinnekoo, E;MacKay, M;Sedlazeck, FJ;Ivanov, NA;Sierra, M;Pohle, D;Zietz, M;Gisladottir, U;Ramlall, V;Sholle, ET;Schenck, EJ;Westover, CD;Hassan, C;Ryon, K;Young, B;Bhattacharya, C;Ng, DL;Granados, AC;Santos, YA;Servellita, V;Federman, S;Ruggiero, P;Fungtammasan, A;Chin, CS;Pearson, NM;Langhorst, BW;Tanner, NA;Kim, Y;Reeves, JW;Hether, TD;Warren, SE;Bailey, M;Gawrys, J;Meleshko, D;Xu, D;Couto-Rodriguez, M;Nagy-Szakal, D;Barrows, J;Wells, H;O'Hara, NB;Rosenfeld, JA;Chen, Y;Steel, PAD;Shemesh, AJ;Xiang, J;Thierry-Mieg, J;Thierry-Mieg, D;Iftner, A;Bezdan, D;Sanchez, E;Campion, TR;Sipley, J;Cong, L;Craney, A;Velu, P;Melnick, AM;Shapira, S;Hajirasouliha, I;Borczuk, A;Iftner, T;Salvatore, M;Loda, M;Westblade, LF;Cushing, M;Wu, S;Levy, S;Chiu, C;Schwartz, RE;Tatonetti, N;Rennert, H;Imielinski, M;Mason, CE; | Shotgun transcriptome, spatial omics, and isothermal profiling of SARS-CoV-2 infection reveals unique host responses, viral diversification, and drug interactions | Nature communications | 33712587 | Department of Physiology and Biophysics, Weill Cornell Medicine, New York, NY, USA.++Department of Physiology and Biophysics, Weill Cornell Medicine, New York, NY, USA.++Department of Physiology and Biophysics, Weill Cornell Medicine, New York, NY, U | Full Paper |
2021 | Li, J;Conrad, C;Mills, TW;Berg, NK;Kim, B;Ruan, W;Lee, JW;Zhang, X;Yuan, X;Eltzschig, HK; | PMN-derived netrin-1 attenuates cardiac ischemia-reperfusion injury via myeloid ADORA2B signaling | The Journal of experimental medicine | 33891683 | Materials and methods. MI patient and healthy donor samples. Serum/plasma samples of patients with MI or healthy donors were purchased from Discovery Life Sciences. Corresponding cTnI levels of patients with MI were documented in the patient sample d | Full Paper |
2021 | Dang, K;Castello, G;Clarke, SC;Li, Y;Balasubramani, A;Boudreau, A;Davison, L;Harris, KE;Pham, D;Sankaran, P;Ugamraj, HS;Deng, R;Kwek, S;Starzinski, A;Iyer, S;van Schooten, W;Schellenberger, U;Sun, W;Trinklein, ND;Buelow, R;Buelow, B;Fong, L;Dalvi, P; | Attenuating CD3 affinity in a PSMAxCD3 bispecific antibody enables killing of prostate tumor cells with reduced cytokine release | Journal for immunotherapy of cancer | 34088740 | Tumor cells were either isolated from fresh prostate tumor tissue procured from LF's lab at UCSF (San Francisco, California, USA) or received as frozen dissociated aliquots along with donor matched PBMCs from Discovery Life Sciences (Newtown, Pennsyl | Full Paper |
2021 | Nghiem, P;Bhatia, S;Lipson, EJ;Sharfman, WH;Kudchadkar, RR;Brohl, AS;Friedlander, PA;Daud, A;Kluger, HM;Reddy, SA;Boulmay, BC;Riker, A;Burgess, MA;Hanks, BA;Olencki, T;Kendra, K;Church, C;Akaike, T;Ramchurren, N;Shinohara, MM;Salim, B;Taube, JM;Jensen, E;Kalabis, M;Fling, SP;Homet Moreno, B;Sharon, E;Cheever, MA;Topalian, SL; | Three-year survival, correlates and salvage therapies in patients receiving first-line pembrolizumab for advanced Merkel cell carcinoma | Journal for immunotherapy of cancer | 33879601 | small T-antigen-specific serum antibodies21 or manifested large T-antigen expression in tumor biopsies via immunohistochemistry.22 PD-L1 staining (anti-PD-L1 clone 22C3, Merck & Co, Kenilworth, New Jersey, USA) was performed at QualTek Molecular | Full Paper |
2021 | Banchereau, R;Chitre, AS;Scherl, A;Wu, TD;Patil, NS;de Almeida, P;Kadel Iii, EE;Madireddi, S;Au-Yeung, A;Takahashi, C;Chen, YJ;Modrusan, Z;McBride, J;Nersesian, R;El-Gabry, EA;Robida, MD;Hung, JC;Kowanetz, M;Zou, W;McCleland, M;Caplazi, P;Eshgi, ST;Koeppen, H;Hegde, PS;Mellman, I;Mathews, WR;Powles, T;Mariathasan, S;Grogan, J;O'Gorman, WE; | Intratumoral CD103+ CD8+ T cells predict response to PD-L1 blockade | Journal for immunotherapy of cancer | 33827905 | containing regimen. Fresh tumor samples and matched adjacent non-cancerous tissues were procured from a commercial vendor (Discovery Life Sciences) as part of adult patients undergoing surgical resection. Online supplemental ;h locally advanced | Full Paper |
2021 | Badve, SS;Penault-Llorca, F;Reis-Filho, JS;Deurloo, R;Siziopikou, KP;D'Arrigo, C;Viale, G; | Determining PD-L1 Status in Patients with Triple-Negative Breast Cancer: Lessons Learned from IMpassion130 | Journal of the National Cancer Institute | 34286340 | CD has received consulting fees from Roche TD, Targos GmbH, Pfizer, Roche Pharma, LDPath Ltd, About Health Ltd, Uralensis INOV8 Ltd, and various NHS hospitals and has received nonfinan- cial support from UKNEQAS ICC&ISH and CADQAS cic | Full Paper |
2021 | Saura, C;Matito, J;Oliveira, M;Wildiers, H;Brufksy, AM;Waters, SH;Hurvitz, SA;Moy, B;Kim, SB;Gradishar, WJ;Queiroz, GS;Cronemberger, E;Wallweber, GJ;Bebchuk, J;Keyvanjah, K;Lalani, AS;Bryce, R;Vivancos, A;Eli, LD;Delaloge, S; | Biomarker Analysis of the Phase III NALA Study of Neratinib + Capecitabine versus Lapatinib + Capecitabine in Patients with Previously Treated Metastatic Breast Cancer | Clinical cancer research : an official journal of the American Association for Cancer Research | 34380637 | Yan (Puma Biotechnology). We thank Jeff Sperinde and Weidong Huang (Monogram Biosciences) for additional support for HERmark and p95 assay design and execution. We thank Sandra Bernard (Targos GMBH) for oversight of clinical sample management. We | Full Paper |
2021 | Pedersen, KS;Foster, NR;Overman, MJ;Boland, PM;Kim, SS;Arrambide, KA;Jaszewski, BL;Bekaii-Saab, T;Graham, RP;Welch, J;Wilson, RH;McWilliams, RR; | ZEBRA: A Multicenter Phase II Study of Pembrolizumab in Patients with Advanced Small-Bowel Adenocarcinoma | Clinical cancer research : an official journal of the American Association for Cancer Research | 33883178 | (clinicaltrials.gov). Biomarkers PD-L1 expression was centrally assessed (QualTek, Santa Barbara, CA) by immunohistochemical assays utilizing the Merck 22C3 antibody (Agilent/Dako). Samples required > 50 viable neoplastic cells. Modified Proportion S | Full Paper |
2021 | Larson, MH;Pan, W;Kim, HJ;Mauntz, RE;Stuart, SM;Pimentel, M;Zhou, Y;Knudsgaard, P;Demas, V;Aravanis, AM;Jamshidi, A; | A comprehensive characterization of the cell-free transcriptome reveals tissue- and subtype-specific biomarkers for cancer detection | Nature communications | 33883548 | We set out to validate the 23 cell-free mRNA biomarkers identified in our CCGA cohort in an orthogonal set of breast (n = 38) and lung (n = 18) cancer plasma samples obtained from a commercial vendor (Discovery Life Sciences) ;t to validate the | Full Paper |
2021 | Lorés-Motta, L;van Beek, AE;Willems, E;Zandstra, J;van Mierlo, G;Einhaus, A;Mary, JL;Stucki, C;Bakker, B;Hoyng, CB;Fauser, S;Clark, SJ;de Jonge, MI;Nogoceke, E;Koertvely, E;Jongerius, I;Kuijpers, TW;den Hollander, AI; | Common haplotypes at the CFH locus and low-frequency variants in CFHR2 and CFHR5 associate with systemic FHR concentrations and age-related macular degeneration | American journal of human genetics | 34260947 | associated with AMD (locus-wide conditioning).15 All the association analyses were performed with the “glm” R function.40 Immunocytochemistry of human retinas Human donor eyes were obtained from Discovery Life Sciences. Eyes were collected within 12 | Full Paper |
2021 | Egelston, C;Guo, W;Yost, S;Lee, JS;Rose, D;Avalos, C;Ye, J;Frankel, P;Schmolze, D;Waisman, J;Lee, P;Yuan, Y; | Pre-existing effector T-cell levels and augmented myeloid cell composition denote response to CDK4/6 inhibitor palbociclib and pembrolizumab in hormone receptor-positive metastatic breast cancer | Journal for immunotherapy of cancer | 33757987 | PD-L1 stain was performed using 22C3 antibody by Qualtek Molecular Laboratory | Full Paper |
2021 | Campbell, JR;McDonald, BR;Mesko, PB;Siemers, NO;Singh, PB;Selby, M;Sproul, TW;Korman, AJ;Vlach, LM;Houser, J;Sambanthamoorthy, S;Lu, K;Hatcher, SV;Lohre, J;Jain, R;Lan, RY; | Fc-optimized Anti-CCR8 Antibody Depletes Regulatory T Cells in Human Tumor Models | Cancer research | 33757978 | Study approval Human tumor, skin, spleen, patient blood, and healthy blood leukopack samples were collected through commercial providers (BioIVT, MT Group, Avaden, BioOptions, Discovery Life Sciences, AllCells) or the Cooperative Human Tissue Network | Full Paper |
2021 | Dieckmann, N;Schildhaus, HU;Bauer, S; | Tropomyosin receptor kinases in sarcomas - of joy and despair | Current opinion in oncology | 33989242 | Novartis, and Incyte; and received travel and accommodation funding from PharmaMar. H.U.S. is an employee of Targos Molecular pathology, Inc., received research funding from Novartis Oncology, has received honoria from MSD, BMS, Pfizer, Novartis Onco | Full Paper |
2021 | Yuan, Y;Lee, J;Yost, S;Frankel, P;Ruel, C;Egelston, C;Guo, W;Padam, S;Tang, A;Martinez, N;Schmolze, D;Presant, C;Ebrahimi, B;Yeon, C;Sedrak, M;Patel, N;Portnow, J;Lee, P;Mortimer, J; | Phase I/II trial of palbociclib, pembrolizumab and letrozole in patients with hormone receptor-positive metastatic breast cancer | European Journal of Cancer | 2.4. Tumour immune biomarkers Percentage of stromal TILs in tumour was evaluated using haematoxylin and eosin diagnostic sections per International TIL Work Group guideline [23]. PD-L1 was determined by immunohistochemistry (IHC) using the PD-L1 IHC | Full Paper | |
2021 | Liang, X;Wang, Y;Zhang, Y;Li, B;Radosevich, M; | Bacteriophage-host depth distribution patterns in soil are maintained after nutrient stimulation in vitro | The Science of the total environment | 33991924 | The extracted DNA samples were quantified using PicoGreen Assay Kit (Invitrogen, Carlsbad, CA) and were then sent to the HudsonAlpha Genomic Services Laboratory (Huntsville, AL, USA) for preparation of 16S rRNA gene amplicon library and high-throughp | Full Paper |
2021 | Quaas, A;Pamuk, A;Klein, S;Quantius, J;Rehkaemper, J;Barutcu, AG;Rueschoff, J;Zander, T;Gebauer, F;Hillmer, A;Buettner, R;Schroeder, W;Bruns, CJ;Löser, H;Schoemig-Markiefka, B;Alakus, H; | Sex-specific prognostic effect of CD66b-positive tumor-infiltrating neutrophils (TANs) in gastric and esophageal adenocarcinoma | Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association | 34009535 | Thomas Zander. Institute of Pathology, Nordhessen and Targos Molecular Pathology GmbH, Kassel, Germany. Josef Rueschoff. Authors: Alexander Quaas View author publications. You can also search for this author in PubMed Google Scholar | Full Paper |
2021 | Schoemig-Markiefka, B;Eschbach, J;Scheel, AH;Pamuk, A;Rueschoff, J;Zander, T;Buettner, R;Schroeder, W;Bruns, CJ;Loeser, H;Alakus, H;Quaas, A; | Optimized PD-L1 scoring of gastric cancer | Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association | 33954872 | Thomas Zander. Institute of Pathology Nordhessen, Kassel, Germany. Josef Rueschoff. Targos Molecular Pathology GmbH, Kassel, Germany. Josef Rueschoff & Reinhard Buettner. Authors: Birgid Schoemig-Markiefka View author publications | Full Paper |
2021 | Onogi, S;Lee, SH;Fruehauf, KR;Shea, KJ; | Abiotic Stimuli-Responsive Protein Affinity Reagent for IgG | Biomacromolecules | 34009976 | Transferrin (80 kDa) from human plasma was obtained from Calbiochem. Human serum was procured from Discovery Life Sciences, Inc. F(ab′) 2 (110 kDa) and Fc (50 kDa) fragments from human IgG were sourced from Jackson ImmunoResearch Laboratories, Inc | Full Paper |
2021 | Cao, XE;Kim, J;Mehta, S;Erickson, D; | Two-Color Duplex Platform for Point-of-Care Differential Detection of Malaria and Typhoid Fever | Analytical chemistry | 34469115 | samples in serum. 2.4. Validation with Human Clinical Samples. The clinical validation was conducted to evaluate the performance of the duplex platform with 25 human samples (Discovery Life Sciences). These included eight | Full Paper |
2021 | Narla, RK;Modi, H;Bauer, D;Abbasian, M;Leisten, J;Piccotti, JR;Kopytek, S;Eckelman, BP;Deveraux, Q;Timmer, J;Zhu, D;Wong, L;Escoubet, L;Raymon, HK;Hariharan, K; | Modulation of CD47-SIRPα innate immune checkpoint axis with Fc-function detuned anti-CD47 therapeutic antibody | Cancer immunology, immunotherapy : CII | 34247273 | lenalidomide [30]. Cell samples from AML patients were obtained from Conversant Bio (Huntsville) and are described in Supplemental Table 1. CC-90002 binding on cells and blockade of SIRPα to CD47 positive cells. Evaluation of | Full Paper |
2021 | Vos, H;Lambein, K;Richard, F;Mariën, B;Nevelsteen, I;Punie, K;Wildiers, H;Berben, L;Laenen, A;Floris, G;Desmedt, C;Smeets, A; | Comparison of the tumor immune microenvironment of primary hormone receptor-negative HER2-positive and triple negative breast cancer | NPJ breast cancer | 34556657 | PD-L1 (22C3 antibody, 2 μg/mL, Dako-Agilent) immunohistochemistry was performed by Qualtek Molecular Laboratories (Newtown PA, USA) as per agreement with Merck. QualTek provided a modified proportion score (MPS | Full Paper |
2021 | Pierson, SK;Shenoy, S;Oromendia, AB;Gorzewski, AM;Langan Pai, RA;Nabel, CS;Ruth, JR;Parente, SAT;Arenas, DJ;Guilfoyle, M;Reddy, M;Weinblatt, M;Shadick, N;Bower, M;Pria, AD;Masaki, Y;Katz, L;Mezey, J;Beineke, P;Lee, D;Tendler, C;Kambayashi, T;Fosså, A;van Rhee, F;Fajgenbaum, DC; | Discovery and validation of a novel subgroup and therapeutic target in idiopathic multicentric Castleman disease | Blood advances | 34438448 | this study. We wish to thank Daniel Martinez and the other members of the CHOP Pathology Core as well as Qualtek for their immunohistochemical analyses. We wish to thank Kevin Silk, Giovanni Insana, and James A. Lebovitz for their contributions to th | Full Paper |
2021 | Wang, A;Song, Z;Zheng, G;Nicolazzi, C;Fromm, JR;Shehu, E;Srinivasan, S;Chen, X;Zhu, C;Blondel, MC;Adrian, FJ; | Evaluation of Preclinical Activity of Isatuximab in Patients with Acute Lymphoblastic Leukemia | Molecular cancer therapeutics | 34376579 | centrifugation in line with the manufacturer's instructions. Patient ALL PBMCs were obtained from Conversant Biologics, Inc. Antibodies and reagents Isatuximab was generated in-house. Human immunoglobulin (Ig) G1, IgG4, ATRA | Full Paper |
2021 | Reardon, DA;Kim, TM;Frenel, JS;Simonelli, M;Lopez, J;Subramaniam, DS;Siu, LL;Wang, H;Krishnan, S;Stein, K;Massard, C; | Treatment with pembrolizumab in programmed death ligand 1-positive recurrent glioblastoma: Results from the multicohort phase 1 KEYNOTE-028 trial | Cancer | 33496357 | QualTek Molecular Laboratories evaluated archived or newly obtained formalin-fixed, paraffin-embedded tumor samples using the 22C3 PD-L1 antibody clone (Merck & Co., Inc., Kenilworth, NJ, USA) and a laboratory- developed prototype immunohistochemical | Full Paper |
2021 | Preillon, J;Cuende, J;Rabolli, V;Garnero, L;Mercier, M;Wald, N;Pappalardo, A;Denies, S;Jamart, D;Michaux, AC;Pirson, R;Pitard, V;Bagot, M;Prasad, S;Houthuys, E;Brouwer, M;Marillier, R;Lambolez, F;Marchante, JR;Nyawouame, F;Carter, MJ;Baron-Bodo, V;Marie-Cardine, A;Cragg, M;Déchanet-Merville, J;Driessens, G;Hoofd, C; | Restoration of T-cell Effector Function, Depletion of Tregs, and Direct Killing of Tumor Cells: The Multiple Mechanisms of Action of a-TIGIT Antagonist Antibodies | Molecular cancer therapeutics | 33277440 | Cryopreserved isolated PBMCs from healthy volunteers and patients with cancer were provided by ImmunXperts and ConversantBio, respectively. PBMCs were thawed, resuspended in RPMI medium supplemented with 10% FBS + 50 U/mL penicillin/streptomycin (Wes | Full Paper |
2021 | MacFarlane, AW;Yeung, HM;Alpaugh, RK;Dulaimi, E;Engstrom, PF;Dasari, A;Campbell, KS;Vijayvergia, N; | Impacts of pembrolizumab therapy on immune phenotype in patients with high-grade neuroendocrine neoplasms | Cancer immunology, immunotherapy : CII | 33398390 | PD-L1 immunohistochemistry (IHC) assay was performed at Qualtek Research Laboratories on formalin-fixed, paraffin-embedded tissue sections using anti-PD-L1 monoclonal antibody clone 22C3 (Merck Research Laboratories) | Full Paper |
2021 | Holder, C;Adams, A;Allison, C;Cote, O;Lippens, R;Blount, BC;Wang, L; | A Novel UHPLC-MS/MS Method for Measuring 8-iso-Prostaglandin F2α in Bronchoalveolar Lavage Fluid | Frontiers in chemistry | 34476231 | Non-EVALI BAL fluids used in this study were acquired from Discovery Life Sciences (Huntsville, AL, United States) | Full Paper |
2021 | Rodrigues, D;de Souza, T;Coyle, L;Di Piazza, M;Herpers, B;Ferreira, S;Zhang, M;Vappiani, J;Sévin, DC;Gabor, A;Lynch, A;Chung, SW;Saez-Rodriguez, J;Jennen, DGJ;Kleinjans, JCS;de Kok, TM; | New insights into the mechanisms underlying 5-fluorouracil-induced intestinal toxicity based on transcriptomic and metabolomic responses in human intestinal organoids | Archives of toxicology | 34151400 | 5-Fluorouracil (5-FU) is a widely used chemotherapeutical that induces acute toxicity in the small and large intestine of patients. Symptoms can be severe. ;- 5-Fluorouracil (5-FU) is a widely used chemotherapeutical that induces acute toxicity in | Full Paper |
2021 | Comunale, BA;Engineer, L;Jiang, Y;Andrews, JC;Liu, Q;Ji, L;Yurkovich, JT;Comunale, RA;Xie, Q; | Poliovirus Vaccination Induces a Humoral Immune Response That Cross Reacts With SARS-CoV-2 | Frontiers in medicine | 34414206 | ccination protocols, set by the Centers for Disease Control and Prevention (CDC). IRB approval for the collection of adult sera was obtained from BioMed IRB, and pediatric samples were purchased from Discovery Life Sciences (Huntsville, AL) in accord | Full Paper |
2021 | Haynes, WA;Kamath, K;Waitz, R;Daugherty, PS;Shon, JC; | Protein-Based Immunome Wide Association Studies (PIWAS) for the Discovery of Significant Disease-Associated Antigens | Frontiers in immunology | 33986742 | years, with a range of 22-72. Anti-Smith Cohort Samples from 34 subjects that tested positive for Anti-SM RNP (4) or Anti-Smith (30) antibodies by predicate ANA multiplex testing were obtained from Discovery Life Sciences. Subjects ranged in age fro | Full Paper |
2021 | Kerr, KM;Bibeau, F;Thunnissen, E;Botling, J;Ryška, A;Wolf, J;Öhrling, K;Burdon, P;Malapelle, U;Büttner, R; | The evolving landscape of biomarker testing for non-small cell lung cancer in Europe | Lung cancer (Amsterdam, Netherlands) | 33690091 | He is a co-owner and CSO of Targos Molecular Pathology, Inc., Germany | Full Paper |
2021 | Gentzel, RC;Toolan, D;Jinn, S;Schachter, JB;Ma, L;Kahle, PJ;Smith, SM;Marcus, JN; | Intracranial administration of alpha-synuclein fibrils in A30P-synuclein transgenic mice causes robust synucleinopathy and microglial induction | Neurobiology of aging | 34225000 | comparison. Neuropathologically confirmed human post-mortem PD brain tissue, acquired from Folio/Discovery Life Sciences (California, USA), or A30P HET brain tissues were serially extracted to obtain a sarkosyl insoluble fraction | Full Paper |
2021 | Malik-Chaudhry, HK;Prabhakar, K;Ugamraj, HS;Boudreau, AA;Buelow, B;Dang, K;Davison, LM;Harris, KE;Jorgensen, B;Ogana, H;Pham, D;Schellenberger, U;Van Schooten, W;Buelow, R;Iyer, S;Trinklein, ND;Rangaswamy, US; | TNB-486 induces potent tumor cell cytotoxicity coupled with low cytokine release in preclinical models of B-NHL | mAbs | 33818299 | ground value. The percent of specific lysis was calculated as described above. Ex vivo cytotoxicity assay The ability of TNB-486 to kill CD19+ tumor cells from CLL or DLBCL patient-derived samples (Discovery Life Sciences and IQ Biosciences) was det | Full Paper |
2021 | Yamada, M;Eguchi, A;Okuno, K;Sakaguchi, K;Yamaguchi, T; | Development of a highly sensitive chemiluminescent enzyme immunoassay for fragmented cytokeratin 18 using new antibodies | Scientific reports | 34521905 | All methods were carried out in accordance with relevant guidelines and regulations. Human samples. Serum from healthy individuals and NASH patients was purchased from Discovery Life Sciences (CA, USA) with approval and informed consent;defined below | Full Paper |
2021 | Awad, H;Tili, E;Nuovo, G;Kelani, H;Ramadan, ME;Williams, J;Binzel, K;Rajan, J;Mast, D;Efanov, AA;Rasul, KB;Moore, S;Basso, M;Mikhail, A;Eltobgy, M;Malbrue, RA;Bourekas, E;Oglesbee, M;Bergdall, V;Knopp, M;Michaille, JJ;El-Sayed, H; | Endovascular repair and open repair surgery of thoraco-abdominal aortic aneurysms cause drastically different types of spinal cord injury | Scientific reports | 33837260 | The remainder of the tissue was stored at − 80 °C for metabolome analyses. All sections were subsequently analyzed blindly. Immunohistochemistry (IHC). All sections were dealt with blindly using an automated Leica Bond Max platform at Phylogeny Inc. | Full Paper |
2021 | Mezache, L;Nuovo, G;Veeraraghavan, R; | A Multipronged Microscopy Approach Identifies Common Anti-Arrhythmic Strategy for Atrial Fibrillation and Myocardial Infarction | Microscopy and Microanalysis | 1 The Ohio State University, United States, 2 Discovery Life Sciences, United States Vascular leak and inflammation are associated with arrhythmic heart diseases such as atrial fibrillation (AF) and myocardial infarction (MI) | Full Paper | |
2021 | Ermann, J;Matmusaev, M;Haley, E;Braun, C;Jost, F;Mayer-Wrangowski, S;Hsiao, P;Ting, N;Li, L;Terenzio, D;Chime, J;Lukas, S;Patnaude, L;Panzenbeck, M;Csordas, D;Zheng, J;Mierz, D;Simpson, T;King, FJ;Klimowicz, A;Mbow, ML;Fine, JS;Miller, C;Fogal, S;Byrne, FR; | The potent and selective RIPK2 inhibitor BI 706039 improves intestinal inflammation in the TRUC mouse model of Inflammatory Bowel Disease | American journal of physiology. Gastrointestinal and liver physiology | 34494462 | Human IBD Intestinal biopsy Immuno-histo-chemical analysis 231 Tissue blocks from surgical resections for ulcerative colitis (n=6) and Crohn's Disease (n=5) were 232 acquired from Discovery Life Sciences. 4 µm sections were fluorescently stained usin | Full Paper |
2021 | Reisenauer, KN;Tao, Y;Das, P;Song, S;Svatek, H;Patel, SD;Mikhail, S;Ingros, A;Sheesley, P;Masi, M;Boari, A;Evidente, A;Kornienko, A;Romo, D;Taube, J; | Epithelial-mesenchymal transition sensitizes breast cancer cells to cell death via the fungus-derived sesterterpenoid ophiobolin A | Scientific reports | 34017048 | ke to acknowledge Dr. Michelle Nemec, Director of the Molecular Bioscience Center (Baylor University) for assistance with flow cytometry and Dr. Maria Boccia (Baylor University) and Dr. Gerard Nuovo (Discovery Life Sciences, Powell, OH, USA) for assi | Full Paper |
2021 | Caldwell, C;Rottman, JB;Paces, W;Bueche, E;Reitsma, S;Gibb, J;Adisetiyo, V;Haas, MS;Heath, H;Newman, W;Baum, J;Gianani, R;Kagey, MH; | Validation of a DKK1 RNAscope chromogenic in situ hybridization assay for gastric and gastroesophageal junction adenocarcinoma tumors | Scientific reports | 33972574 | chromogen kit (Biocare Medical). RNAscope. G/GEJ FFPE tumor resections were commercially acquired from Avaden Biosciences, Discovery Life Sciences or BioOptions following IRB compliance. RNAscope was performed ;emperature for 30 min, washed, and | Full Paper |
2021 | Wong, RL;Yu, EY; | Refining Immuno-Oncology Approaches in Metastatic Prostate Cancer: Transcending Current Limitations | Current treatment options in oncology | 33433743 | 028 phase 1b trial of pembrolizumab in PD-L1-positive advanced solid tumors included 23 patients with CRPC and PD-L1 expression ≥ 1% in tumor or stroma cells by a laboratory-developed prototype immunohistochemistry (IHC) assay (QualTek Molecular | Full Paper |
2021 | Meyer, L;Delgado-Cunningham, K;Lorig-Roach, N;Ford, J;DuBois, RM; | Human Astrovirus 1-8 Seroprevalence Evaluation in a United States Adult Population | Viruses | 34070419 | 2.7. Human Plasma Samples. Human plasma samples were obtained from Discovery Life Sciences Supplementary Materials. The following are available online at https://www.mdpi. com/article/10.3390/v13060979/s1, Table S1: Plasma Samples from Discovery Li | Full Paper |
2021 | Lopez-Anido, RN;Harrington, AM;Hamlin, HJ; | Coping with stress in a warming Gulf: the postlarval American lobster's cellular stress response under future warming scenarios | Cell stress & chaperones | 34115338 | The RNA samples from five replicate animals reared at each temperature were shipped to HudsonAlpha Discovery (formerly the Genomic Services Lab) at the HudsonAlpha Institute for Biotechnology (Huntsville, AL, USA) for library preparation and sequenci | Full Paper |
2021 | Magro, C;Crowson, A;Franks, L;Schaffer, P;Whelan, P;Nuovo, G; | The histologic and molecular correlates of COVID-19 vaccine-induced changes in the skin | Clinics in Dermatology | onald O. Perelman Department of Dermatology, New York University Grossman School of Medicine, New York, New York eDepartment of Pediatrics, Geffen School of Medicine at UCLA, Los Angeles, California fDiscovery Life Sciences, Powell, Ohio gThe Ohio St | Full Paper | |
2021 | Magro, C;Nuovo, G;Mulvey, J;Laurence, J;Harp, J;Crowson, A; | The skin as a critical window in unveiling the pathophysiologic principles of COVID-19 | Clinics in Dermatology | Joanna MD e Crowson A. Neil MD f aDepartment of Pathology and Laboratory Medicine, Weill Cornell Medicine, New York, New York bThe Ohio State University Comprehensive Cancer Center, Columbus Ohio and Discovery Life Sciences, Powell, Ohio cDepartment | Full Paper | |
2021 | Xia, B;Blount, BC;Wang, L; | Sensitive Quantification of Nicotine in Bronchoalveolar Lavage Fluid by Acetone Precipitation Combined With Isotope-Dilution Liquid Chromatography-Tandem Mass Spectrometry | ACS omega | 34124421 | We directly injected 1 μL of the residual supernatant onto the LC-MS/MS. BAL fluid pools were created for method validation experiments of the method from 12 anonymous BAL fluids purchased commercially from Discovery Life Sciences (Huntsville, AL) | Full Paper |
2021 | Cirillo, PDR;Margiotti, K;Fabiani, M;Barros-Filho, MC;Sparacino, D;Cima, A;Longo, SA;Cupellaro, M;Mesoraca, A;Giorlandino, C; | Multi-analytical test based on serum miRNAs and proteins quantification for ovarian cancer early detection | PloS one | 34352040 | All serum samples from ovarian cancer patients were obtained through MTA (Material Transfer Agreement) signed consent form from the following centers: Discovery Life Sciences (Huntsville, USA), BioIVT (London, UK), Victorian Cancer Bank (Melbourne, A | Full Paper |
2021 | Walsh, CS;Kamrava, M;Rogatko, A;Kim, S;Li, A;Cass, I;Karlan, B;Rimel, BJ; | Phase II trial of cisplatin, gemcitabine and pembrolizumab for platinum-resistant ovarian cancer | PloS one | 34081738 | that had membrane staining at low (1+) intensities or greater. An H-score was calculated ranging from 0–300, reflecting the percentage of cells staining at each of the following intensities: negative (1), low (1+), moderate (2+), high (3+). IHC assay | Full Paper |
2021 | Bernstein, DE;Trinh, HN;Schiff, ER;Smith, CI;Mospan, AR;Zink, RC;Fried, MW;Lok, AS; | Safety and Effectiveness of Tenofovir Alafenamide in Usual Clinical Practice Confirms Results of Clinical Trials: TARGET-HBV | Digestive diseases and sciences | 34059991 | ERS: Grant support: Eiger, Galmed, Zydus, Celgene, Beckman, Biokit, Bristol Myers Squibb, Conatus, Celgene, Discovery Life Sciences, Genfit, Gilead, Intercept, Novartis, Novo Nordisk, Orasure Technologies, Ortho Diagnostics, Pfizer, Prometheus Lab, R | Full Paper |
2021 | Varlet, P;Bouffet, E;Casanova, M;Giangaspero, F;Antonelli, M;Hargrave, D;Ladenstein, R;Pearson, A;Hawkins, C;König, FB;Rüschoff, J;Schmauch, C;Bühnemann, C;Garin-Chesa, P;Schweifer, N;Uttenreuther-Fischer, M;Gibson, N;Ittrich, C;Krämer, N;Solca, F;Stolze, B;Geoerger, B; | Comprehensive analysis of the ErbB receptor family in pediatric nervous system tumors and rhabdomyosarcoma | Pediatric blood & cancer | 34546642 | Institute, Medical University, Vienna, Austria 8 Paediatric Drug Development, Children and Young People's Unit, Royal Marsden Hospital, London, UK 9 Division of Clinical Studies, Institute of Cancer Research, London, UK 10 Targos Molecular Pathology | Full Paper |
2021 | Bio, S;Nunes, B; | Twists and turns of an oyster's life: effects of different depuration periods on physiological biochemical functions of oysters | Environmental science and pollution research international | 33559825 | Aquaculture activities are often established in the vicinity of highly populated, potentially contaminated areas. Animals cultured at such locations, namely bivalves, are frequently used as test organisms in ecotoxicological testing. In this case, a | Full Paper |
2021 | Chen, YC;Figliozzi, RW;Hsia, SV; | Pilot Analyses of Interferon Subtype Expression Profiles in Patients with Herpes Zoster or Postherpetic Neuralgia | Viral immunology | 33857386 | A variety of blood samples containing ICD10 codes of HZ or PHN (Table 1) were purchased from Discovery Life Sciences (800 Hudson Way, Suite 1700, Huntsville, AL 35806) The sera of healthy controls were purchased from Discovery Life Sciences with an | Full Paper |
2021 | Kam, K;Kumar, V;Lamport, Z;Kymissis, I; | A laboratory course on information display technologies for remote learning | Journal of the Society for Information Display | Survey response percentage, 55.55%. TABLE 2. Listed components and suppliers Component, Brand. AC/DC wall mount adapter 12 V 12 W, Qualtek. LED matrix 5 × 7, Kingbright. Fan axial 40 × 10mm 12VDC wire, CUI Devices. Switch push, C&K | Full Paper | |
2021 | Rüschoff, J;Baretton, G;Bläker, H;Dietmaier, W;Dietel, M;Hartmann, A;Horn, LC;Jöhrens, K;Kirchner, T;Knüchel, R;Mayr, D;Merkelbach-Bruse, S;Schildhaus, HU;Schirmacher, P;Tiemann, M;Tiemann, K;Weichert, W;Büttner, R; | MSI testing : What's new? What should be considered? | Der Pathologe | 34477921 | Institute of Pathology, Nordhessen und Targos Molecular Pathology GmbH, Germaniastr. 7, 34119, Kassel, Germany. josef.rueschoff@targos-gmbh.de.++Institute of Pathology, University Hospital Carl Gustav Carus, Fetscherstr. 74, 01307, Dresden, Germany.+ | Full Paper |
2021 | Rüschoff, J;Baretton, G;Bläker, H;Dietmaier, W;Dietel, M;Hartmann, A;Horn, LC;Jöhrens, K;Kirchner, T;Knüchel, R;Mayr, D;Merkelbach-Bruse, S;Schildhaus, HU;Schirmacher, P;Tiemann, M;Tiemann, K;Weichert, W;Büttner, R; | [MSI testing : What is new? What should be considered? German version] | Der Pathologe | 34043067 | What should be considered? German version]. Josef Ruschoff Institut fur Pathologie Nordhessen, TARGOS Molecular Pathology GmbH, Germaniastr Affiliations. 1 author 1. Institut fur Pathologie Nordhessen, TARGOS Molecular Pathology GmbH, Germaniastr | Full Paper |
2021 | Schildhaus, HU;Weichert, W; | [Predictive diagnostics for checkpoint inhibitors] | Der Pathologe | 33956171 | H.-U. Schildhaus ist Mitarbeiter der Targos Molecular Pathology GmbH und gibt Honorare und Advisory Boards von MSD, BMS, AstraZeneca, Pfizer, | Full Paper |
2021 | Cromer, MK;Camarena, J;Martin, RM;Lesch, BJ;Vakulskas, CA;Bode, NM;Kurgan, G;Collingwood, MA;Rettig, GR;Behlke, MA;Lemgart, VT;Zhang, Y;Goyal, A;Zhao, F;Ponce, E;Srifa, W;Bak, RO;Uchida, N;Majeti, R;Sheehan, VA;Tisdale, JF;Dever, DP;Porteus, MH; | Gene replacement of α-globin with β-globin restores hemoglobin balance in β-thalassemia-derived hematopoietic stem and progenitor cells | Nature medicine | 33737751 | Human CD34+ HSPCs were cultured as previously described18,24,33,36,46,47. CD34+ HSPCs were sourced from fresh cord blood (generously provided by the Binns Family program for Cord Blood Research); from frozen cord blood and Plerixafor- and/or G-CSF-mo | Full Paper |
2021 | Gaidt, MM;Morrow, A;Fairgrieve, MR;Karr, JP;Yosef, N;Vance, RE; | Self-guarding of MORC3 enables virulence factor-triggered immunity | Nature | 34759314 | (PBMCs) from de-identified donors were obtained from AllCells (Alameda) under donor-informed consent and Alpha IRB approval obtained by AllCells (7000-SOP-045) for the study ' Save | Full Paper |
2021 | Mimitou, EP;Lareau, CA;Chen, KY;Zorzetto-Fernandes, AL;Hao, Y;Takeshima, Y;Luo, W;Huang, TS;Yeung, BZ;Papalexi, E;Thakore, PI;Kibayashi, T;Wing, JB;Hata, M;Satija, R;Nazor, KL;Sakaguchi, S;Ludwig, LS;Sankaran, VG;Regev, A;Smibert, P; | Scalable, multimodal profiling of chromatin accessibility, gene expression and protein levels in single cells | Nature biotechnology | 34083792 | Cryopreserved healthy donor peripheral blood mononuclear cells (PBMCs) and bone marrow cells (BM) were obtained from AllCells (USA) or Cellular Technology Limited (CTL) and processed immediately after thawing. NIH-3T3 and HEK293FT cells were maintain | Full Paper |
2021 | Lareau, CA;Ludwig, LS;Muus, C;Gohil, SH;Zhao, T;Chiang, Z;Pelka, K;Verboon, JM;Luo, W;Christian, E;Rosebrock, D;Getz, G;Boland, GM;Chen, F;Buenrostro, JD;Hacohen, N;Wu, CJ;Aryee, MJ;Regev, A;Sankaran, VG; | Massively parallel single-cell mitochondrial DNA genotyping and chromatin profiling | Nature biotechnology | 32788668 | Cryopreserved PBMCs from patients with CLL consented on institutional review board approved protocols were obtained from AllCells (Patient 1) or from Adrian Wiestner at the Save | Full Paper |
2021 | Hao, Y;Hao, S;Andersen-Nissen, E;Mauck, WM;Zheng, S;Butler, A;Lee, MJ;Wilk, AJ;Darby, C;Zager, M;Hoffman, P;Stoeckius, M;Papalexi, E;Mimitou, EP;Jain, J;Srivastava, A;Stuart, T;Fleming, LM;Yeung, B;Rogers, AJ;McElrath, JM;Blish, CA;Gottardo, R;Smibert, P;Satija, R; | Integrated analysis of multimodal single-cell data | Cell | 34062119 | stom made clone UCHL1 ------------------------- Biological samples ------------------------- Human PBMC Cape Town HVTN Immunology Lab, South Africa https://www.chil.org.za/ Human PBMC AllCells Lot 3032552 ------------------------- | Full Paper |
2021 | Okuchi, Y;Reeves, J;Ng, SS;Doro, DH;Junyent, S;Liu, KJ;El Haj, AJ;Habib, SJ; | Wnt-modified materials mediate asymmetric stem cell division to direct human osteogenic tissue formation for bone repair | Nature materials | 32958876 | hSSCs were isolated from a commercially available bone marrow aspirate (AllCells). The bone marrow aspirate was plated onto culture flasks precoated with 10 ng ml−1 fibronectin (Sigma-Aldrich, 356000) and the cells were allowed to attach. Surface mar | Full Paper |
2021 | Wu, SZ;Al-Eryani, G;Roden, DL;Junankar, S;Harvey, K;Andersson, A;Thennavan, A;Wang, C;Torpy, JR;Bartonicek, N;Wang, T;Larsson, L;Kaczorowski, D;Weisenfeld, NI;Uytingco, CR;Chew, JG;Bent, ZW;Chan, CL;Gnanasambandapillai, V;Dutertre, CA;Gluch, L;Hui, MN;Beith, J;Parker, A;Robbins, E;Segara, D;Cooper, C;Mak, C;Chan, B;Warrier, S;Ginhoux, F;Millar, E;Powell, JE;Williams, SR;Liu, XS;O'Toole, S;Lim, E;Lundeberg, J;Perou, CM;Swarbrick, A; | A single-cell and spatially resolved atlas of human breast cancers | Nature genetics | 34493872 | Percentage of neoplastic cells in each tumor that are classified as each of the SCSubtypes. Tumor samples are grouped according to their Allcells-Pseudobulk classifications. NL, normal-like. c, Representative images of CK5 (top) and ER (bottom) IHC f | Full Paper |
2021 | Ge, Y;Tian, T;Huang, S;Wan, F;Li, J;Li, S;Wang, X;Yang, H;Hong, L;Wu, N;Yuan, E;Luo, Y;Cheng, L;Hu, C;Lei, Y;Shu, H;Feng, X;Jiang, Z;Wu, Y;Chi, Y;Guo, X;Cui, L;Xiao, L;Li, Z;Yang, C;Miao, Z;Chen, L;Li, H;Zeng, H;Zhao, D;Zhu, F;Shen, X;Zeng, J; | An integrative drug repositioning framework discovered a potential therapeutic agent targeting COVID-19 | Signal transduction and targeted therapy | 33895786 | e performed at a flow rate of 30 μL/min. Data processing and analyses were performed using BIAevaluation 1.1 software. LPS-induced cytokine production in PBMCs Peripheral blood mononuclear cells (Allcells) were cultured at 37 °C at concentration 5% | Full Paper |
2021 | Miller, IC;Zamat, A;Sun, LK;Phuengkham, H;Harris, AM;Gamboa, L;Yang, J;Murad, JP;Priceman, SJ;Kwong, GA; | Enhanced intratumoural activity of CAR T cells engineered to produce immunomodulators under photothermal control | Nature biomedical engineering | 34385695 | Primary human CD3+ cells were obtained from an anonymous donor blood after apheresis (AllCells) and were cryopreserved in 90% FBS and 10% dimethylsulfoxide until subsequent Save | Full Paper |
2021 | Frede, J;Anand, P;Sotudeh, N;Pinto, RA;Nair, MS;Stuart, H;Yee, AJ;Vijaykumar, T;Waldschmidt, JM;Potdar, S;Kloeber, JA;Kokkalis, A;Dimitrova, V;Mann, M;Laubach, JP;Richardson, PG;Anderson, KC;Raje, NS;Knoechel, B;Lohr, JG; | Dynamic transcriptional reprogramming leads to immunotherapeutic vulnerabilities in myeloma | Nature cell biology | 34675390 | registration was 68.5 years (range 45-80). Myeloma cells were enriched using the EasySep Human CD138 positive selection kit (STEMCELL Technologies). Bone marrow from normal donors was obtained from AllCells. Single cell sorting Bone marrow cells wer | Full Paper |
2021 | Duault, C;Kumar, A;Taghi Khani, A;Lee, SJ;Yang, L; | Activated natural killer cells predict poor clinical prognosis in high-risk B-and T-cell acute lymphoblastic leukemia | blood | 36107453 | processed from patients with B/T-ALL and healthy donors according to Institutional Review Board policies. Healthy BMMCs were purchased from AllCells (Alameda, CA). Healthy PBMCs were isolated from buffy coats procured from Stanford Blood Center, City | Full Paper |
2021 | Duault, C;Kumar, A;Taghi Khani, A;Lee, SJ;Yang, L;Huang, M;Hurtz, C;Manning, B;Ghoda, L;McDonald, T;Lacayo, NJ;Sakamoto, KM;Carroll, M;Tasian, SK;Marcucci, G;Yu, J;Caligiuri, MA;Maecker, HT;Swaminathan, S; | Activated natural killer cells predict poor clinical prognosis in high-risk B- and T-cell acute lymphoblastic leukemia | Blood | 34077953 | ripheral blood mononuclear cells (PBMCs) were collected and processed from patients with B/T-ALL and healthy donors according to Institutional Review Board policies. Healthy BMMCs were purchased from AllCells (Alameda, CA). Healthy PBMCs were isolate | Full Paper |
2021 | Alavi, A;Krishnamurti, L;Abedi, M;Galeon, I;Reiner, D;Smith, S;Wang, L;Ramezi, A;Rendo, P;Walters, M; | Preliminary Safety and Efficacy Results from Precizn-1: An Ongoing Phase 1/2 Study on Zinc Finger Nuclease-Modified Autologous CD34+ HSPCs for Sickle Cell Disease (SCD) | Blood | Introduction Sickle cell disease (SCD) is caused by pathologic variants in both alleles of the β-globin gene, affecting ~100,000 patients in the US (Strouse. Handb Clin Neurol 2016;138:311-24). Elevated fetal hemoglobin (HbF) levels am | Full Paper | |
2021 | Kwiatkowski, J;Locatelli, F;Walters, M;Porter, J;Hongeng, S;Yannaki, E;Kulozik, A;Sauer, M;Thrasher, A;Thuret, I;Lal, A;Guo, R;Colvin, R;Gruppioni, K;Thompson, A; | Improvement in Health-Related Quality of Life Following Treatment with Betibeglogene Autotemcel in Patients with Transfusion-Dependent β-Thalassemia Enrolled in Phase 3 Studies | Blood | Introduction: Patients with transfusion-dependent β-thalassemia (TDT) have increased morbidity and mortality and reduced health-related quality of life (HRQoL) compared with the general population owing to the mental, physical, and time demands of ch | Full Paper | |
2021 | Hall, A;Winestone, L;Sullivan, E;Wu, Q;Lamble, A;Walters, M;Aguayo-Hiraldo, P;Baez Conde, L;Coker, T;Dave, H;Dornsife, D;Keating, A;Merino, D;Ramsey, B;Park, J;Agrawal, A; | Access to CAR-T Cell Therapy in Underrepresented Populations: A Multicenter Cohort Study of Pediatric and Young Adult ALL Patients | Blood | Introduction: Social determinants of health such as race, ethnicity, and socioeconomic status (SES) are associated with inferior outcomes in patients with B-cell acute lymphoblastic leukemia (B-ALL). Latinx patients have worse event-free survival and | Full Paper | |
2021 | Thompson, A;Locatelli, F;Yannaki, E;Walters, M;Porter, J;Hongeng, S;Kulozik, A;Sauer, M;Thrasher, A;Thuret, I;Lal, A;Cavazzana, M;Rasko, J;Du, L;Colvin, R;Kwiatkowski, J; | Restoring Iron Homeostasis in Pts Who Achieved Transfusion Independence after Treatment with Betibeglogene Autotemcel Gene Therapy: Results from up to 7 Years of Follow-up | Blood | Introduction: Transfusion-dependent β-thalassemia (TDT) is a severe genetic disease requiring lifelong, regular packed red blood cell (pRBC) transfusions and iron chelation treatment. Betibeglogene autotemcel (beti-cel) is a one-time ex vivo gene the | Full Paper | |
2021 | Walters, M;Smith, A;Schiller, G;Esrick, E;Williams, D;Gogoleva, T;Rouy, D;Cockroft, B;Vercellotti, G; | Updated Results of a Phase 1/2 Clinical Study of Zinc Finger Nuclease-Mediated Editing of BCL11A in Autologous Hematopoietic Stem Cells for Transfusion-Dependent Beta Thalassemia | Blood | Introduction: Persistently elevated fetal hemoglobin (HbF) can ameliorate transfusion-dependent beta thalassemia (TDT) (Musallam et al ., 2012). BCL11A is a repressor of γ-globin expression and HbF production in adult erythrocytes. Down-regulation of | Full Paper | |
2021 | Tisdale, J;Thompson, A;Mapara, M;Kwiatkowski, J;Krishnamurti, L;Aygun, B;Kasow, K;Rifkin-Zenenberg, S;Schmidt, M;Pierciey, F;Whitney, D;Rogers, C;Nnamani, M;Foos, M;Miller, A;Zhang, X;Lynch, J;Walters, M;Kanter, J;Bonner, M; | Polyclonality Strongly Correlates with Biological Outcomes and Is Significantly Increased Following Improvements to the Phase 1/2 HGB-206 Protocol and Manufacturing of LentiGlobin for Sickle Cell Disease (SCD; bb1111) Gene Therapy (GT) | Blood | Background: The ongoing Phase 1/2 HGB-206 study (NCT02140554) of LentiGlobin for SCD (bb1111) GT uses a modified human β-globin gene that expresses an anti-sickling hemoglobin (HbA T87Q). The relationships between biological outcomes, clinical outcom | Full Paper | |
2021 | Walters, M;Tisdale, J;Mapara, M;Krishnamurti, L;Kwiatkowski, J;Aygun, B;Kasow, K;Rifkin-Zenenberg, S;Jaroscak, J;Garbinsky, D;Chirila, C;Gallagher, M;Zhang, X;Ho, P;Thompson, A;Kanter, J; | Sustained Improvements in Patient-Reported Quality of Life up to 24 Months Post-Treatment with LentiGlobin for Sickle Cell Disease (bb1111) Gene Therapy | Blood | Background: Sickle cell disease (SCD) is characterized by painful vaso-occlusive events (VOEs), progressive vasculopathy, hemolytic anemia, and organ damage resulting in frequent hospitalizations and decreased quality of life (QoL). The ongoing phase | Full Paper | |
2021 | Kruta, M;Sunshine, MJ;Chua, BA;Fu, Y;Chawla, A;Dillingham, CH;Hidalgo San Jose, L;De Jong, B;Zhou, FJ;Signer, RAJ; | Hsf1 promotes hematopoietic stem cell fitness and proteostasis in response to ex vivo culture stress and aging | Cell stem cell | 34388375 | Human cord blood derived CD34 + HSPCs were purchased from AllCells. Cell number and viability were assessed with a hemocytometer based on trypan blue exclusion. Save | Full Paper |
2021 | Turchiano, G;Andrieux, G;Klermund, J;Blattner, G;Pennucci, V;El Gaz, M;Monaco, G;Poddar, S;Mussolino, C;Cornu, TI;Boerries, M;Cathomen, T; | Quantitative evaluation of chromosomal rearrangements in gene-edited human stem cells by CAST-Seq | Cell stem cell | 33626327 | Experimental models: cell lines human CD34+ HSPCs AllCells Cat.# CB008F human CD34+ HSPCs StemCell-Technologies Cat.# 70008.3 K562 N/A RRID:CVCL_0004; authenticated by STR profiling | Full Paper |
2021 | Mondala, PK;Vora, AA;Zhou, T;Lazzari, E;Ladel, L;Luo, X;Kim, Y;Costello, C;MacLeod, AR;Jamieson, CHM;Crews, LA; | Selective antisense oligonucleotide inhibition of human IRF4 prevents malignant myeloma regeneration via cell cycle disruption | Cell stem cell | 33476575 | In multiple myeloma, inflammatory and anti-viral pathways promote disease progression and cancer stem cell generation. Using diverse pre-clinical models, we investigated the role of Save | Full Paper |
2021 | Su, M;Lin, Y;Cui, C;Tian, X;Lai, L; | ERMAP is a B7 family-related molecule that negatively regulates T cell and macrophage responses | Cellular & molecular immunology | 32620788 | T cells that were negatively isolated from mononuclear cells using an indirect immunomagnetic Pan-T labeling system were purchased from ALLCELLS, LLC (Alameda, CA). Murine CD3+ T cells were purified from C57BL/6 mice by an immunomagnetic system (Milt | Full Paper |
2021 | Seo, H;Masuda, H;Asagoshi, K;Uchiki, T;Kawata, S;Sasaki, G;Yabuki, T;Miyai, S;Takahashi, N;Hashimoto, SI;Sawada, A;Takaiwa, A;Koyama, C;Tamai, K;Kurosawa, K;Lin, KY;Ohta, K;Nakazaki, Y; | Streamlined human antibody generation and optimization by exploiting designed immunoglobulin loci in a B cell line | Cellular & molecular immunology | 32457406 | The germline-derived divergent hV H harboring CDR3 was prepared from normal human peripheral blood CD19 + B-cell cDNA (ALLCELLS) using degenerate primers that annealed to Save | Full Paper |
2021 | Sadras, T;Martin, M;Kume, K;Robinson, ME;Saravanakumar, S;Lenz, G;Chen, Z;Song, JY;Siddiqi, T;Oksa, L;Knapp, AM;Cutler, J;Cosgun, KN;Klemm, L;Ecker, V;Winchester, J;Ghergus, D;Soulas-Sprauel, P;Kiefer, F;Heisterkamp, N;Pandey, A;Ngo, V;Wang, L;Jumaa, H;Buchner, M;Ruland, J;Chan, WC;Meffre, E;Martin, T;Müschen, M; | Developmental partitioning of SYK and ZAP70 prevents autoimmunity and cancer | Molecular cell | 33878293 | Cord blood derived human CD34 + cells (ALLCELLS) were thawed and were lentivirally transduced with pCL6-ZAP70-GFP or an empty vector control. To obtain optimal transduction, Save | Full Paper |
2021 | Lattanzi, A;Camarena, J;Lahiri, P;Segal, H;Srifa, W;Vakulskas, CA;Frock, RL;Kenrick, J;Lee, C;Talbott, N;Skowronski, J;Cromer, MK;Charlesworth, CT;Bak, RO;Mantri, S;Bao, G;DiGiusto, D;Tisdale, J;Wright, JF;Bhatia, N;Roncarolo, MG;Dever, DP;Porteus, MH; | Development of β-globin gene correction in human hematopoietic stem cells as a potential durable treatment for sickle cell disease | Science translational medicine | 34135108 | Human CD34+ HSPCs were cultured in small-scale conditions as previously described (67, 20, 25, 68, 69). Frozen purified CD34+ HSPCs were sourced from plerixafor- and/or G-CSF-mobilized peripheral blood (AllCells, Alameda, CA, USA and STEMCELL Technol | Full Paper |
2021 | Jain, MS;Polanski, K;Conde, CD;Chen, X;Park, J;Mamanova, L;Knights, A;Botting, RA;Stephenson, E;Haniffa, M;Lamacraft, A;Efremova, M;Teichmann, SA; | MultiMAP: dimensionality reduction and integration of multimodal data | Genome biology | 34930412 | sed to identify genes whose expression changes significantly along the trajectory. Acquisition and processing of human PBMCs PBMCs from two donors were acquired from a LeukoLab (Clinical division of AllCells). Frozen PBMC samples were thawed quickly | Full Paper |
2021 | Thongon, N;Ma, F;Santoni, A;Marchesini, M;Fiorini, E;Rose, A;Adema, V;Ganan-Gomez, I;Groarke, EM;Gutierrez-Rodrigues, F;Chen, S;Lockyer, P;Schneider, S;Bueso-Ramos, C;Montalban-Bravo, G;Class, CA;Soltysiak, KA;Pellegrini, M;Sahin, E;Bertuch, AA;DiNardo, CD;Garcia-Manero, G;Young, NS;Dwyer, K;Colla, S; | Hematopoiesis under telomere attrition at the single-cell resolution | Nature communications | 34824242 | BM samples from HDs were obtained from AllCells. Written informed consent was obtained from all donors. The clinical characteristics and the PB counts of the individuals with Save | Full Paper |
2021 | Qiao, Y;Qiu, Y;Ding, J;Luo, N;Wang, H;Ling, X;Sun, J;Wu, Z;Wang, Y;Liu, Y;Guo, F;Sun, T;Shen, W;Zhang, M;Wu, D;Chen, B;Xu, W;Wang, X; | Cancer immune therapy with PD-1-dependent CD137 co-stimulation provides localized tumour killing without systemic toxicity | Nature communications | 34737267 | Human PBMCs were purchased from Allcells and the informed consent was obtained from all donors. Human PBMCs were cultured in RPMI 1640 medium supplemented with 10% FBS Save | Full Paper |
2021 | Duren, Z;Lu, WS;Arthur, JG;Shah, P;Xin, J;Meschi, F;Li, ML;Nemec, CM;Yin, Y;Wong, WH; | Sc-compReg enables the comparison of gene regulatory networks between conditions using single-cell data | Nature communications | 34362918 | itial analysis has considered the HiChIP data. We will extend our sc-compReg software to enable this type of analysis. Methods Single-cell ATAC Cryopreserved BMMCs from two donors were obtained from AllCells. One donor was a 93-year-old non-Hispanic | Full Paper |
2021 | Amit, I;Iancu, O;Levy-Jurgenson, A;Kurgan, G;McNeill, MS;Rettig, GR;Allen, D;Breier, D;Ben Haim, N;Wang, Y;Anavy, L;Hendel, A;Yakhini, Z; | CRISPECTOR provides accurate estimation of genome editing translocation and off-target activity from comparative NGS data | Nature communications | 34031394 | ubation at room temperature before the electroporation. Genome editing in mobilized CD34+ HSPCs and in HEK293/HEK293-Cas9 cell lines Human CD34+ HSPCs, derived from mobilized peripheral blood (MPB) (AllCells, Alameda, CA), were thawed and cultured f | Full Paper |
2021 | Lal, A;Chiang, ZD;Yakovenko, N;Duarte, FM;Israeli, J;Buenrostro, JD; | Deep learning-based enhancement of epigenomics data with AtacWorks | Nature communications | 33686069 | 0 or 1 representing whether that position was part of a CTCF binding motif on the reverse strand. Generation of dscATAC-seq data for FACS-isolated HSCs Cryopreserved human BMMCs were purchased from Allcells (catalog number BM, CR, MNC, 10 M). Cells | Full Paper |
2021 | Sharma, R;Dever, DP;Lee, CM;Azizi, A;Pan, Y;Camarena, J;Köhnke, T;Bao, G;Porteus, MH;Majeti, R; | The TRACE-Seq method tracks recombination alleles and identifies clonal reconstitution dynamics of gene targeted human hematopoietic stem cells | Nature communications | 33473139 | For in vivo studies presented, cord blood-derived CD34 + cells were purchased from AllCells or STEMCELL Technologies and were thawed according to the manufacturer's Save | Full Paper |
2021 | Yang, KD;Belyaeva, A;Venkatachalapathy, S;Damodaran, K;Katcoff, A;Radhakrishnan, A;Shivashankar, GV;Uhler, C; | Multi-domain translation between single-cell imaging and sequencing data using autoencoders | Nature communications | 33397893 | nly limited functional data is available by acquiring chromatin imaging data. Methods Cell culture and immunostaning CD4+/CD45RA+ naive helper T-cells from human peripheral blood were purchased from AllCells. These cells were revived and cultured in | Full Paper |
2021 | Gnanapragasam, M;Planutis, A;Glassberg, J;Bieker, J; | Identification of a genomic DNA sequence that quantitatively modulates KLF1 expression in differentiating human hematopoietic cells | bioRxiv | CD34+ cells were purchased from AllCells or obtained from the Yale Cooperative Center of Excellence in Hematology. These were differentiated under three-phase protocols, initially based on (Antoniani et al., 2018; Yien and Bieker, 2012) but then late | Full Paper | |
2021 | Shy, B;Vykunta, V;Ha, A;Roth, T;Talbot, A;Nguyen, D;Chen, Y;Blaeschke, F;Vedova, S;Mamedov, M;Chung, J;Li, H;Wolf, J;Martin, T;Ye, L;Eyquem, J;Esensten, J;Marson, A; | Hybrid ssDNA repair templates enable high yield genome engineering in primary cells for disease modeling and cell therapy manufacturing | bioRxiv | Primary adult blood cells were obtained from anonymous healthy human donors as a leukapheresis pack purchased from StemCell Technologies, Inc. or Allcells Inc, or as a Trima residual from Vitalant. If needed, peripheral blood mononuclear cells were i | Full Paper | |
2021 | Amin, OE;Colbeck, EJ;Daffis, S;Khan, S;Ramakrishnan, D;Pattabiraman, D;Chu, R;Micolochick Steuer, H;Lehar, S;Peiser, L;Palazzo, A;Frey, C;Davies, J;Javanbakht, H;Rosenberg, WMC;Fletcher, SP;Maini, MK;Pallett, LJ; | Therapeutic Potential of TLR8 Agonist GS-9688 (Selgantolimod) in Chronic Hepatitis B: Remodeling of Antiviral and Regulatory Mediators | Hepatology (Baltimore, Md.) | 33368377 | In select experiments, whole blood was obtained from AllCells (Alameda, CA) and the MT Group (Van Nuys, CA). In this instance, consent was obtained from the donor or donor's legal Save | Full Paper |
2021 | Shukla, S;Ying, W;Gray, F;Yao, Y;Simes, ML;Zhao, Q;Miao, H;Cho, HJ;González-Alonso, P;Winkler, A;Lund, G;Purohit, T;Kim, E;Zhang, X;Ray, JM;He, S;Nikolaidis, C;Ndoj, J;Wang, J;Jaremko, Ł;Jaremko, M;Ryan, RJH;Guzman, ML;Grembecka, J;Cierpicki, T; | Small-molecule inhibitors targeting Polycomb repressive complex 1 RING domain | Nature chemical biology | 34155404 | CD34-positive bone marrow blood cells were obtained from Allcells (ABM021F) and stored in liquid nitrogen until use. For treatment experiments that lasted more than 4 d, media were Save | Full Paper |
2021 | Jang, S;Song, J;Kim, N;Bak, J;Jung, K;Park, YW;Park, BC;Kim, HM; | Development of an antibody-like T-cell engager based on VH-VL heterodimer formation and its application in cancer therapy | Biomaterials | 33774526 | All healthy donor PBMCs and CD8 + T cells used in this study were purchased from AllCells (#PB004F and #PB009-3 F), Zenbio (#SER-PBMC-200-F), and Lonza (#3W-270). CD3 + T Save | Full Paper |
2021 | Davis-Marcisak, EF;Fitzgerald, AA;Kessler, MD;Danilova, L;Jaffee, EM;Zaidi, N;Weiner, LM;Fertig, EJ; | Transfer learning between preclinical models and human tumors identifies a conserved NK cell activation signature in anti-CTLA-4 responsive tumors | Genome medicine | 34376232 | Fresh healthy donor NK cells were purchased from AllCells (PB012-P). These NK cells were positively selected from donor peripheral blood using CD56 positivity. Donor NK cell purity Save | Full Paper |
2021 | Steinbuck, MP;Seenappa, LM;Jakubowski, A;McNeil, LK;Haqq, CM;DeMuth, PC; | A lymph node-targeted Amphiphile vaccine induces potent cellular and humoral immunity to SARS-CoV-2 | Science advances | 33547083 | scent serum/plasma Convalescent serum samples (n = 7) and plasma samples (n = 15) from patients who had recovered from SARS-CoV-2 infection (COVID-19) were obtained from US Biolab (Rockville, MD) and AllCells (Alameda, CA), respectively. All samples | Full Paper |
2021 | Lin, Y;Cui, C;Su, M;Silbart, LK;Liu, H;Zhao, J;He, L;Huang, Y;Xu, D;Wei, X;Du, Q;Lai, L; | Identification of TAPBPL as a novel negative regulator of T-cell function | EMBO molecular medicine | 33938620 | itro T‐cell assays Normal human peripheral blood CD3+ Pan T cells that were negatively isolated from mononuclear cells using an indirect immunomagnetic Pan‐T labeling system were purchased from ALLCELLS, LLC (Alameda, CA). Murine CD3+ T cells were pu | Full Paper |
2021 | Kim, WT;Hennick, K;Johnson, J;Finnerty, B;Choo, S;Short, SB;Drubin, C;Forster, R;McMaster, ML;Hockemeyer, D; | Cancer-associated POT1 mutations lead to telomere elongation without induction of a DNA damage response | The EMBO journal | 33934394 | e aging or age‐associated diseases (Chakravarti et al, 2021). Materials and Methods Cell culture and cryopreservation Human bone marrow CD34+ hematopoietic stem/progenitor cells were obtained from AllCells and Fred Hutchinson Cancer Research Center. | Full Paper |
2021 | Deegen, P;Thomas, O;Nolan-Stevaux, O;Li, S;Wahl, J;Bogner, P;Aeffner, F;Friedrich, M;Liao, MZ;Matthes, K;Rau, D;Rattel, B;Raum, T;Kufer, P;Coxon, A;Bailis, JM; | The PSMA-targeting Half-life Extended BiTE Therapy AMG 160 has Potent Antitumor Activity in Preclinical Models of Metastatic Castration-resistant Prostate Cancer | Clinical cancer research : an official journal of the American Association for Cancer Research | 33504551 | Human T cells were obtained from AllCells. Human peripheral blood mononuclear cells (PBMC) were isolated from buffy coats collected at the Institute of Clinical Transfusion Medicine Save | Full Paper |
2021 | Giffin, MJ;Cooke, K;Lobenhofer, EK;Estrada, J;Zhan, J;Deegen, P;Thomas, M;Murawsky, CM;Werner, J;Liu, S;Lee, F;Homann, O;Friedrich, M;Pearson, JT;Raum, T;Yang, Y;Caenepeel, S;Stevens, J;Beltran, PJ;Canon, J;Coxon, A;Bailis, JM;Hughes, PE; | AMG 757, a Half-Life Extended, DLL3-Targeted Bispecific T-Cell Engager, Shows High Potency and Sensitivity in Preclinical Models of Small-Cell Lung Cancer | Clinical cancer research : an official journal of the American Association for Cancer Research | 33203642 | human CD3+ T cells (2 × 107) by intravenous infusion on study day 0. Human CD3+ T cells, isolated from PBMCs from two different donors using negative selection, were purchased from AllCells and activated in vitro using IL2 and CD3/CD28/CD2 (STEMCELL | Full Paper |
2021 | Kögler, AC;Kherdjemil, Y;Bender, K;Rabinowitz, A;Marco-Ferreres, R;Furlong, EEM; | Extremely rapid and reversible optogenetic perturbation of nuclear proteins in living embryos | Developmental cell | 34363757 | were also taken from regions not overlapping any mCherry-expressing cells (background (BG)) and from regions overlapping the entire group of cells investigated (AllCells) to Save;each time point, the same measurements were also taken from regions n | Full Paper |
2021 | Montalban-Bravo, G;Kanagal-Shamanna, R;Darbaniyan, F;Siddiqui, MT;Sasaki, K;Wei, Y;Yang, H;Chien, KS;Naqvi, K;Jabbour, E;Kadia, TM;Daver, N;DiNardo, C;Ravandi, F;Pemmaraju, N;Bose, P;Verstovsek, S;Pierce, S;Bueso-Ramos, C;Patel, K;Do, KA;Kantarjian, H;Garcia-Manero, G; | Clinical, genomic, and transcriptomic differences between myelodysplastic syndrome/myeloproliferative neoplasm with ring sideroblasts and thrombocytosis (MDS/MPN-RS-T) and myelodysplastic syndrome with ring sideroblasts (MDS-RS) | American journal of hematology | 33811786 | seven patients with MDS-RS, and 17 healthy individuals obtained from AllCells (Emeryville, CA) were isolated using the CD34 MicroBead Kit and RNA was isolated using the PicoPure RNA isolation kit, following manufacturer's instructions. Fastq files we | Full Paper |
2021 | Kwee, BJ;Lam, J;Akue, A;KuKuruga, MA;Zhang, K;Gu, L;Sung, KE; | Functional heterogeneity of IFN-γ-licensed mesenchymal stromal cell immunosuppressive capacity on biomaterials | Proceedings of the National Academy of Sciences of the United States of America | 34446555 | MSCs obtained from AllCells and Lonza cultured on the two hydrogels (SI Appendix Overall similar observations were obtained with a representative MSC line obtained from AllCells ( Save | Full Paper |
2021 | Cui, L;Moraga, I;Lerbs, T;Van Neste, C;Wilmes, S;Tsutsumi, N;Trotman-Grant, AC;Gakovic, M;Andrews, S;Gotlib, J;Darmanis, S;Enge, M;Quake, S;Hitchcock, IS;Piehler, J;Garcia, KC;Wernig, G; | Tuning MPL signaling to influence hematopoietic stem cell differentiation and inhibit essential thrombocythemia progenitors | Proceedings of the National Academy of Sciences of the United States of America | 33384332 | Healthy deidentified human bone marrow samples were acquired from AllCells. Essential thrombocytosis bone marrow samples were deidentified and acquired from the Stanford Save | Full Paper |
2021 | Poussin, M;Sereno, A;Wu, X;Huang, F;Manro, J;Cao, S;Carpenito, C;Glasebrook, A;Powell, DJ;Demarest, S; | Dichotomous impact of affinity on the function of T cell engaging bispecific antibodies | Journal for immunotherapy of cancer | 34253637 | w cytometric evaluation of cell surface proteins on T cells 48 hours after mixing SKOV3 cells and biologic test articles is further described in online supplemental methods. Briefly, human T cells (ALLCELLS frozen normal human peripheral blood CD3+ P | Full Paper |
2021 | Roselli, E;Boucher, JC;Li, G;Kotani, H;Spitler, K;Reid, K;Cervantes, EV;Bulliard, Y;Tu, N;Lee, SB;Yu, B;Locke, FL;Davila, ML; | 4-1BB and optimized CD28 co-stimulation enhances function of human mono-specific and bi-specific third-generation CAR T cells | Journal for immunotherapy of cancer | 34706886 | Human peripheral blood mononuclear cells (PBMCs) were purchased from AllCells. T cells were enriched from PBMCs using the EasySep human T cell isolation kit according to Save | Full Paper |
2021 | Paavola, KJ;Roda, JM;Lin, VY;Chen, P;O'Hollaren, KP;Ventura, R;Crawley, SC;Li, B;Chen, HH;Malmersjö, S;Sharkov, NA;Horner, G;Guo, W;Kutach, AK;Mondal, K;Zhang, Z;Lichtman, JS;Song, C;Rivera, LB;Liu, W;Luo, J;Wang, Y;Solloway, MJ;Allan, BB;Kekatpure, A;Starck, SR;Haldankar, R;Fan, B;Chu, C;Tang, J;Molgora, M;Colonna, M;Kaplan, DD;Hsu, JY; | The Fibronectin-ILT3 Interaction Functions as a Stromal Checkpoint that Suppresses Myeloid Cells | Cancer immunology research | 34426457 | Human peripheral blood mononuclear cells (PBMC) of healthy donors were isolated from freshly drawn leukopaks (Allcells, catalog no. PB007) by density gradient centrifugation over Save | Full Paper |
2021 | Badeaux, MD;Rolig, AS;Agnello, G;Enzler, D;Kasiewicz, MJ;Priddy, L;Wiggins, JF;Muir, A;Sullivan, MR;Van Cleef, J;Daige, C;Vander Heiden, MG;Rajamanickam, V;Wooldridge, JE;Redmond, WL;Rowlinson, SW; | Arginase Therapy Combines Effectively with Immune Checkpoint Blockade or Agonist Anti-OX40 Immunotherapy to Control Tumor Growth | Cancer immunology research | 33500272 | Primary human bone marrow (AllCells) was obtained from healthy patients and cultured as follows. Briefly, Hs5 cells were cultured for 72 hours in SFEM2 media (Stem Cell Save | Full Paper |
2021 | Boucher, JC;Li, G;Kotani, H;Cabral, ML;Morrissey, D;Lee, SB;Spitler, K;Beatty, NJ;Cervantes, EV;Shrestha, B;Yu, B;Kazi, A;Wang, X;Sebti, SM;Davila, ML; | CD28 Costimulatory Domain-Targeted Mutations Enhance Chimeric Antigen Receptor T-cell Function | Cancer immunology research | 33188139 | An obstacle to the development of chimeric antigen receptor (CAR) T cells is the limited understanding of CAR T-cell biology and the mechanisms behind their antitumor activity. We and Save | Full Paper |
2021 | Li, J;Whelan, S;Kotturi, MF;Meyran, D;D'Souza, C;Hansen, K;Liang, S;Hunter, J;Trapani, JA;Neeson, PJ; | PVRIG is a novel natural killer cell immune checkpoint receptor in acute myeloid leukemia | Haematologica | 33147937 | nt clinical characteristics are summarised in the Online Supplementary Table S2. Healthy donor bone marrow samples were obtained from Royal Melbourne Hospital (Melbourne, Australia) or purchased from AllCells (Alameda, California). All bone marrow sa | Full Paper |
2021 | Gilmartin, AG;Groy, A;Gore, ER;Atkins, C;Long, ER;Montoute, MN;Wu, Z;Halsey, W;McNulty, DE;Ennulat, D;Rueda, L;Pappalardi, M;Kruger, RG;McCabe, MT;Raoof, A;Butlin, R;Stowell, A;Cockerill, M;Waddell, I;Ogilvie, D;Luengo, J;Jordan, A;Benowitz, AB; | In vitro and in vivo induction of fetal hemoglobin with a reversible and selective DNMT1 inhibitor | Haematologica | 32586904 | Cryopreserved human bone marrow CD34+ cells (AllCells) were confirmed to be sourced ethically, and their research use was in accord with the terms of the informed consents under Save | Full Paper |
2021 | Zhang, C;Zhang, X;Huang, L;Guan, Y;Huang, X;Tian, XL;Zhang, L;Tao, W; | ATF3 drives senescence by reconstructing accessible chromatin profiles | Aging cell | 33539668 | accessibility in IARs. Accordingly, our research provides a target to aim for in the exploration of senescence and aging. 4 EXPERIMENTAL PROCEDURES 4.1 Cell culture We purchased primary HUVECs from AllCells Biotech Shanghai Co., Ltd., and cultured t | Full Paper |
2021 | Nesterenko, PA;McLaughlin, J;Tsai, BL;Burton Sojo, G;Cheng, D;Zhao, D;Mao, Z;Bangayan, NJ;Obusan, MB;Su, Y;Ng, RH;Chour, W;Xie, J;Li, YR;Lee, D;Noguchi, M;Carmona, C;Phillips, JW;Kim, JT;Yang, L;Heath, JR;Boutros, PC;Witte, ON; | HLA-A∗02:01 restricted T cell receptors against the highly conserved SARS-CoV-2 polymerase cross-react with human coronaviruses | Cell reports | 34919800 | Cryo preserved peripheral blood mononuclear cells (PBMCs) were commercially purchased (Allcells and Hemacare) or obtained from the CFAR Virology Core Laboratory at the UCLA Save;d virus strains ------------------------- NFAT-zsGreen virus UCLA, | Full Paper |
2021 | Qian, Y;Arellano, G;Ifergan, I;Lin, J;Snowden, C;Kim, T;Thomas, JJ;Law, C;Guan, T;Balabanov, RD;Kaech, SM;Miller, SD;Choi, J; | ZEB1 promotes pathogenic Th1 and Th17 cell differentiation in multiple sclerosis | Cell reports | 34433042 | FN-γ, 1 μg/mL anti-IL2 (Cat #554375, clone: S4B6, BD). Isolation of human CD4+ naive T cells and Th cells differentiation Fresh Leukopak samples from de-identified blood donors were purchased from AllCells, LLC. Peripheral blood mononuclear cells (P | Full Paper |
2021 | Hamilton, JR;Tsuchida, CA;Nguyen, DN;Shy, BR;McGarrigle, ER;Sandoval Espinoza, CR;Carr, D;Blaeschke, F;Marson, A;Doudna, JA; | Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineering | Cell reports | 34077734 | ons. Isolation and culture of human primary T cells Primary adult blood cells were obtained from anonymous healthy human donors as a leukoreduction pack purchased from StemCell Technologies, Inc. or Allcells Inc, or as a Trima residual from Vitalant | Full Paper |
2021 | Jiang, Q;Isquith, J;Ladel, L;Mark, A;Holm, F;Mason, C;He, Y;Mondala, P;Oliver, I;Pham, J;Ma, W;Reynoso, E;Ali, S;Morris, IJ;Diep, R;Nasamran, C;Xu, G;Sasik, R;Rosenthal, SB;Birmingham, A;Coso, S;Pineda, G;Crews, L;Donohoe, ME;Venter, JC;Whisenant, T;Mesa, RA;Alexandrov, LB;Fisch, KM;Jamieson, C; | Inflammation-driven deaminase deregulation fuels human pre-leukemia stem cell evolution | Cell reports | 33503434 | Aged normal and MPN Patient samples Obtained through patients consenting at UCSD Moores Cancer Center according to Institutional Review Boardapproved protocols. N/A Young Cord blood CD34+ cells Purchased from AllCells or StemCell Technologies | Full Paper |
2021 | Bunis, DG;Bronevetsky, Y;Krow-Lucal, E;Bhakta, NR;Kim, CC;Nerella, S;Jones, N;Mendoza, VF;Bryson, YJ;Gern, JE;Rutishauser, RL;Ye, CJ;Sirota, M;McCune, JM;Burt, TD; | Single-Cell Mapping of Progressive Fetal-to-Adult Transition in Human Naive T Cells | Cell reports | 33406429 | Matched adult peripheral blood and BM samples were obtained from healthy volunteer donors through AllCells (Alameda, CA). UCB and longitudinal post-natal samples were obtained Save | Full Paper |
2021 | Yang, Z;Huang, Y;Zhu, L;Yang, K;Liang, K;Tan, J;Yu, B; | SIRT6 promotes angiogenesis and hemorrhage of carotid plaque via regulating HIF-1α and reactive oxygen species | Cell death & disease | 33436551 | oCl2) was purchased from Sigma-Aldrich, Inc. (Burlington, MA, USA). The work concentration and time were confirmed by instructions combined with experimental requirements. HUVECs were purchased from Allcells, Inc. (Alameda, CA, USA) and cultured in | Full Paper |
2021 | Yang, Z;Wei, X;Pan, Y;Xu, J;Si, Y;Min, Z;Yu, B; | A new risk factor indicator for papillary thyroid cancer based on immune infiltration | Cell death & disease | 33414407 | d. The sections were fixed and images were obtained with an inverted microscope (Olympus IX71, Japan). Cell culture and co-culture Human umbilical vein endothelial cells (HUVECs) were purchased from Allcells, Inc. (Alameda, CA, USA) and cultured in | Full Paper |
2021 | Everitt, ML;Boegner, DJ;Birukov, KG;White, IM; | Sample-to-Answer Diagnostic System for the Detection of Circulating Histones in Whole Blood | ACS sensors | 34270219 | Varying concentrations of histone octamers (Sigma-Aldrich) (0-65 μg/mL final concentrations) are suspended in either fetal bovine serum (FBS) (ATCC) or whole blood (AllCells) (medium is indicated in figure caption). Fifteen microliters of histone-spi | Full Paper |
2021 | Varricchio, L;Iancu-Rubin, C;Upadhyaya, B;Zingariello, M;Martelli, F;Verachi, P;Clementelli, C;Denis, JF;Rahman, AH;Tremblay, G;Mascarenhas, J;Mesa, RA;O'Connor-McCourt, M;Migliaccio, AR;Hoffman, R; | TGF-β1 protein trap AVID200 beneficially affects hematopoiesis and bone marrow fibrosis in myelofibrosis | JCI insight | 34383713 | n and response to TGF-β. Methods Further information and complete unedited blots can be found in Supplemental Methods. Human subjects. Primary ND specimens were purchased from a commercial source (AllCells, LLC), whereas MF MNCs were provided by th | Full Paper |
2021 | Pan, Y;You, Y;Sun, L;Sui, Q;Liu, L;Yuan, H;Chen, C;Liu, J;Wen, X;Dai, L;Sun, H; | The STING antagonist H-151 ameliorates psoriasis via suppression of STING/NF-κB-mediated inflammation | British journal of pharmacology | 34460100 | Peripheral blood mononuclear cells (PBMCs) were purchased from AllCells Shanghai and were used immediately after resuscitation. H-151 was synthesized according to the published Save | Full Paper |
2021 | Hu, X;Qie, C;Jiang, J;Xie, X;Chen, W;Liu, W;Liu, J; | M351-0056 is a novel low MW compound modulating the actions of the immune-checkpoint protein VISTA | British journal of pharmacology | 33450048 | Peripheral blood mononuclear cells (PBMCs) were purchased from AllCells and were used immediately after resuscitation; these cells cannot be subcultured. Human CD4 + T cells Save | Full Paper |
2021 | Wang, X;Guo, J;Wen, J;Zhang, X;Cao, L;Zeng, D;Liu, X;Jiang, X; | Novel vascular strategies on polyetheretherketone modification in promoting osseointegration in ovariectomized rats | Materials & Design | HUVECs were purchased from AllCells Biology Technology Company (Shanghai, China). HUVECs were cultured in endothelial basal medium (EBM, Lonza) without endothelial cell growth supplementation. HUVECs at a density of 2 × 104 cells per mL were seeded o | Full Paper | |
2021 | Iftakhar-E-Khuda, I;Pessia, A;Zheng, S;Kankainen, M;Kontro, M;Karikoski, M;Laurila, J;Gerke, H;Tadayon, S;Hollmén, M;Tang, J;Imhof, BA;Salmi, M;Jalkanen, S; | Vascular adhesion protein-1 defines a unique subpopulation of human hematopoietic stem cells and regulates their proliferation | Cellular and molecular life sciences : CMLS | 34719737 | Five hundred cryopreserved and thawed human BM CD34 + cells (AllCells) were cultured in complete methylcellulose-based medium (H4436, STEMCELL Technologies) with or Save | Full Paper |
2021 | Huang, YJ;Cao, J;Lee, CY;Wu, YM; | Umbilical cord blood plasma-derived exosomes as a novel therapy to reverse liver fibrosis | Stem cell research & therapy | 34772443 | Human UCB and peripheral blood (PB) plasma were purchased from AllCells LLC (Alameda, CA), and exosomes were acquired using ExoQuick Exosome isolation reagent (System Save | Full Paper |
2021 | Pieles, O;Reichert, TE;Morsczeck, C; | Classical isoforms of protein kinase C (PKC) and Akt regulate the osteogenic differentiation of human dental follicle cells via both β-catenin and NF-κB | Stem cell research & therapy | 33853677 | to examine the role of classical PKC isoforms and the potential downstream mechanisms during the osteogenic differentiation of DFCs. Materials and methods Cell culture Human DFCs were purchased from AllCells (Emeryville, USA) and grown in Dulbecco’s | Full Paper |
2021 | Lin, Z;Liu, X;Liu, T;Gao, H;Wang, S;Zhu, X;Rong, L;Cheng, J;Cai, Z;Xu, F;Tan, X;Lv, L;Li, Z;Sun, Y;Qian, Q; | Evaluation of Nonviral piggyBac and lentiviral Vector in Functions of CD19chimeric Antigen Receptor T Cells and Their Antitumor Activity for CD19+ Tumor Cells | Frontiers in immunology | 35082789 | Peripheral blood mononuclear cells (PBMCs) from whole blood were purchased from AllCells (Shanghai, China) and isolated by Ficoll density gradient centrifugation (Cat#17-5442-03, Save | Full Paper |
2021 | Cui, X;Jia, H;Xin, H;Zhang, L;Chen, S;Xia, S;Li, X;Xu, W;Chen, X;Feng, Y;Wei, X;Yu, H;Wang, Y;Zhan, Y;Zhu, X;Zhang, X; | A Novel Bispecific Antibody Targeting PD-L1 and VEGF With Combined Anti-Tumor Activities | Frontiers in immunology | 34925354 | Human PBMCs and DCs were acquired by using the Easy MLR Kit (Allcells, Alameda). DCs were treated with mitomycin (H19999025, Hisun Pharm Co., Ltd.) for 30 min before co- Save | Full Paper |
2021 | Ceglia, V;Kelley, EJ;Boyle, AS;Zurawski, S;Mead, HL;Harms, CE;Blanck, JP;Flamar, AL;Kirschman, JH;Ogongo, P;Ernst, JD;Levy, Y;Zurawski, G;Altin, JA; | A Framework to Identify Antigen-Expanded T Cell Receptor Clusters Within Complex Repertoires | Frontiers in immunology | 34917073 | cificity, are described in other studies (16, 17, 19). Cohesin-Influenza Matrix 1 (Flu M1) protein is described in (16). Donors Cryopreserved human PBMC from normal donors were sourced commercially (AllCells, CA. ND1001 ID:A5983, ND1002 ID:9441, ND1 | Full Paper |
2021 | Teo Hansen Selnø, A;Schlichtner, S;Yasinska, IM;Sakhnevych, SS;Fiedler, W;Wellbrock, J;Berger, SM;Klenova, E;Gibbs, BF;Fasler-Kan, E;Sumbayev, VV; | High Mobility Group Box 1 (HMGB1) Induces Toll-Like Receptor 4-Mediated Production of the Immunosuppressive Protein Galectin-9 in Human Cancer Cells | Frontiers in immunology | 34234778 | Medical Centre Hamburg-Eppendorf (Ethik Kommission der Ärztekammer Hamburg, reference: PV3469). Primary human AML mononuclear blasts (AML-PB001F, newly diagnosed/untreated) were also purchased from AllCells (Alameda, CA, USA) and handled in accordanc | Full Paper |
2021 | Xie, X;Chen, C;Chen, W;Jiang, J;Wang, L;Li, T;Sun, H;Liu, J; | Structural Basis of VSIG3: The Ligand for VISTA | Frontiers in immunology | 33841409 | azole buffer (GenScript). Protein was concentrated using 10K MWCO spin columns (Merck). The purified protein was used for functional verification. Cell Culture and Reagents PBMCs were purchased from Allcells Biotechnology (Shanghai) Co., LTD, and we | Full Paper |
2021 | Jost, M;Jacobson, AN;Hussmann, JA;Cirolia, G;Fischbach, MA;Weissman, JS; | CRISPR-based functional genomics in human dendritic cells | eLife | 33904395 | t al., 2018 Referred to as ‘B. theta 4PP’ in the text Mutant producing tetra-acylated, di-phosphorylated lipid A in a capsule-producing background Biological sample (human) PBMCs AllCells Freshly isolated from de-identified healt | Full Paper |
2021 | Gao, X;Guan, M;Liu, X;Xu, H;Huang, Q;Chen, L;Huang, S;Xiao, Y;Shi, X;Lin, Z; | Sustained delivery of growth factors and alendronate using partially demineralized dentin matrix for endogenous periodontal regeneration | Applied Materials Today | cells (HUVECs) were purchased from AllCells (Shanghai, China). HUVECs were cultured in endothelial cell growth medium (EGM; AllCells, Shanghai, China). Angiogenesis Save | Full Paper | |
2021 | Scherer, SD;Riggio, AI;Haroun, F;DeRose, YS;Ekiz, HA;Fujita, M;Toner, J;Zhao, L;Li, Z;Oesterreich, S;Samatar, AA;Welm, AL; | An immune-humanized patient-derived xenograft model of estrogen-independent, hormone receptor positive metastatic breast cancer | Breast cancer research : BCR | 34717714 | CD34 + hematopoietic stem cells (HSCs) isolated from healthy donor bone marrow (BM) were purchased from AllCells. On the day of injection, cells were thawed in a 37 C water bath Save | Full Paper |
2021 | Nada, MH;Wang, H;Hussein, AJ;Tanaka, Y;Morita, CT; | PD-1 checkpoint blockade enhances adoptive immunotherapy by human Vγ2Vδ2 T cells against human prostate cancer | Oncoimmunology | 34712512 | e IgG1 (clone MOPC-21) antibodies were from Bio X Cell (West Lebanon, NH). Ex vivo expansion of Vγ2Vδ2 T cells by pulse zoledronic acid stimulation PBMC were isolated from random donor leukopaks (AllCells, LLC, Alameda, CA) by density centrifugation | Full Paper |
2021 | Jiang, H;Ni, H;Zhang, P;Guo, X;Wu, M;Shen, H;Wang, J;Wu, W;Wu, Z;Ding, J;Tang, R;Zhou, S;Chen, B;Yu, M;Jing, H;Liu, J; | PD-L1/LAG-3 bispecific antibody enhances tumor-specific immunity | Oncoimmunology | 34239776 | oduced by Innovent Biologics Co., Ltd. (Suzhou, China). Human IgG was purchased from Equitech-Bio (Kerrville). Peripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs) were purchased from AllCells (Shanghai, China). Cynomolgus macaque PBM | Full Paper |
2021 | Wang, X;Peticone, C;Kotsopoulou, E;Göttgens, B;Calero-Nieto, FJ; | Single-cell transcriptome analysis of CAR T-cell products reveals subpopulations, stimulation, and exhaustion signatures | Oncoimmunology | 33489472 | or samples PBMCs were derived from healthy donors leukapheresis. Peripheral blood leukapaheresis were obtained from the NHS as part of a research study (IRAS ID 185945) or purchased as LeukoPaks from AllCells. Manufacturing of CAR T cells product Ge | Full Paper |
2021 | Zhang, C;Delawary, M;Huang, P;Korchak, JA;Suda, K;Zubair, AC; | IL-10 mRNA Engineered MSCs Demonstrate Enhanced Anti-Inflammation in an Acute GvHD Model | Cells | 34831324 | g T7 promoter, 5′ UTRs, 3′ UTRs, and poly-A tail. 2.3. MSC Culture and Time Course Experiment Human MSCs were generated from commercial de-identified bone marrow (Catalog# ABM002) purchased from AllCells (Alameda, CA, USA). The donor was a healthy 2 | Full Paper |
2021 | Ahn, Y;An, JH;Yang, HJ;Lee, DG;Kim, J;Koh, H;Park, YH;Song, BS;Sim, BW;Lee, HJ;Lee, JH;Kim, SU; | Human Blood Vessel Organoids Penetrate Human Cerebral Organoids and Form a Vessel-Like System | Cells | 34440805 | Human Induced Pluripotent Stem Cells (hiPSCs) and Culture Conditions The hiPSCs were reprogrammed from primary human bone marrow cells (Allcells, Emeryville, CA, USA) as Save;The hiPSCs were reprogrammed from primary human bone marrow cells (Allcel | Full Paper |
2021 | Dogan, F;Aljumaily, RMK;Kitchen, M;Forsyth, NR; | DNMT3B Is an Oxygen-Sensitive De Novo Methylase in Human Mesenchymal Stem Cells | Cells | 33925659 | nd Methods 2.1. Isolation and Culture of BM-hMSCs Three human BM-hMSCs BMA-16 (Male, Age—29 years, Lonza, MD, USA), BMA-20 (Female, Age—50 years, Lonza, MD, USA) and BMA-25 (Male, Age—27 years, AllCells, LLC, Alameda, CA, USA) were isolated from comm | Full Paper |
2021 | Miao, G;Sun, X; | Development of a novel anti-B7-H4 antibody enhances anti-tumor immune response of human T cells | Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie | 34328096 | Human PBMCs were purchased from ALLCELLS. Hybridoma cell lines were cultured in H-SFM complete medium. CD8+ T cells were cultured in RPMI 1640 medium containing 2 mM L- Save | Full Paper |
2021 | Gu, C;Cao, X;Wang, Z;Hu, X;Yao, Y;Zhou, Y;Liu, P;Liu, X;Gao, G;Hu, X;Zhang, Y;Chen, Z;Gao, L;Peng, Y;Jia, F;Shan, C;Yu, L;Liu, K;Li, N;Guo, W;Jiang, G;Min, J;Zhang, J;Yang, L;Shi, M;Hou, T;Li, Y;Liang, W;Lu, G;Yang, C;Wang, Y;Xia, K;Xiao, Z;Xue, J;Huang, X;Chen, X;Ma, H;Song, D;Pan, Z;Wang, X;Guo, H;Liang, H;Yuan, Z;Guan, W;Deng, SJ; | A human antibody of potent efficacy against SARS-CoV-2 in rhesus macaques showed strong blocking activity to B.1.351 | mAbs | 34097570 | ed SARS-CoV-2 RBD (Sino Biological, 40592-V05H). Phage libraries were constructed using antibody gene fragments amplified from peripheral blood mononuclear cells (PBMCs) of 50 healthy human subjects (Allcells, PB003F and PB003 C) and total RNA from P | Full Paper |
2021 | Chen, J;Ding, J;Wu, Y;Zhang, S;Zheng, N;Yang, J;Xu, J; | Chromium Oxide Nanoparticle Impaired Osteogenesis and Cellular Response to Mechanical Stimulus | International journal of nanomedicine | 34511912 | Human MSCs were isolated from bone marrow aspirate (ALLCELLS, Lot No: BM2893). The cells were grown in α-MEM (Gibco, Thermo Fisher Scientific, UK) supplemented with 10% Save | Full Paper |
2021 | Shin, Y;Park, CM;Kim, HG;Kim, DE;Choi, MS;Kim, JA;Choi, BS;Yoon, CH; | Identification of Aristolactam Derivatives That Act as Inhibitors of Human Immunodeficiency Virus Type 1 Infection and Replication by Targeting Tat-Mediated Viral Transcription | Virologica Sinica | 32779073 | Peripheral blood mononuclear cells (PBMCs) were purchased from AllCells (Alameda, CA, USA) and cultured, as described previously (Yoon et al. 2015). HIV-1 clones pNL4-3 and AD8, as well as TZM-bl and A3.01 cells, were obtained from the National Insti | Full Paper |
2021 | Wang, Y;Ni, H;Zhou, S;He, K;Gao, Y;Wu, W;Wu, M;Wu, Z;Qiu, X;Zhou, Y;Chen, B;Pan, D;Huang, C;Li, M;Bian, Y;Yang, M;Miao, L;Liu, J; | Tumor-selective blockade of CD47 signaling with a CD47/PD-L1 bispecific antibody for enhanced anti-tumor activity and limited toxicity | Cancer immunology, immunotherapy : CII | 32761423 | CD4+ T cells were isolated from human PBMC (AllCells) using EasySep human CD4+ T cells enrichment kit (StemCell Technologies). DCs were generated by incubating PBMC first Save | Full Paper |
2021 | Luban, J;Sattler, RA;Mühlberger, E;Graci, JD;Cao, L;Weetall, M;Trotta, C;Colacino, JM;Bavari, S;Strambio-De-Castillia, C;Suder, EL;Wang, Y;Soloveva, V;Cintron-Lue, K;Naryshkin, NA;Pykett, M;Welch, EM;O'Keefe, K;Kong, R;Goodwin, E;Jacobson, A;Paessler, S;Peltz, SW; | The DHODH inhibitor PTC299 arrests SARS-CoV-2 replication and suppresses induction of inflammatory cytokines | Virus research | 33249060 | c. Uridine, brequinar, and A77 were obtained from Sigma-Aldrich (St. Louis, MO). Anti IL-4 and anti-IFL-γ antibodies were obtained from BD Biosciences (San Jose, CA). Frozen PBMCs were obtained from AllCells (Alameda, CA). IL-17, IL-17 F and IL-23 EL | Full Paper |
2021 | Satani, N;Zhang, X;Giridhar, K;Wewior, N;Cai, C;Aronowski, J;Savitz, SI; | A Combination of Atorvastatin and Aspirin Enhances the Pro-Regenerative Interactions of Marrow Stromal Cells and Stroke-Derived Monocytes In Vitro | Frontiers in pharmacology | 33959001 | d of stroke patients. Methods Isolation and Culture of Human Mesenchymal Stromal Cells (MSCs) MSCs were isolated from commercially available fresh human bone marrow aspirates of a 34 year old male (AllCells, Alameda, CA) using density centrifugation | Full Paper |
2021 | Sun, LK; | Engineering genetic thermal switches for remote control of therapeutic T cells | Thesis | Primary human CD3+ T cells were obtained from anonymous donor blood following apheresis (AllCells) and were cryopreserved until subsequent use. Two days prior to lentiviral Save | Full Paper | |
2021 | Wu, HH;Ralph, KL;Sepuldeva, E;Hansen, G;Li, H;Huang, ZF;Liu, D;Dziegelewski, M;Ahlberg, J;Frego, L;Fogal, S;van Tongeren, S;Grimaldi, C;Litzenberger, T;Presky, D;Singh, S;Brodeur, S;Kroe-Barrett, R; | An optimally designed anti-human CD40 antibody with potent B cell suppression for the treatment of autoimmune diseases | International journal of pharmaceutics | 34624444 | Effector cells were generated by stimulating human peripheral blood mononuclear cells (PBMCs) (AllCells) with 10 ng/mL human IL-2 (R&D Systems) in RPMI 1640 medium (Invitrogen) Save | Full Paper |
2021 | Xiang, H;Chan, AG;Ahene, A;Bellovin, DI;Deng, R;Hsu, AW;Jeffry, U;Palencia, S;Powers, J;Zanghi, J;Collins, H; | Preclinical characterization of bemarituzumab, an anti-FGFR2b antibody for the treatment of cancer | mAbs | 34719330 | the full-length human FGFR2b described as Ba/F3 FGFR2b, and the effector cells were peripheral blood mononuclear cells obtained fresh from individual human donors (AllCells; Save | Full Paper |
2021 | Li, G;Guo, J;Zheng, Y;Ding, W;Han, Z;Qin, L;Mo, W;Luo, M; | CXCR5 guides migration and tumor eradication of anti-EGFR chimeric antigen receptor T cells | Molecular therapy oncolytics | 34553036 | CAR-T cells were generated from commercial normal donor peripheral blood mononuclear cells (PBMCs) from AllCells. The cells were further enriched from PBMC by CD3 magnetic Save;.22-μm filter, aliquoted to 2 mL cryotubes, quick frozen on dry ice, an | Full Paper |
2021 | Chen, X;Yang, S;Li, S;Qu, Y;Wang, HY;Liu, J;Dunn, ZS;Cinay, GE;MacMullan, MA;Hu, F;Zhang, X;Wang, P; | Secretion of bispecific protein of anti-PD-1 fused with TGF-β trap enhances antitumor efficacy of CAR-T cell therapy | Molecular therapy oncolytics | 33981830 | Frozen human PBMCs were obtained from AllCells. The T cell culture medium (TCM) was composed of AIM-V medium with 5% (v/v) human AB serum, 10 mM HEPES, 1% (v/v) Save;ng gag-pol. The supernatants were harvested at 48 h after transfection and filtere | Full Paper |
2021 | Branquinho, MV;Ferreira, SO;Alvites, RD;Magueta, AF;Ivanov, M;Sousa, AC;Amorim, I;Faria, F;Fernandes, MHV;Vilarinho, PM;Maurício, AC; | In Vitro and In Vivo Characterization of PLLA-316L Stainless Steel Electromechanical Devices for Bone Tissue Engineering-A Preliminary Study | International journal of molecular sciences | 34299274 | e enthalpy of fusion of 100% crystalline material [54]. (1)XC (%)=ΔHfΔHf0×100 4.3. In Vitro Assays 4.3.1. Cell Culture and Maintenance Human Dental Pulp stem/stromal cells (hDPSCs) obtained from AllCells, LLC, Alameda, CA, USA (Cat. DP0037F, Lot no. | Full Paper |
2021 | Thavapalachandran, S;Le, TYL;Romanazzo, S;Rashid, FN;Ogawa, M;Kilian, KA;Brown, P;Pouliopoulos, J;Barry, AM;Fahmy, P;Kelly, K;Kizana, E;Chong, JJH; | Pluripotent stem cell-derived mesenchymal stromal cells improve cardiac function and vascularity after myocardial infarction | Cytotherapy | 34588150 | Cells were kept cold on ice until administration to animals. BM-MSCs were purchased from AllCells (Alameda, CA, USA). Cryopreserved BM-MSCs were washed twice in DMEM and resuspended at the same density as Cymerus MSC derivatives (5 × 106 cells per 10 | Full Paper |
2021 | Kavanagh, H;Dunne, S;Martin, DS;McFadden, E;Gallagher, L;Schwaber, J;Leonard, S;O'Dea, S; | A novel non-viral delivery method that enables efficient engineering of primary human T cells for ex vivo cell therapy applications | Cytotherapy | 33941482 | cells with minimal perturbation of cell function. Methods Ethics All experimental methods were carried out in accordance with the approved guidelines. Leukopaks from healthy donors were sourced from AllCells (Quincy, MA, USA) or BioIVT (Westbury, NY | Full Paper |
2021 | Wang, Y;Zhong, K;Ke, J;Chen, X;Chen, Y;Shu, W;Chen, C;Hu, S;Sun, X;Huang, H;Luo, C;Liu, L;Yang, J;Zhang, Y;Zhi, H; | Combined 4-1BB and ICOS co-stimulation improves anti-tumor efficacy and persistence of dual anti-CD19/CD20 chimeric antigen receptor T cells | Cytotherapy | 33863641 | Human peripheral blood mononuclear cells (PBMCs) from healthy donors were obtained from AllCells. The cryopreserved PBMCs were thawed into the T-cell culture medium and Save | Full Paper |
2021 | Martin, A;Daris, M;Johnston, JA;Cui, J; | HLA-A*02:01-directed chimeric antigen receptor/forkhead box P3-engineered CD4+ T cells adopt a regulatory phenotype and suppress established graft-versus-host disease | Cytotherapy | 33309258 | A*02:01- peripheral blood mononuclear cells (PBMCs) from four donors were isolated from fresh Leukopak (AllCells) using Ficoll density gradient media. CD4+ T cells or Tregs were Save | Full Paper |
2021 | Story, JY;Zoine, JT;Burnham, RE;Hamilton, JAG;Spencer, HT;Doering, CB;Raikar, SS; | Bortezomib enhances cytotoxicity of ex vivo-expanded gamma delta T cells against acute myeloid leukemia and T-cell acute lymphoblastic leukemia | Cytotherapy | 33168453 | PBMCs (50-100 million per donor) from six different healthy donors were obtained through AllCells ( Eight total expansions from PBMCs from AllCells were performed, with two separate Save | Full Paper |
2021 | Banerjee, A;Lu, Y;Do, K;Mize, T;Wu, X;Chen, X;Chen, J; | Validation of Induced Microglia-Like Cells (iMG Cells) for Future Studies of Brain Diseases | Frontiers in cellular neuroscience | 33897370 | ity for polarization. With whole-genome transcript profile, we also demonstrated that iMG cells were clustered closely with human microglia. Materials and Methods Materials PBMCs were purchased from AllCells, LLC (Alameda, CA, USA, #PB003F and #PB00 | Full Paper |
2021 | Stem, C;Rodman, C;Ramamurthy, RM;George, S;Meares, D;Farland, A;Atala, A;Doering, CB;Spencer, HT;Porada, CD;Almeida-Porada, G; | Investigating Optimal Autologous Cellular Platforms for Prenatal or Perinatal Factor VIII Delivery to Treat Hemophilia A | Frontiers in cell and developmental biology | 34447745 | Bone marrow mononuclear cells from two different biological donors were purchased from AllCells (Alameda, CA, United States) and their purchase approved by the Office of Human Save | Full Paper |
2021 | Han, Y;Chen, Q;Zhang, L;Dissanayaka, WL; | Indispensable Role of HIF-1α Signaling in Post-implantation Survival and Angio-/Vasculogenic Properties of SHED | Frontiers in cell and developmental biology | 34368116 | e expression of target proteins that mediate adaptive metabolic mechanisms in both in vivo and in vitro survival and angiogenesis in SHED. Materials and Methods Cell Culture SHED were purchased from AllCells (Alameda, CA, United States) and cultured | Full Paper |
2021 | Yazawa, T;Inaba, H;Imamichi, Y;Sekiguchi, T;Uwada, J;Islam, MS;Orisaka, M;Mikami, D;Ida, T;Sato, T;Miyashiro, Y;Takahashi, S;Khan, MRI;Suzuki, N;Umezawa, A;Kitano, T; | Profiles of 5α-Reduced Androgens in Humans and Eels: 5α-Dihydrotestosterone and 11-Ketodihydrotestosterone Are Active Androgens Produced in Eel Gonads | Frontiers in endocrinology | 33833737 | healthy women volunteers (obtaining informed consent) at University of Fukui Hospital in 2007. Plasma was separated by centrifugation at 1000g for 5 minutes. Other plasma samples were purchased from AllCells (Alameda, CA, USA) and ProMedDX (Norton, M | Full Paper |
2021 | Sternjak, A;Lee, F;Thomas, O;Balazs, M;Wahl, J;Lorenczewski, G;Ullrich, I;Muenz, M;Rattel, B;Bailis, JM;Friedrich, M; | Preclinical Assessment of AMG 596, a Bispecific T-cell Engager (BiTE) Immunotherapy Targeting the Tumor-specific Antigen EGFRvIII | Molecular cancer therapeutics | 33632870 | Human pan-T cells (AllCells) were added at an E:T ratio of 10:1 with a dose range of AMG 596. Microvesicles were added simultaneously with T cells and AMG 596 to maintain Save | Full Paper |
2021 | Massimino, M;Tirrò, E;Stella, S;Manzella, L;Pennisi, MS;Romano, C;Vitale, SR;Puma, A;Tomarchio, C;Di Gregorio, S;Antolino, A;Di Raimondo, F;Vigneri, P; | Impact of the Breakpoint Region on the Leukemogenic Potential and the TKI Responsiveness of Atypical BCR-ABL1 Transcripts | Frontiers in pharmacology | 34276365 | CD34-positive cells derived from healthy donors were obtained from ALLCELLS. CD34-positive cells were maintained in Stem Span SFEM supplemented with cytokines at low Save | Full Paper |
2021 | Tang, J;Zou, Y;Li, L;Lu, F;Xu, H;Ren, P;Bai, F;Niedermann, G;Zhu, X; | BAY 60-6583 Enhances the Antitumor Function of Chimeric Antigen Receptor-Modified T Cells Independent of the Adenosine A2b Receptor | Frontiers in pharmacology | 33776765 | ed States) + 10% FBS (10099141C, ThermoFisher Scientific) were used to expand and culture CAR T cells. Frozen human peripheral blood mononuclear cells (PBMCs) from healthy donors were purchased from AllCells (PB005F, Alameda, CA, United States). Aft | Full Paper |
2021 | Sim, DS;Mallari, CR;Teare, JM;Feldman, RI;Bauzon, M;Hermiston, TW; | In vitro characterization of CT-001-a short-acting factor VIIa with enhanced prohemostatic activity | Research and practice in thrombosis and haemostasis | 34263099 | e binding of FVIIa to activated platelet surfaces was detected by Alexa488‐anti‐FVII (clone AA3). Donor informed consent and collection protocols are approved by the Institutional Review Board of AllCells. 2.4 Inhibition by antithrombin and tissue f | Full Paper |
2021 | Xu, Y;Barauskas, O;Kim, C;Babusis, D;Murakami, E;Kornyeyev, D;Lee, G;Stepan, G;Perron, M;Bannister, R;Schultz, BE;Sakowicz, R;Porter, D;Cihlar, T;Feng, JY; | Off-Target In Vitro Profiling Demonstrates that Remdesivir Is a Highly Selective Antiviral Agent | Antimicrobial agents and chemotherapy | 33229429 | Normal human primary bone marrow (BM) light-density cells were from three different lots obtained from AllCells (Emeryville, CA) or Lonza (Walkersville, MD). All primary human cells Save | Full Paper |
2021 | Huang, Y;Jia, F;Zhao, J;Hou, Y;Hu, SQ; | Novel ACE Inhibitory Peptides Derived from Yeast Hydrolysates: Screening, Inhibition Mechanisms and Effects on HUVECs | Journal of agricultural and food chemistry | 33593053 | Primary HUVECs, as well as the endothelial growth medium (EGM) and endothelial basal serum-free medium, were purchased from Allcells Co., Ltd. (Shanghai, China). Penicillin/ Save | Full Paper |
2021 | Jing, L;Fan, S;Yao, X;Zhang, Y; | Effects of compound stimulation of fluid shear stress plus ultrasound on stem cell proliferation and osteogenesis | Regenerative biomaterials | 34868635 | lopment kit was purchased from Beyotime Biotechnology Co., Ltd. (China). The MagneSil@ Total RNA mini isolation system was purchased from Promega (USA). Primary rat BMSCs were purchased from Shanghai AllCells Biotech Co., Ltd. (China). The polytetraf | Full Paper |
2021 | Chai, ZT;Zhang, XP;Ao, JY;Zhu, XD;Wu, MC;Lau, WY;Sun, HC;Cheng, SQ; | AXL Overexpression in Tumor-Derived Endothelial Cells Promotes Vessel Metastasis in Patients With Hepatocellular Carcinoma | Frontiers in oncology | 34123800 | Primary human umbilical vein endothelial cells (HUVECs; AllCells, Shanghai, China) were cultured in endothelial cell growth medium-2 (Lonza, Basel, Switzerland) supplemented with Save | Full Paper |
2021 | Romito, M;Juillerat, A;Kok, YL;Hildenbeutel, M;Rhiel, M;Andrieux, G;Geiger, J;Rudolph, C;Mussolino, C;Duclert, A;Metzner, KJ;Duchateau, P;Cathomen, T;Cornu, TI; | Preclinical Evaluation of a Novel TALEN Targeting CCR5 Confirms Efficacy and Safety in Conferring Resistance to HIV-1 Infection | Biotechnology journal | 33103367 | and data analyzed with CRISPResso2.[49] p values were adjusted with the Benjamini & Hochberg[50] method. For OCA, 1 × 106 PBMCs (ALLCELLS, USA)/mL in X-Vivo15 medium (Lonza), supplemented with 5% human AB serum (Gemini, USA) and 20 ng mL−1 of IL-2 (M | Full Paper |
2021 | Kitanaga, Y;Yamajuku, D;Kubo, S;Nakamura, K;Maeda, M;Seki, M;Kaneko, Y;Kinugasa, F;Morokata, T;Kondo, Y;Yoshinari, H;Nakayamada, S;Sumida, T;Tanaka, Y; | Discovery of a novel Igβ and FcγRIIB cross-linking antibody, ASP2713, and its potential application in the treatment of systemic lupus erythematosus | International immunopharmacology | 34781122 | Human peripheral blood mononuclear cells (PBMCs; Lonza, Basel, Switzerland) and normal human peripheral blood B cells (AllCells, CA, USA) were purchased. Whole blood samples were obtained from healthy subjects and patients with SLE at the University | Full Paper |
2021 | Chen, YL;Cui, Y;Liu, X;Liu, G;Dong, X;Tang, L;Hung, Y;Wang, C;Feng, MQ; | A bispecific antibody targeting HER2 and PD-L1 inhibits tumor growth with superior efficacy | The Journal of biological chemistry | 34798072 | man IgG (H + L) was obtained from Jackson ImmunoResearch. Monocyte purification kit was obtained from Miltenyi Biotec. Ficoll gradient was obtained from GE healthcare. Human PBMCs were obtained from Allcells. Humanization of anti-PD-L1 mAb by framew | Full Paper |
2021 | Langrish, CL;Bradshaw, JM;Francesco, MR;Owens, TD;Xing, Y;Shu, J;LaStant, J;Bisconte, A;Outerbridge, C;White, SD;Hill, RJ;Brameld, KA;Goldstein, DM;Nunn, PA; | Preclinical Efficacy and Anti-Inflammatory Mechanisms of Action of the Bruton Tyrosine Kinase Inhibitor Rilzabrutinib for Immune-Mediated Disease | Journal of immunology (Baltimore, Md. : 1950) | 33674445 | Human whole blood from healthy donors was purchased from AllCells and assayed for rilzabrutinib inhibition of IgE basophil activation. Whole blood was treated with ten 3-fold dilutions Save | Full Paper |
2021 | Andrejeva, G;Capoccia, BJ;Hiebsch, RR;Donio, MJ;Darwech, IM;Puro, RJ;Pereira, DS; | Novel SIRPα Antibodies That Induce Single-Agent Phagocytosis of Tumor Cells while Preserving T Cells | Journal of immunology (Baltimore, Md. : 1950) | 33431660 | were differentiated from CD14+ monocytes purchased from Astarte Biologics or selected using Pan Monocyte Isolation Kit (Miltenyi Biotec) from PBMCs (AllCells and Hemacare). Monocytes were seeded onto 96-well, flat-bottom plates at 3 × 104 cells per w | Full Paper |
2021 | Chaerkady, R;Zhou, Y;Delmar, JA;Weng, SHS;Wang, J;Awasthi, S;Sims, D;Bowen, MA;Yu, W;Cazares, LH;Sims, GP;Hess, S; | Characterization of Citrullination Sites in Neutrophils and Mast Cells Activated by Ionomycin via Integration of Mass Spectrometry and Machine Learning | Journal of proteome research | 34008986 | For mast cell preparation, three donors were used. Briefly, leukocytes were collected from Leukopak (ALLCells) and mixed with Robo II Buffer (StemCell Technologies) at 1:4 and centrifuged at 500g for 15 mins. The pellet was resuspended in 1× Vitalyse | Full Paper |
2021 | Deng, M;Wu, D;Zhang, Y;Jin, Z;Miao, J; | MiR-29c downregulates tumor-expressed B7-H3 to mediate the antitumor NK-cell functions in ovarian cancer | Gynecologic oncology | 33875234 | The human CD56 + NK cells were obtained from ALLCELLS (Emeryville, California) and were confirmed by flow cytometric analyses. NK cells were maintained in Human NK cell Save | Full Paper |
2021 | Friedman, D;Dozor, AJ;Milner, J;D'Souza, M;Talano, JA;Moore, TB;Shenoy, S;Shi, Q;Walters, MC;Vichinsky, E;Parsons, SK;Braniecki, S;Moorthy, CR;Ayello, J;Flower, A;Morris, E;Mahanti, H;Fabricatore, S;Klejmont, L;van de Ven, C;Baxter-Lowe, LA;Cairo, MS; | Stable to improved cardiac and pulmonary function in children with high-risk sickle cell disease following haploidentical stem cell transplantation | Bone marrow transplantation | 33958740 | Bioverativ, Sangamo, Veevo, Editas Medicine and is medical director for AllCells, Inc. Biosciences. SKP is a consultant to Seattle Genetics, also unrelated to this study. EV is a consultant for ApoPharma, on the advisory committee for Global Blood Th | Full Paper |
2021 | Song, D;Liu, X;Dong, C;Wang, Q;Sha, C;Liu, C;Ning, Z;Han, J;Liu, H;Zong, M;Zhao, Y;Li, Y;Liu, G;Shao, X;Dou, C; | Two novel human anti-CD25 antibodies with antitumor activity inversely related to their affinity and in vitro activity | Scientific reports | 34824364 | The effector cells PBMCs (PB003F-C, ALLCELLS) were added and the mixture was incubated at 37 C for 5 h. After substrate was added, OD490 value was read on the microplate Save;The effector cells PBMCs (PB003F-C, ALLCELLS) were added and the mixture | Full Paper |
2021 | Loo, J;Sicher, I;Goff, A;Kim, O;Clary, N;Alexeev, A;Sulchek, T;Zamarayeva, A;Han, S;Calero-Garcia, M; | Microfluidic transfection of mRNA into human primary lymphocytes and hematopoietic stem and progenitor cells using ultra-fast physical deformations | Scientific reports | 34725429 | Mobilized peripheral blood CD34-selected hematopoietic stem and progenitor cells (mPB CD34 + HSPCs, purchased from AllCells) were taken from liquid nitrogen freezer and placed Save | Full Paper |
2021 | Wang, X;Negrou, E;Maloney, MT;Bondar, VV;Andrews, SV;Montalban, M;Llapashtica, C;Maciuca, R;Nguyen, H;Solanoy, H;Arguello, A;Przybyla, L;Moerke, NJ;Huntwork-Rodriguez, S;Henry, AG; | Understanding LRRK2 kinase activity in preclinical models and human subjects through quantitative analysis of LRRK2 and pT73 Rab10 | Scientific reports | 34145320 | University of Dundee (https://mrcppureagents.dundee.ac.uk/). For the total Rab10 assay, recombinant Rab10 protein (LSBio, LS-G2178) and Rab8 protein (LS-G29310) were used. Human cryopreserved PBMCs (AllCells, PB005F) were thawed and cultured in RPMI | Full Paper |
2021 | Xue, X;De Leon-Tabaldo, A;Luna-Roman, R;Castro, G;Albers, M;Schoetens, F;DePrimo, S;Devineni, D;Wilde, T;Goldberg, S;Kinzel, O;Hoffmann, T;Fourie, AM;Thurmond, RL; | Preclinical and clinical characterization of the RORγt inhibitor JNJ-61803534 | Scientific reports | 34040108 | mentary materials and methods). Human nTreg suppressive assay Frozen purified human CD4+CD25+ natural Treg cells (nTreg), monocyte-derived dendritic cells (DC) and CD4+CD25- T effector cells (Teff) (Allcells, LLC, Alameda, CA) were thawed and co-cul | Full Paper |
2021 | Harris, KE;Lorentsen, KJ;Malik-Chaudhry, HK;Loughlin, K;Basappa, HM;Hartstein, S;Ahmil, G;Allen, NS;Avanzino, BC;Balasubramani, A;Boudreau, AA;Chang, K;Cuturi, MC;Davison, LM;Ho, DM;Iyer, S;Rangaswamy, US;Sankaran, P;Schellenberger, U;Buelow, R;Trinklein, ND; | A bispecific antibody agonist of the IL-2 heterodimeric receptor preferentially promotes in vivo expansion of CD8 and NK cells | Scientific reports | 34011961 | resuspended in 125 µL/well flow buffer and acquired on a BD FACSCelesta. Whole blood cytokine release assay Cytokine secretion was detected using fresh human whole blood (heparinized) obtained from AllCells. The following method was adapted from B. | Full Paper |
2021 | Tago, Y;Kobayashi, C;Ogura, M;Wada, J;Yamaguchi, S;Yamaguchi, T;Hayashi, M;Nakaishi, T;Kubo, H;Ueda, Y; | Human amnion-derived mesenchymal stem cells attenuate xenogeneic graft-versus-host disease by preventing T cell activation and proliferation | Scientific reports | 33510297 | Human BMSC from healthy donors were purchased from AllCells (CA, USA). The culture conditions of AMSC and BMSC (ie, MSC) were determined based on previous studies 43 . In Save | Full Paper |
2021 | Subhi, H;Husein, A;Mohamad, D;Nik Abdul Ghani, NR;Nurul, AA; | Chitosan-Based Accelerated Portland Cement Promotes Dentinogenic/Osteogenic Differentiation and Mineralization Activity of SHED | Polymers | 34641172 | SHED employed in this study were obtained from ALLCELLS, USA (Catalog No. DP004F; lot number SHED092211-01). Upon being received, the cells were characterized using stem Save | Full Paper |
2021 | Kim, OH;Park, JH;Son, JI;Yoon, OJ;Lee, HJ; | Bone Marrow Mesenchymal Stromal Cells on Silk Fibroin Scaffolds to Attenuate Polymicrobial Sepsis Induced by Cecal Ligation and Puncture | Polymers | 33946773 | y (FE-SEM; JSM 7500F, JEOL Ltd., Akishima, Tokyo, Japan). 2.3. MSC Preparation Human bone marrow MSCs were derived from the whole bone marrow of independent human donors (commercially available from AllCells, Alameda, CA, USA). The cells were cultur | Full Paper |
2021 | Wang, X;Sandberg, ML;Martin, AD;Negri, KR;Gabrelow, GB;Nampe, DP;Wu, ML;McElvain, ME;Toledo Warshaviak, D;Lee, WH;Oh, J;Daris, ME;Chai, F;Yao, C;Furney, J;Pigott, C;Kamb, A;Xu, H; | Potent, Selective CARs as Potential T-Cell Therapeutics for HPV-positive Cancers | Journal of immunotherapy (Hagerstown, Md. : 1997) | 34432728 | For human peripheral blood mononuclear cells (PBMCs), collection protocols and donor informed-consent were approved by an Institutional Review Board at Allcells. Allcells followed Save | Full Paper |
2021 | Martin, AD;Wang, X;Sandberg, ML;Negri, KR;Wu, ML;Toledo Warshaviak, D;Gabrelow, GB;McElvain, ME;Lee, B;Daris, ME;Xu, H;Kamb, A; | Re-examination of MAGE-A3 as a T-cell Therapeutic Target | Journal of immunotherapy (Hagerstown, Md. : 1997) | 33284140 | purchased from Allcells according to the method described by Garcia et al31 Collection protocols and donor informed-consent were approved by an institutional review board at Allcells. Save | Full Paper |
2021 | Xu, F;Liu, X;Zhang, D;Zhao, F;Fan, Z;Hu, S;Mei, S;Huang, Y;Sun, H;Wei, L;Guo, L;Wang, J;Cen, S;Liang, C;Guo, F; | The Engineered MARCH8-Resistant Vesicular Stomatitis Virus Glycoprotein Enhances Lentiviral Vector Transduction | Human gene therapy | 33678011 | Peripheral blood mononuclear cells (PBMCs) isolated from healthy donors were purchased from AllCells (Shanghai, China), and cultured in RPMI 1640 media containing 10% FBS ( Save | Full Paper |
2021 | Chen, Z;Chen, Z;Xu, S;Zhang, Q; | LncRNA SOX2-OT/miR-30d-5p/PDK1 Regulates PD-L1 Checkpoint Through the mTOR Signaling Pathway to Promote Non-small Cell Lung Cancer Progression and Immune Escape | Frontiers in Genetics | The microporous 2-compartment co-culture system was applied for co-culture. Transfected NSCLC cells were inoculated in the upper chamber, while CD8+ T (PB009-3-C, ALLCELLS, Shanghai) cells were inoculated in the lower chamber, allowing direct contact | Full Paper | |
2021 | Raskin, S;Van Pelt, S;Toner, K;Balakrishnan, PB;Dave, H;Bollard, CM;Yvon, E; | Novel TCR-like CAR-T cells targeting an HLA∗0201-restricted SSX2 epitope display strong activity against acute myeloid leukemia | Molecular therapy. Methods & clinical development | 34729377 | Steady-state apheresis units were purchased from AllCells and peripheral blood mononuclear cells (PBMCs) were isolated using lymphoprep density gradient. Before cryopreserving Save;ng a phase I clinical trial to evaluate the safety and anti-tumor e | Full Paper |
2021 | Xue, L;Gao, X;Zhang, H;Tang, J;Wang, Q;Li, F;Li, X;Yu, X;Lu, Z;Huang, Y;Tang, R;Yang, W; | Antiangiogenic antibody BD0801 combined with immune checkpoint inhibitors achieves synergistic antitumor activity and affects the tumor microenvironment | BMC cancer | 34686154 | #0025), 1% penicillin/streptomycin (GIBCO, Invitrogen Inc., Carlsbad, CA, USA, #15140-122) and 1% ECGS (ScienCell, #1052). For HUVEC Western blot, migration inhibition, and scratch assays, HUVECs (AllCells, Alameda, CA, USA) were maintained in HUVEC | Full Paper |
2021 | Noaks, E;Peticone, C;Kotsopoulou, E;Bracewell, DG; | Enriching leukapheresis improves T cell activation and transduction efficiency during CAR T processing | Molecular therapy. Methods & clinical development | 33718517 | Peripheral blood leukapheresis products were obtained from the NHS or purchased as LeukoPaks from AllCells, Cellex, and Anthony Nolan as part of research study NREC ID 15/LO/ Save;omplex and expensive magnetic cell sorting. Materials and methods Cu | Full Paper |
2021 | Green, R;Elliott, JL;Norona, W;Go, F;Nguyen, VT;Ge, J;Short, ML;Mulero, JJ;Zhong, C; | Developmental validation of VeriFiler™ Plus PCR Amplification Kit: A 6-dye multiplex assay designed for casework samples | Forensic science international. Genetics | 33740707 | Human genomic DNA used for the degraded DNA experiments was extracted from normal peripheral blood mononuclear cells (PBMC) of a male donor (ALLCELLS, Emeryville, CA) using a QiAamp DNA Blood Maxi Kit (Qiagen) | Full Paper |
2021 | Park, S;Huang, NWY;Wong, CXY;Pan, J;Albakr, L;Gu, J;Kang, L; | Microstructured Hyaluronic Acid Hydrogel for Tooth Germ Bioengineering | Gels (Basel, Switzerland) | 34449604 | ovine serum (Thermo Fisher, Waltham, MA, USA), penicillin-Streptomycin solution with 10,000 units penicillin and 10 mg streptomycin / mL (Thermo Fisher, Waltham, MA, USA). The culture media for DPSC (AllCells, Alameda, CA, USA) were α-Minimum essenti | Full Paper |
2021 | Garbuzova-Davis, S;Boccio, KJ;Llauget, A;Shell, R;Hailu, S;Mustafa, H;Ehrhart, J;Sanberg, PR;Appel, SH;Borlongan, CV; | Beneficial Effects of Transplanted Human Bone Marrow Endothelial Progenitors on Functional and Cellular Components of Blood-Spinal Cord Barrier in ALS Mice | eNeuro | 34479980 | Cryopreserved human bone marrow CD34+ cells (hBM34+) and human bone marrow-derived endothelial progenitor cells (hBM-EPCs) were purchased from AllCells and CELPROGEN Save | Full Paper |
2021 | Chu, J;Pieles, O;Pfeifer, CG;Alt, V;Morsczeck, C;Docheva, D; | Dental follicle cell differentiation towards periodontal ligament-like tissue in a self-assembly three-dimensional organoid model | European cells & materials | 34251657 | according to AllCells company regulations, further donor information such gender and exact age was not provided to the purchaser). The PDL-hTERT immortal cell line has already Save | Full Paper |
2021 | Madanagopal, TT;Tai, YK;Lim, SH;Fong, CH;Cao, T;Rosa, V;Franco-Obregón, A; | Pulsed electromagnetic fields synergize with graphene to enhance dental pulp stem cell-derived neurogenesis by selectively targeting TRPC1 channels | European cells & materials | 33644848 | hDPSC culture The use of human cells was approved by the NUS Institutional Review Board (NUS2094/2015). hDPSC (DPF003, AllCells, Quincy, MA, USA) were cultured in basal growth medium (DMEM, Invitrogen), supplemented with 10 % FBS (Invitrogen) in the | Full Paper |
2021 | Wang, X;Martin, AD;Negri, KR;McElvain, ME;Oh, J;Wu, ML;Lee, WH;Ando, Y;Gabrelow, GB;Toledo Warshaviak, D;Sandberg, ML;Xu, H;Kamb, A; | Extensive functional comparisons between chimeric antigen receptors and T cell receptors highlight fundamental similarities | Molecular immunology | 34419823 | Collection protocols and donor informed consent were approved by an Institutional Review Board (IRB) at Allcells . Allcells also followed HIPAA compliance and approved protocols Save | Full Paper |
2021 | Zacharia, A;Harberts, E;Valencia, SM;Myers, B;Sanders, C;Jain, A;Larson, NR;Middaugh, CR;Picking, WD;Difilippantonio, S;Kirnbauer, R;Roden, RB;Pinto, LA;Shoemaker, RH;Ernst, RK;Marshall, JD; | Optimization of RG1-VLP vaccine performance in mice with novel TLR4 agonists | Vaccine | 33309485 | cells were also cultured in the presence of BECC470 or TLR4 agonists and the resulting upregulation of surface co-stimulatory markers was measured by flow cytometry (AllCells). Save | Full Paper |
2021 | Liu, C;Yang, G;Zhou, M;Zhang, X;Wu, X;Wu, P;Gu, X;Jiang, X; | Magnesium Ammonium Phosphate Composite Cell-Laden Hydrogel Promotes Osteogenesis and Angiogenesis In Vitro | ACS omega | 33869925 | Human umbilical vein endothelial cells (HUVECs; eahy926) were purchased from AllCells and cultured in EBM. They were seeded in the upper chamber, while the lower chambers Save | Full Paper |
2021 | Jangjoo, M;Goodman, SJ;Choufani, S;Trost, B;Scherer, SW;Kelley, E;Ayub, M;Nicolson, R;Georgiades, S;Crosbie, J;Schachar, R;Anagnostou, E;Grunebaum, E;Weksberg, R; | An Epigenetically Distinct Subset of Children With Autism Spectrum Disorder Resulting From Differences in Blood Cell Composition | Frontiers in neurology | 33935932 | ed, B cell, CD4T, CD8T, monocyte, granulocytes, and NK. These blood cell types were those on which the Houseman method was originally trained, using peripheral blood leukocyte subtypes purchased from AllCells , LLC (Emeryville, CA) or sorted cells fr | Full Paper |
2021 | Zhou, N;Chen, Y;Yang, L;Xu, T;Wang, F;Chen, L;Liu, J;Liu, G; | LncRNA SNHG4 promotes malignant biological behaviors and immune escape of colorectal cancer cells by regulating the miR-144-3p/MET axis | American journal of translational research | 34786048 | The transfected CACO2 cells were co-cultured with CD4+ T cells (PB009-2-C, AllCells Biotechnology Co., Ltd., Shanghai, China), followed by the addition of PD-1 antibody (ab52587, Abcam, UK) and PD-L1 antibody (ab205921, Abcam, UK). CD4+ T cell isolat | Full Paper |
2021 | Horton, TM;Hoff, FW;van Dijk, A;Jenkins, GN;Morrison, D;Bhatla, T;Hogan, L;Romanos-Sirakis, E;Meyer, J;Carroll, WL;Qiu, Y;Wang, T;Mo, Q;Kornblau, SM; | The effects of sample handling on proteomics assessed by reverse phase protein arrays (RPPA): Functional proteomic profiling in leukemia | Journal of proteomics | 33212251 | Normalization controls were commercially available normal adult CD34+ bone marrow cells (AllCells). Peripheral blood mononuclear cells (PBMC) were isolated using Lymphoprep Save | Full Paper |
2021 | Khouri, J;Faiman, BM;Grabowski, D;Mahfouz, RZ;Khan, SN;Wei, W;Valent, J;Dean, R;Samaras, C;Jha, BK;Lazarus, H;Campagnaro, EL;Malek, E;Reed, J;Karam, MA;Hamilton, K;Fada, S;Kalaycio, M;Liu, H;Sobecks, R;Saunthararajah, Y;Chew, Y;Orloff, M;Reu, FJ; | DNA methylation inhibition in myeloma: Experience from a phase 1b study of low-dose continuous azacitidine in combination with lenalidomide and low-dose dexamethasone in relapsed or refractory multiple myeloma | Seminars in hematology | 33509443 | Normal bone marrow mononuclear cells for separation of CD138 positive and negative fractions of 3 healthy donors was obtained commercially from ALLCELLS and processed the Save | Full Paper |
2021 | Schölzel, C;Blesius, V;Ernst, G;Goesmann, A;Dominik, A; | Countering reproducibility issues in mathematical models with software engineering techniques: A case study using a one-dimensional mathematical model of the atrioventricular node | PloS one | 34280231 | This means that the release version of the AllCells model is not only executable in OpenModelica, but also in any of the over 100 tools that support the Functional Mock-up Interface (FMI Save | Full Paper |
2021 | Dulay, RM;Valdez, BC;Li, Y;Chakrabarti, S;Dhillon, B;Kalaw, SP;Reyes, RG;Cabrera, EC; | Cytotoxicity of Gymnopilus purpureosquamulosus extracts on hematologic malignant cells through activation of the SAPK/JNK signaling pathway | PloS one | 34048499 | esuspended in freezing medium (50% heat-inactivated fetal bovine serum, 40% RPMI, 10% DMSO), and cryopreserved in liquid nitrogen until used. Mononuclear cells from healthy donors were purchased from ALLCELLS LLC (Almeda, CA, USA). For extract exposu | Full Paper |
2021 | Caplan, HW;Prabhakara, KS;Toledano Furman, NE;Zorofchian, S;Martin, C;Xue, H;Olson, SD;Cox, CS; | Human-derived Treg and MSC combination therapy may augment immunosuppressive potency in vitro, but did not improve blood brain barrier integrity in an experimental rat traumatic brain injury model | PloS one | 34038436 | Bone marrow-derived MSC were isolated from a commercially available fresh human bone marrow aspirate (AllCells, Alameda, CA) and expanded following established procedures [8, Save | Full Paper |
2021 | Baik, R;Wyman, SK;Kabir, S;Corn, JE; | Genome editing to model and reverse a prevalent mutation associated with myeloproliferative neoplasms | PloS one | 33661998 | Frozen human mobilized peripheral blood CD34+ HSPCs were purchased from AllCells and thawed according to manufacturer's instructions. CD34+ cells were cultured in StemSpan Save | Full Paper |
2021 | Garbuzova-Davis, S;Boccio, KJ;Ehrhart, J;Sanberg, PR;Appel, SH;Borlongan, CV; | Detection of endothelial cell-associated human DNA reveals transplanted human bone marrow stem cell engraftment into CNS capillaries of ALS mice | Brain research bulletin | 33545308 | Cryopreserved human bone marrow CD34+ cells (hBM34+) and human bone marrow-derived endothelial progenitor cells (hBM-EPCs) were purchased from AllCells (Alameda, CA, USA) and CELPROGEN (Torrance, CA, USA), respectively. According to the company repor | Full Paper |
2021 | Montalban-Bravo, G;Darbaniyan, F;Kanagal-Shamanna, R;Ganan-Gomez, I;Class, CA;Sasaki, K;Naqvi, K;Wei, Y;Yang, H;Soltysiak, KA;Chien, KS;Bueso-Ramos, C;Do, KA;Kantarjian, H;Garcia-Manero, G; | Type I interferon upregulation and deregulation of genes involved in monopoiesis in chronic myelomonocytic leukemia | Leukemia research | 33517186 | BM samples from healthy individuals were obtained from AllCells (Emeryville, CA). Informed consent was obtained according to protocols approved by the MDACC institutional review Save | Full Paper |
2021 | Lu, J;Collins, P;Lee, KJ;Li, CM;Wang, S; | In vitro assessment of an engineered tBID-based safety switch system in human T lymphocytes | Annals of translational medicine | 34988150 | n 12-well plate and incubated the plate in incubator at 37 °C. Human T-cell samples were purchased anonymously from the vendor and considered exempt from IRB approval. The frozen human pan-T cells (AllCells, LLC., Cat# S-ISO004-06) were thawed and c | Full Paper |
2021 | Maucort, C;Di Giorgio, A;Azoulay, S;Duca, M; | Differentiation of Cancer Stem Cells by Using Synthetic Small Molecules: Toward New Therapeutic Strategies against Therapy Resistance | ChemMedChem | 32803855 | In an analogous work, it was found that ICG-001 could safely eradicate the drug-resistant CSC-like population and initiate cell differentiation in leukemia (pre-B ALLcells). The same Save | Full Paper |
2021 | Hu, J;Zhang, J;Yu, M;Liu, Z;Zou, Y;Hong, L;Zhang, T;Sun, J;Zheng, M;Zhu, X;Wang, Z;Liu, S; | Circulating miR-221/222 reduces CD4+ T cells by inhibiting CD4 expression in colorectal cancer | Acta biochimica et biophysica Sinica | 34357372 | Peripheral blood mononuclear cells (PBMCs) were purchased from ALLCELLS (PB005F; Shanghai, China). PBMCs were incubated with DynaBeads (11141D; Gibco, Carlsbad, USA), and CD3+ T cells were isolated in a magnet by binding to DynaBeads containing anti- | Full Paper |
2021 | Yang, Y;Wang, C;Dai, C;Liu, X;Li, W;Huang, M;Zhao, X;Ji, D;Li, J;Guo, W; | Amplification and expression of c-MET correlate with poor prognosis of patients with gastric cancer and upregulate the expression of PDL1 | Acta biochimica et biophysica Sinica | 33693450 | The prognostic significance of c-MET in gastric cancer (GC) remains uncertain. In the present study, we examined the amplification, expression, and the prognostic value of c-MET, Save | Full Paper |
2021 | Thorarensen, A;Balbo, P;Banker, ME;Czerwinski, RM;Kuhn, M;Maurer, TS;Telliez, JB;Vincent, F;Wittwer, AJ; | The advantages of describing covalent inhibitor in vitro potencies by IC50 at a fixed time point. IC50 determination of covalent inhibitors provides meaningful data to medicinal chemistry for SAR optimization | Bioorganic & medicinal chemistry | 33285410 | Cryopreserved human PBMCs (Catalog No. PB005F), which were used in the IL-2, IL-10, IL-15, and IFNα assays, were purchased from Allcells (Emeryville, CA). Frozen PBMCs were thawed in a water bath (37 °C), and washed once with RPMI1640 medium (Catalog | Full Paper |
2021 | Jiang, J;Li, X;Mao, F;Wu, X;Chen, Y; | Small molecular fluorescence dyes for immuno cell analysis | Analytical biochemistry | 33306976 | Statement of Ethical Use of Human Samples: All human PBMCs used in this study were obtained from AllCells Alameda, 1301 Harbor Bay Parkway, Suite 200, Alameda, CA 94502, Save;h as leukemia; and provide a quick and efficient way to study the immune | Full Paper |
2021 | Takahashi, N;Higa, A;Hiyama, G;Tamura, H;Hoshi, H;Dobashi, Y;Katahira, K;Ishihara, H;Takagi, K;Goda, K;Okabe, N;Muto, S;Suzuki, H;Shimomura, K;Watanabe, S;Takagi, M; | Construction of in vitro patient-derived tumor models to evaluate anticancer agents and cancer immunotherapy | Oncology letters | 33841567 | patient, were used in this study. Patient-derived hematopoietic tumor cells were provided by Fukushima Medical University Hospital, the Japanese Pediatric Cancer Group ALL-R14 study, ProteoGenex, or AllCells. Peripheral blood mononuclear cells (PBMCs | Full Paper |
2021 | Yoshida, K;Takabayashi, T;Imoto, Y;Sakashita, M;Kato, Y;Narita, N;Fujieda, S; | Increased Thrombin-Activatable Fibrinolysis Inhibitor in Response to Sublingual Immunotherapy for Allergic Rhinitis | The Laryngoscope | 33844301 | Systems, Minneapolis, Minnesota ), 100 ng IL-13 (R&D Systems), 100 ng IL-4 plus 1 μg/mL TAFI (Abcam, Cambridge, UK), and 100 ng IL-13 with 1 μg/mL TAFI. Human mast cells were differentiated from CD34+ hematopoietic progenitor cells (ALLCELLS, Alamed | Full Paper |
2021 | Hashim, SNM;Yusof, MFH;Zahari, W;Noordin, KBAA;Akamatsu, T;Azlina, A; | Amniotic membrane matrix effects on calcineurin-NFAT-related gene expressions of SHED treated with VEGF for endothelial differentiation | In vitro cellular & developmental biology. Animal | 34021476 | SHED (AllCells, Alameda, California) were cultured in a complete medium made of the Minimum Essential Medium (MEM) Alpha Medium (α-MEM) (Gibco, Waltham, Massachusetts), supplemented with 15% of fetal bovine serum (FBS) (Gibco, Waltham, Massachusetts) | Full Paper |
2021 | Pieles, O;Hartmann, M;Morsczeck, C; | AMP-activated protein kinase and the down-stream activated process of autophagy regulate the osteogenic differentiation of human dental follicle cells | Archives of oral biology | 33254047 | 2.1. Cell culture Human dental follicle cells were purchased from AllCells and cultivated in DMEM (Dulbecco’s Modified Eagle’s Medium) high glucose with 10 % FBS (fetal bovine serum) and 1% penicillin (10,000 units/mL) / streptomycin (10 mg/mL) solut | Full Paper |
2021 | Wang, Z;Jiang, L;Wang, J;Chai, Z;Xiong, W; | Morphine promotes angiogenesis by activating PI3K/Akt/HIF-1α pathway and upregulating VEGF in hepatocellular carcinoma | Journal of gastrointestinal oncology | 34532126 | Academy of Science (Shanghai, China). The cells were cultured in 10% FBS DMEM, 37 °C, 5% CO2 incubator. HUVECs were obtained from the Allcells Company(Shanghai, China) and cultured in 10% FBS Endothelial Cell Growth Medium (ECM, Lonza, Switzerland), | Full Paper |
2021 | Hayashi, Y;Kawaki, H;Hori, M;Shintani, K;Hasegawa, T;Tanaka, M;Kondoh, N;Yoshida, T;Kawano, S;Tamaki, Y; | Evaluation of the mechanical properties and biocompatibility of gypsum-containing calcium silicate cements | Dental materials journal | 33642445 | Evaluation of the cytotoxicity of cement-immersed media Samples of hDPSCs (Allcells, Emeryville, CA, USA), which had been subcultured 11-14 times in 10% fetal bovine serum (FBS)-containing α-MEM, were seeded within a 96-well plate at a density of 4,0 | Full Paper |
2021 | Iwasa, M;Fujii, S;Fujishiro, A;Maekawa, T;Andoh, A;Takaori-Kondo, A;Ichinohe, T;Miura, Y; | Impact of 2 Gy γ-irradiation on the hallmark characteristics of human bone marrow-derived MSCs | International journal of hematology | 33386593 | Bone marrow of multiple healthy adults aged 21-44 years (#4362, #4615, and #4641) was purchased from AllCells (Emeryville, CA). Human BM-MSCs were isolated from bone marrow according to our previously published methods [12, 13]. In brief, a single-ce | Full Paper |
2021 | Cui, L;Yin, F;Cheng, J;Liu, H;Zheng, M;Liu, D;Wu, Z;Qian, Q; | Optimized cytotoxicity assay for co-suspended effector and target cells | Journal of immunological methods | 34270976 | Peripheral blood mononuclear cells (PBMCs) obtained from whole blood of healthy volunteers (AllCells, Silicon Valley, CA, USA) were isolated by density gradient centrifugation with Save | Full Paper |
2021 | Sunderic, K;Li, C;Ahmed, AHR;Dawkins, D;Azar, T;Cardoso, L;Wang, S; | Tuning Thermal Dosage to Facilitate Mesenchymal Stem Cell Osteogenesis in Pro-Inflammatory Environment | Journal of biomechanical engineering | 32601701 | Human bone marrow explanted from the iliac crest of donors was purchased from AllCells, LLC (Berkeley, CA). Human mesenchymal stem cells were enriched using the RosetteSep Save | Full Paper |
2021 | Koh, H;Kwon, SY;Zhen, X;Ha, HY;Lee, JH; | Generation of induced pluripotent stem cell line (KRIBBi004-A) from adult bone marrow CD34+ cells from a patient carrying 46,XX,t(1;5)(p31.1;35.1) karyotype | Stem cell research | 34736040 | Cell Source iPSC was derived from CD34+ bone marrow (BM) cells, obtained from AllCells, LLC Clonality Clonal Associated disease N/A Gene/locus Chromosome translocation t(1;5)(p31.1;35.1) Date archived/stock date Jun.2021 Cell line repository/bank The | Full Paper |
2021 | Kim, J;Koh, H;Zhen, X;Lee, DS;Ha, HY;Lee, JH; | Establishment of iPSC (KRIBBi001-A) from CD34+ group O D-negative bone marrow blood | Stem cell research | 33529979 | Cell Source iPSC was derived from CD34+ bone marrow (BM) cells, obtained from AllCells, LLC Clonality Clonal Method of reprogramming Integration-free Sendai virus-based vectors (CytoTune™-iPS 2.0 Sendai Reprogramming Kit, Life Technologies) | Full Paper |
2021 | Fu, X;Shen, X;Yin, X;Zhang, Y;Wang, X;Han, Z;Lin, Q;Fan, J; | Antioxidant and pro-apoptosis activities of coffee husk (Coffea arabica) anthocyanins | International Food Research Journal | The HUVEC and Caco-2 cell lines were purchased from ALLCELLS Biotechnology Company (Shanghai, China) and Kunming Institute of Zoology Cell Line Bank (Yunnan, China), respectively. Dulbecco’s Modified Eagle’s Medium (DMEM), foetal bovine serum, penici | Full Paper | |
2021 | Choi, J;Goulding, SP;Conn, BP;McGann, CD;Dietze, JL;Kohler, J;Lenkala, D;Boudot, A;Rothenberg, DA;Turcott, PJ;Srouji, JR;Foley, KC;Rooney, MS;van Buuren, MM;Gaynor, RB;Abelin, JG;Addona, TA;Juneja, VR; | Systematic discovery and validation of T cell targets directed against oncogenic KRAS mutations | Cell reports methods | 35474673 | (HLA-A∗03:01, HLA-A∗11:01, HLA-A∗68:01, HLA-B∗07:02, HLA-C∗01:02, HLA-C∗03:04, and/or HLA-C∗08:02) were isolated using Ficoll separation from apheresis material (AllCells Save;130-050-201; RRID:AB_2665482 CD25 MicroBeads, human Miltenyi Biotec | Full Paper |
2021 | Cai, W;Dong, J;Gallolu Kankanamalage, S;Titong, A;Shi, J;Jia, Z;Wang, B;Huang, C;Zhang, J;Lin, J;Kan, SZ;Han, S;Zhou, J;Liu, Y; | Biological activity validation of a computationally designed Rituximab/CD3 T cell engager targeting CD20+ cancers with multiple mechanisms of action | Antibody therapeutics | 34805746 | They were cultured in RPMI 1640 (Thermo fisher) medium supplemented with 10% fetal bovine serum (FBS) (GIBCO) at 37 °C, 5% CO2. Human peripheral blood mononuclear cells (hPBMC) were purchased from AllCells (Alameda, CA) and HumanCells Bio (San Jose, | Full Paper |
2021 | Moe, GR;Steirer, LM;Lee, JA;Shivakumar, A;Bolanos, AD; | A cancer-unique glycan: de-N-acetyl polysialic acid (dPSA) linked to cell surface nucleolin depends on re-expression of the fetal polysialyltransferase ST8SIA2 gene | Journal of experimental & clinical cancer research : CR | 34544457 | rting (FACS) binding, and fluorescence labeling experiments were treated with Accutase and washed with medium before use. Human normal peripheral blood mononuclear cells (PBMCs) were purchased from AllCells (Alameda, CA). Protein extraction from ce | Full Paper |
2021 | Xing, Y;Chu, KA;Wadhwa, J;Chen, W;Zhu, J;Bradshaw, JM;Shu, J;Foulke, MC;Loewenstein, N;Nunn, P;By, K;Phiasivongsa, P;Goldstein, DM;Langrish, CL; | Preclinical Mechanisms of Topical PRN473, a Bruton Tyrosine Kinase Inhibitor, in Immune-Mediated Skin Disease Models | ImmunoHorizons | 34326199 | Human whole blood (AllCells) pretreated for 1 h with eleven 3-fold serial dilutions of PRN473, starting at a concentration of 10 μM, was incubated overnight with goat anti-human IgM F( Save | Full Paper |
2021 | Pohlmeyer, CW;Shang, C;Han, P;Cui, ZH;Jones, RM;Clarke, AS;Murray, BP;Lopez, DA;Newstrom, DW;Inzunza, MD;Matzkies, FG;Currie, KS;Di Paolo, JA; | Characterization of the mechanism of action of lanraplenib, a novel spleen tyrosine kinase inhibitor, in models of lupus nephritis | BMC rheumatology | 33781343 | healthy donors or individuals with SLE (AllCells) were treated with lanraplenib or dimethyl Naive B cells were isolated from freshly collected PBMCs (AllCells) by negative selection ( Save | Full Paper |
2021 | Nordin, NS;Mokhtar, KI;Mustafa, BE; | Effects of Flaxseed (Linum usitatissimum) Extract on the Osteoblast Differentiation Potential of Stem Cells Derived from Human Exfoliated Deciduous Teeth | Makara Journal of Health Research | SHED (ALLCells, USA) were cultured in complete growth media (alpha-MEM; 10% FBS; 0.5% Pen-Strep) until confluence. SHED at 80%-90% confluence were subjected to osteoblast differentiation. The complete growth medium was replaced with osteoblast induct | Full Paper | |
2021 | Turkson, A;Addor, J;Kharib, D; | Validating Intrinsic Factors Informing E-Commerce: Categorical Data Analysis Demo | Open Journal of Statistics | ows a chi-square distribution, and the conclusion depends on whether or not the obtained statistic is greater that the critical statistic at a chosen alpha level. The test statistics is: χ 2 = ∑ allcells ( Observed − Expected ) 2 Expected = ∑ i , j | Full Paper | |
2021 | Xu, Y;Shen, L;Li, G; | The The Effect of Elution Volume for Immunoprecipitation on m6A-Seq Analysis | Proceedings of Anticancer Research | The Mouse Renal Carcinoma cells (RenCa) were cultured in DMEM medium (Invitrogen) containing 10% FBS, 2 mM L-Glutamine and 1% penicillin-streptomycin. RenCa cell line was purchased from Allcells Biotechnology (Shanghai, China) and were routinely test | Full Paper | |
2021 | Zhou, Z;Zheng, J;Lin, D;Chen, Y;Hu, X; | Exosomes Derived from Dental Pulp Stem Cells Accelerate Cutaneous wound Healing by Enhancing Angiogenesis via Cdc42/p38 MAPK Pathway | Research Square | 1% penicillin-streptomycin (Sigma, USA). HUVECs were bought from ALLCELLS (Shanghai, China) and expanded in endothelial cell growth medium (EGM). For exosome co-cultures experiment, 10μg/ml of exosomes were added to the culture medium of HUVECs. All | Full Paper | |
2021 | Blitzer, G;Paz, C;Glassey, A;Ganz, O;Giri, J;Pennati, A;Meyers, R;Lunga, T;Robbins, D;Thibeault, S;Bates, A;Nickel, K;Morris, Z;Mattison, R;Chappell, R;Glazer, T;Rogus-Pulia, N;Galipeau, J;Kimple, R; | A Pilot Study to Assess the Salivary Gland Regenerative Potential of Bone Marrow Mesenchymal Stromal Cells from Treated Head and Neck Cancer Patients | Research Square | Bone marrow from healthy adult control volunteers were purchased from a commercial source (AllCells, Alameda, CA). We had originally planned to enroll 15 patients: 5 patients with Save | Full Paper | |
2021 | Tie, B;Guo, Z;Li, L;Wang, W;Liu, R;Fang, J; | miR-3156-5p Enhances Hypoxia-Induced Angiogenesis in Hepatocellular Carcinoma via Modulating the SOCS5/HIF-1α/VEGF Pathway | Research Square | Human umbilical vein endothelial cells (HUVECs) were purchased from Allcells (Shanghai, China) and cultured in the medium containing 50 U/mL penicillin and 50 U/mL streptomycin (Invitgen, San Diego, CA), 50 mL endothelial cell growth additive (Upstat | Full Paper | |
2021 | Chen, S;Barrientos, J;Ferrer, G;Ravichandran, P;Ibrahim, M;Kieso, Y;Kutok, J;Peluso, M;Sharma, S;Weaver, D;Pachter, J;Rai, K;Chiorazzi, N; | Duvelisib Eliminates CLL B Cells, Impairs CLL-Supporting Cells, and Overcomes Ibrutinib Resistance in Preclinical Models | Research Square | Human PBMCs from CLL donors obtained from whole blood from a commercial source (Bioreclamation IVT or ALLCELLS) were resuspended (1 x 106 cells/mL) in RPMI-1640 medium Save | Full Paper | |
2021 | Valadkhan, S;Plasek, L;Gunawardane, L;Niazi, F;Mason, S;Leskov, K;Perez, G;Dobrowolski, C;Shukla, M;Nutt, W;Karn, J; | An HIV-induced mechanism for T cell quiescence andproviral latency | Research Square | Peripheral blood mononuclear cells from HIV negative Caucasian male donors were purchased from Allcells. Naive CD4+ T cells were isolated using EasySep Human Naive CD4+ T Save | Full Paper | |
2021 | Cai, W;Dong, J;Kankanamalage, S;Titong, A;Shi, J;Jia, Z;Wang, B;Huang, C;Zhang, J;Lin, J;Kan, S;Zhou, J;Liu, Y; | A computationally designed Rituximab/CD3 T cell engager targeting CD20+ cancers with multiple mechanisms of action | Research Square | medium supplemented with 10% fetal bovine serum (FBS) (GIBCO) 115 at 37°C, 5% CO2. Human peripheral blood mononuclear cells (hPBMC) were purchased from 116 AllCells (Alameda, CA) and HumanCells Bio (San Jose, CA). Rituximab resistant Raji cells 117 ( | Full Paper | |
2021 | Zhao, C;Zhang, W;Gong, G;Xie, L;Wang, M;Hu, Y; | A New Approach to Produce IgG4-like Bispecific Antibodies | Research Square | Human CD4+ T cells were purified from PBMC (AllCells, China) by negative selection with CD4+ T cell enrichment cocktail kit (Stemcell, Vancouver, Canada) according to the manufacturer’s instruction. Immature DC (iDC) was generated from monocytes by c | Full Paper | |
2021 | Noto, P; | Analysis of Liver X Receptor target gene expression across species | Drexel University | cDNA from Human MTC™ Panels I and II were purchased from Clontech (catalog# 636742 and 636743) and subjected to real-time PCR. Whole blood from human donors was purchased from AllCells (catalog# WB001) | Full Paper | |
2021 | Dunbar, A;Kim, D;Lu, M;Farina, M;Yang, J;Park, Y;Gobbo, F;Verachi, P;Martelli, F;Karzai, A;Xiao, W;Xia, L;Elmansy, N;Kleppe, M;Chen, Z;Xiao, Y;McGovern, E;Snyder, J;Krishnan, A;Hill, C;Cordner, K;Zouak, A;Salama, M;Yohai, J;Tucker, E;Chen, J;Zhou, J;McConnell, T;Koche, R;Rampal, R;Migliaccio, A;Fan, R;Levine, R;Hoffman, R; | CXCL8/CXCR2 signaling mediates bone marrow fibrosis and represents a therapeutic target in myelofibrosis | bioRxiv | Pro-inflammatory signaling is a hallmark feature of human cancer, including in myeloproliferative neoplasms (MPNs), most notably myelofibrosis (MF). Dysregulated inflammatory Save | Full Paper | |
2021 | Kartha, V;Duarte, F;Hu, Y;Ma, S;Chew, J;Lareau, C;Earl, A;Burkett, Z;Kohlway, A;Lebofsky, R;Buenrostro, J; | Functional Inference of Gene Regulation using Single-Cell Multi-Omics | bioRxiv | CD4+, CD8+, CD14+, CD19+ and CD56+ cells were purchased from AllCells (see Table S1 for catalog numbers and donor information). Cells were quickly thawed in a 37°C water bath, rinsed with culture medium (Iscove’s Modified | Full Paper | |
2021 | Kong, T;Laranjeira, A;Yang, K;Fisher, D;Yu, L;Wang, A;Ruzinova, M;Fowles, J;Allen, M;Celik, H;Challen, G;Huang, S;Oh, S; | DUSP6 mediates resistance to JAK2 inhibition and drives leukemic progression | bioRxiv | gradient extraction and cryopreserved according to standard procedures. Additional BMMCs were purchased from AllCells (Alameda, California). A list of patient samples utilized in this study is provided in Table 1 | Full Paper | |
2021 | Qi, J;D’Souza, D;Dawson, T;Geanon, D;Stefanos, H;Marvin, R;Walker, L;Rahman, A; | Multimodal Single-Cell Characterization of the Human Granulocyte Lineage | bioRxiv | Fresh whole bone marrow was purchased from AllCells Inc. and delivered on the day of the experiment. The bone marrow was in a volume of 3mL and the sample was limited to 2 units/ Save | Full Paper | |
2021 | Kim, J;Schulte, A;Sarver, A;Angelos, M;Frantz, A;Forster, C;O’Brien, T;Cornax, I;O’Sullivan, M;Cheng, N;Lewellen, M;Oseth, L;Kumar, S;Bullman, S;Pedamallu, C;Goyal, S;Meyerson, M;Lund, T;Alfoldi, J;Breen, M;Lindblad-Toh, K;Dickerson, E;Kaufman, D;Modiano, J; | Transcriptional and Functional Activity of Hemangiosarcoma Support Bone Marrow Nurse Cell Ontogeny | bioRxiv | Human BM-derived mesenchymal stromal cells (hBM-MSCs) were isolated from whole bone marrow purchased from AllCells (Emeryville, CA, USA) as previously described [24-27]. M2- Save | Full Paper | |
2021 | Maughon, T;Shen, X;Huang, D;Michael, A;Shockey, W;Andrews, S;McRae, J;Platt, M;Fernández, F;Edison, A;Stice, S;Marklein, R; | Multi-omics characterization of mesenchymal stem/stromal cells for the identification of putative critical quality attributes | bioRxiv | PBMCs (AllCells, Alameda CA) were thawed in RPMI media (RPMI, 20% FBS, 2mM L-glutamine, 50 U/mL penicillin, 50 μg/mL streptomycin) and cultured overnight at 37°C and 5% CO2. Prior to co-culture, PBMCs were labeled with CFSE (Supplemental Table 1, Bio | Full Paper | |
2021 | Jain, S;Rick, J;Joshi, R;Beniwal, A;Spatz, J;Chang, A;Nguyen, A;Sudhir, S;Chandra, A;Haddad, A;Wadhwa, H;Shah, S;Choi, S;Hayes, J;Wang, L;Yagnik, G;Costello, J;Diaz, A;Aghi, M; | Identification of Cancer-Associated Fibroblasts in Glioblastoma and Defining Their Pro-tumoral Effects | bioRxiv | THP-1 cells and monocytes isolated from peripheral blood (AllCells) run through the MojoSort Human CD14 Selection Kit were treated with 50 ng/μL PMA (phorbol myristate acetate) Save | Full Paper | |
2021 | Andrews, S;Klinker, M;Bauer, S;Marklein, R; | Morphological Landscapes from High Content Imaging Identify Optimal Priming Strategies that Enhance MSC Immunosuppression | bioRxiv | Human bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville, CA, USA), and RoosterBio (Frederick, MD, USA) (see Table S1 for donor information). MSC culture conditions for th | Full Paper | |
2021 | Gu, C;Cao, X;Wang, Z;Hu, X;Yao, Y;Zhou, Y;Liu, P;Liu, X;Gao, G;Hu, X;Zhang, Y;Chen, Z;Gao, L;Peng, Y;Jia, F;Shan, C;Yu, L;Liu, K;Li, N;Guo, W;Jiang, G;Min, J;Zhang, J;Yang, L;Shi, M;Hou, T;Li, Y;Liang, W;Lu, G;Yang, C;Wang, Y;Xia, K;Xiao, Z;Xue, J;Huang, X;Chen, X;Ma, H;Song, D;Pan, Z;Wang, X;Guo, H;Liang, H;Yuan, Z;Guan, W;Deng, S; | A human antibody with blocking activity to RBD proteins of multiple SARS-CoV-2 variants including B.1.351 showed potent prophylactic and therapeutic efficacy against SARS-CoV-2 in rhesus macaques | bioRxiv | Phage libraries were constructed using antibody gene fragments amplified from PBMCs of 50 healthy human subjects (Allcells, PB003F and PB003C) and total RNA from PBMCs ( Save | Full Paper | |
2021 | Fitzgerald, A;Marcisak, E;Nasir, A;Glasgow, E;Jablonski, S;Van Der Veken, P;Pearson, G;Fertig, E;Mace, E;Weiner, L; | Fibroblast activation protein regulates natural killer cell migration, extravasation and tumor infiltration | bioRxiv | from AllCells with either CD56 positive selection or CD56 negative selection (Allcells, cat# T cells, B cells and monocytes were isolated from PBMCs (Allcells) using Mojosort magnetic Save | Full Paper | |
2021 | Brooks, J; | Preclinical Dynamic Contrast Enhanced Imaging for Longitudinal Biophysical Assessments of the Healthy and Malignant Vasculature after Radiotherapy | Thesis | C57BL/6J mice (Strain 000664, Jackson Laboratory, Bar Harbor, ME) mice were injected with 1x106 GFP+ BCR-ABL (p190Kd) expressing B-cell ALLcells [66], suspended in 200 µl of phosphate buffered saline, through the tail vein. To test drug delivery, inj | Full Paper | |
2021 | O'Connor, EI; | Mechanisms Behind the Causal Role of Dietary Oxylipins of the Lipoxygenase Pathway in the Development of Pulmonary Arterial Hypertension | Thesis | PAECs were incubated with or without 15-HETE and 12 hours later healthy CD8 cells (ALLCELLS, Lot# 3003028) were added. After 12 hours of contact between EC and CD8 cells, the cells were collected, fixed, and stained for cleaved caspase 3 | Full Paper | |
2021 | McIntyre, P; | The Effects of a Pyk2 Kinase Inhibitor on the Proliferation and Differentiation of Human Dental Pulp Stem Cells | Thesis | Commercially available human DPSCs, collected from the pulp of extracted teeth, have been previously purchased from ALLCells and stored in liquid nitrogen (Alameda, CA, USA). • Save | Full Paper | |
2021 | Noaks, E; | Enhancing the consistency of donor derived peripheral blood mononuclear cells for CAR T-cell manufacturing | Thesis | For work completed at the company site healthy peripheral blood leukapheresis were obtained from the NHS or purchased as LeukoPaks from AllCells, Cellex and Anthony Nolan, as part of research study NREC ID 15/LO/1322. Experiments using healthy leukap | Full Paper | |
2021 | Osman, ZF;Zahari, W;Kannan, TP; | Ultrastructure changes in BMP-2-treated SHED cultured on glycerol preserved human amniotic membrane | Acta Microscópica | ommerciallysourcedSHED(AllCells,USA)wasculturedonde-epithelialized2cmx2cmglycerol-preserved γ-radiated AM in a culture dish containing 3 mlof media at different cell density for the respective days asthefollowing;2x105forday1,5x104forday7,2.5x104 | Full Paper | |
2021 | Luecken, MD;Burkhardt, DB;Cannoodt, R; | A sandbox for prediction and integration of dna, rna, and proteins in single cells | Conference | We sourced multiple samples of BMMCs from 10 donors via AllCells (California, USA), all healthy non-smokers without recent medical treatment. Donors varied by age (22 - 40), sex, Save | Full Paper | |
2021 | Vladimirova, T; | Implementation and Evaluation of Verlet List-based Methods in AutoPas | Thesis | Inside the 2D vector for AllCells or 3D vector for CellPair respectively, the method adds the particle indices corresponding to the particle pointers from the same spot in the AoS neighbor Save | Full Paper | |
2021 | Maser, IP; | In-depth characterization of myeloid enhanced humanized mouse strains | Thesis | was diluted with 0.9% sodium chloride (Braun) and 15 mg/kg was intraperitoneally (i.p.) injected into mice. 24 hours later 1×105 human CD34+ umbilical cord blood-derived hematopoietic stem cells (HSCs) (Stem Cell Technologies/Allcells) in 100 µl phos | Full Paper | |
2021 | Fitzgerald, AA; | Enhancing Anti-Cancer Properties of Human Natural Killer Cells | Thesis | Fresh healthy donor NK cells were purchased from AllCells with either CD56 positive selection or CD56 negative selection (Allcells, cat#PB012-P or PB012-N). T cells, B cells and monocytes were isolated from PBMCs (Allcells) using Mojosort magnetic ce | Full Paper | |
2021 | Butler, A; | Computational Methods for the Integration of Single-Cell Data | Thesis | We therefore repeated the original experiment, where PBMCs from a healthy human donor (ALLCELLS) were cultured with RPMI medium supplemented with 10% FBS and stimulated for 6 h with IFNβ (100 U/ml, PBL Assay Science), with a subset of cells left unex | Full Paper | |
2021 | Nataraja, S;Singh, M;Demes, S;Olson, L;Stanwix, J;Biddle, M;Clarke, E;Huang, Y;Nguyen, J;Chen, C;Zhang, P;Abdulla, F;Vercellotti, G;Belcher, J; | ML-0207/ASP8731: A Novel BACH1 Inhibitor That Induces Fetal Hemoglobin in Treatment of Sickle Cell Disease | Blood | Translational Development, Mitobridge, Cambridge, MA++Translational Science, Mitobridge, Cambridge, MA++Clinical Pharmacology and Exploratory Development, Astellas, Northbrook, IL++Translational Science, Mitobridge, Cambridge, MA++Translational Scien | Full Paper | |
2021 | Qing, Y;Dong, L;Gao, L;Li, C;Li, Y;Han, L;Prince, E;Tan, B;Deng, X;Wetzel, C;Shen, C;Gao, M;Chen, Z;Li, W;Zhang, B;Braas, D;Ten Hoeve, J;Sanchez, GJ;Chen, H;Chan, LN;Chen, CW;Ann, D;Jiang, L;Müschen, M;Marcucci, G;Plas, DR;Li, Z;Su, R;Chen, J; | R-2-hydroxyglutarate attenuates aerobic glycolysis in leukemia by targeting the FTO/m6A/PFKP/LDHB axis | Molecular cell | 33434505 | The Lin− progenitor cells were then subject to retroviral transduction with MSCV-Neo-MA9 construct by two rounds of ‘spinoculation’, as described previously (Li et al., 2015). After being selected for 7 days with 0.5 mg/mL G418 Sulfate (10131027, Gib | Full Paper |
2021 | Li, C;Wang, H;Georgakopoulou, A;Gil, S;Yannaki, E;Lieber, A; | In Vivo HSC Gene Therapy Using a Bi-modular HDAd5/35++ Vector Cures Sickle Cell Disease in a Mouse Model | Molecular therapy : the journal of the American Society of Gene Therapy | 32949495 | The lineage-minus (Lin−) cells were isolated by depletion of lineage-committed cells in bone marrow MNCs using the Mouse Lineage Cell Depletion Kit (Miltenyi Biotec, San Diego, CA, USA) according to the manufacturer’s instructions. CFU assays were pe | Full Paper |
2021 | Loftus, JP;Yahiaoui, A;Brown, PA;Niswander, LM;Bagashev, A;Wang, M;Schauf, A;Tannheimer, S;Tasian, SK; | Combinatorial efficacy of entospletinib and chemotherapy in patient-derived xenograft models of infant acute lymphoblastic leukemia | Haematologica | 32414848 | s Supplementary Appendix Acknowledgments We acknowledge Dr Ann Forslund and Ms Chelsea Mullins formerly at Gilead Sciences for study protocol management and data analysis, and Dr Emer Clarke at ReachBio Research Labs for assistance with experim | Full Paper |
2021 | DiLillo, DJ;Olson, K;Mohrs, K;Meagher, TC;Bray, K;Sineshchekova, O;Startz, T;Kuhnert, J;Retter, MW;Godin, S;Sharma, P;Delfino, F;Lin, J;Smith, E;Thurston, G;Kirshner, JR; | A BCMAxCD3 bispecific T cell-engaging antibody demonstrates robust antitumor efficacy similar to that of anti-BCMA CAR T cells | Blood advances | 33651100 | T cells were purified from normal donor PBMCs (ReachBio) by using magnetic beads (Thermo Fisher Scientific) and activated with CD3/CD28 microbeads (Thermo Fisher Scientific) in Save | Full Paper |
2021 | Byrgazov, K;Besse, A;Kraus, M;Slipicevic, A;Lehmann, F;Driessen, C;Besse, L; | Novel Peptide-drug Conjugate Melflufen Efficiently Eradicates Bortezomib-resistant Multiple Myeloma Cells Including Tumor-initiating Myeloma Progenitor Cells | HemaSphere | 34136753 | of MM were assessed in a semisolid methylcellulose-based media formulation containing 10% phytohemagglutinin (PHA)-stimulated leukocyte conditioned medium (ReachBio, WA). Save;cell outgrowth assay Clonogenic progenitors of MM were assessed in a sem | Full Paper |
2021 | Swaminathan, M;Kopyt, N;Atta, MG;Radhakrishnan, J;Umanath, K;Nguyen, S;O'Rourke, B;Allen, A;Vaninov, N;Tilles, A;LaPointe, E;Blair, A;Gemmiti, C;Miller, B;Parekkadan, B;Barcia, RN; | Pharmacological effects of ex vivo mesenchymal stem cell immunotherapy in patients with acute kidney injury and underlying systemic inflammation | Stem cells translational medicine | 34581517 | Flow cytometry testing of patient leukocytes was performed by ReachBio (Spokane, Washington). Blood was collected in CPT tubes (362 753; BD Biosciences), and peripheral blood Save;n a plasma preparation tube (362 788; BD Biosciences, San Jose, Cali | Full Paper |
2021 | Lin, M;Kowolik, CM;Xie, J;Yadav, S;Overman, LE;Horne, DA; | Potent Anticancer Effects of Epidithiodiketopiperazine NT1721 in Cutaneous T Cell Lymphoma | Cancers | 34282785 | TCC (Manassas, VA, USA), authenticated by STR-profiling at the source and passaged for less than 6 months after receipt or resuscitation. Peripheral blood mononuclear cells (PBMCs) were obtained from ReachBio (Spokane, WA, USA). All cells were grown | Full Paper |
2021 | Samuelson, C;Radtke, S;Zhu, H;Llewellyn, M;Fields, E;Cook, S;Huang, MW;Jerome, KR;Kiem, HP;Humbert, O; | Multiplex CRISPR/Cas9 genome editing in hematopoietic stem cells for fetal hemoglobin reinduction generates chromosomal translocations | Molecular therapy. Methods & clinical development | 34853798 | cation event frequencies was also undertaken on each of these tissues from necropsy as per protocol above. CFU and HbF assays on mouse BM A total of 7 × 104/mL cells were plated in ColonyGEL 1402 (ReachBio, Seattle, WA) in triplicate from each mouse | Full Paper |
2021 | Sharifi, S;Sharifi, H;Akbari, A;Chodosh, J; | Systematic optimization of visible light-induced crosslinking conditions of gelatin methacryloyl (GelMA) | Scientific reports | 34857867 | and exposed to photoirradiation for a 4 and 10 min. Those cell-laden gels were immediately washed 3 times with PBS and incubated in 200 μL of an optimized serum-containing medium (catalog # 02,100, Reachbio lab, Spokane, WA) at 37 °C. Cell viability | Full Paper |
2021 | Haber, L;Olson, K;Kelly, MP;Crawford, A;DiLillo, DJ;Tavaré, R;Ullman, E;Mao, S;Canova, L;Sineshchekova, O;Finney, J;Pawashe, A;Patel, S;McKay, R;Rizvi, S;Damko, E;Chiu, D;Vazzana, K;Ram, P;Mohrs, K;D'Orvilliers, A;Xiao, J;Makonnen, S;Hickey, C;Arnold, C;Giurleo, J;Chen, YP;Thwaites, C;Dudgeon, D;Bray, K;Rafique, A;Huang, T;Delfino, F;Hermann, A;Kirshner, JR;Retter, MW;Babb, R;MacDonald, D;Chen, G;Olson, WC;Thurston, G;Davis, S;Lin, JC;Smith, E; | Generation of T-cell-redirecting bispecific antibodies with differentiated profiles of cytokine release and biodistribution by CD3 affinity tuning | Scientific reports | 34257348 | ce with the ARRIVE guidelines. OVCAR-3 bioluminescence imaging (BLI) study Eight-week-old NOD SCID gamma chain knock-out (NSG) mice (Jackson Laboratory) were injected with 5 × 106 human PBMCs (ReachBio) before 1 × 106 ascites cells from the OVCAR-3/ | Full Paper |
2021 | Patterson, AM;Sellamuthu, R;Plett, PA;Sampson, CH;Chua, HL;Fisher, A;Vemula, S;Feng, H;Katz, BP;Tudor, G;Miller, SJ;MacVittie, TJ;Booth, C;Orschell, CM; | Establishing Pediatric Mouse Models of the Hematopoietic Acute Radiation Syndrome and the Delayed Effects of Acute Radiation Exposure | Radiation research | 33577641 | elsewhere (47). Hematopoietic progenitor cell (HPC) number and function were quantitated from 1.0 × 10e5 low-density bone marrow (LDBM) in 1 ml ColonyGEL™ Mouse Complete Medium (ReachBio Research Labs, Seattle, WA) | Full Paper |
2021 | Rethnam, M;Tan, DQ;Suda, T; | Myeloma cells self-promote migration by regulating TAB1-driven TIMP-1 expression in mesenchymal stem cells | Biochemical and biophysical research communications | 33183761 | Human BM MSCs (#02100, ReachBio) were grown in DMEM low glucose media (Biowest) supplemented with 10% FBS and 1% Antibiotic/Anti-mycotic (Gibco). Cells were passaged upon confluence and cultured at a density of 4.5 × 103 cells/cm2. U266-B1 (TIB-196, | Full Paper |
2021 | Andersen, A;Vieira-Brock, PL;Vaughan, B;Vollmer, D; | Method development for the analysis of PBMC-mediated killing of K562 cells by bovine colostrum | Journal of immunological methods | 34744024 | Declaration of Competing Interest Authors and principle investigators are employed by 4Life Research, which sells the test articles commercially. 4Life Research funded all portions of this study. Acknowledgements All testing was performed at ReachBi | Full Paper |
2021 | Radtke, S;Enstrom, M;Pande, D;Cui, M;Madhu, R;Perez, A;Kiem, H; | Hematopoietic recovery after transplantation is primarily derived from the stochastic contribution of hematopoietic stem cells | bioRxiv | For CFC assays, 800-1,200 sort-purified CD34+ cells and CD34-subpopulations were seeded into 3.5 ml ColonyGEL 1402 (ReachBio, Seattle, WA). Colonies were scored after 12 to 14 days, discriminating colony forming unit- (CFU-) granulocyte (CFU-G), macr | Full Paper | |
2020 | Geoerger, B;Kang, HJ;Yalon-Oren, M;Marshall, LV;Vezina, C;Pappo, A;Laetsch, TW;Petrilli, AS;Ebinger, M;Toporski, J;Glade-Bender, J;Nicholls, W;Fox, E;DuBois, SG;Macy, ME;Cohn, SL;Pathiraja, K;Diede, SJ;Ebbinghaus, S;Pinto, N; | Pembrolizumab in paediatric patients with advanced melanoma or a PD-L1-positive, advanced, relapsed, or refractory solid tumour or lymphoma (KEYNOTE-051): interim analysis of an open-label, single-arm, phase 1–2 trial | Lancet Oncol. | 31812554 | In all patients, baseline PD-L1 expression in tumour samples (positivity defined as any staining of the stroma or PD-L1 expression on at least 1% of tumour cells) was assessed centrally at QualTek Molecular Laboratories (Goleta, CA, USA) using a prot | Full Paper |
2020 | Emens, LA;Esteva, FJ;Beresford, M;Saura, C;De Laurentiis, M;Kim, SB;Im, SA;Wang, Y;Salgado, R;Mani, A;Shah, J;Lambertini, C;Liu, H;de Haas, SL;Patre, M;Loi, S; | Trastuzumab emtansine plus atezolizumab versus trastuzumab emtansine plus placebo in previously treated, HER2-positive advanced breast cancer (KATE2): a phase 2, multicentre, randomised, double-blind trial | The Lancet. Oncology | 33002436 | The KATE2 study is a randomised, double-blind, placebo-controlled, phase 2 trial at 68 centres from nine countries across Asia, Australia, North America, and western Europe (appendix pp 13–15). Eligible patients were adults (aged ≥18 years) with cent | Full Paper |
2020 | Powell, SF;Gold, KA;Gitau, MM;Sumey, CJ;Lohr, MM;McGraw, SC;Nowak, RK;Jensen, AW;Blanchard, MJ;Fischer, CD;Bykowski, J;Ellison, CA;Black, LJ;Thompson, PA;Callejas-Valera, JL;Lee, JH;Cohen, EEW;Spanos, WC; | Safety and Efficacy of Pembrolizumab With Chemoradiotherapy in Locally Advanced Head and Neck Squamous Cell Carcinoma: A Phase IB Study | J. Clin. Oncol. | 32479189 | Testing was performed centrally by QualTek Laboratories (Santa Barbara, CA) using the PD-L1 IHC 22C3 pharmDx (Dako North America, Carpinteria, CA) IHC assay as previously described. 25 PD-L1 evaluation was performed using the combined proportional sc | Full Paper |
2020 | Marabelle, A;Cassier, P;Fakih, M;Kao, S;Nielsen, D;Italiano, A;Guren, T;Dongen, M;Spencer, K;Bariani, G;Ascierto, P;Santoro, A;Hiret, S;Ott, P;Piha-Paul, S;Liu, C;Leiby, M;Norwood, K;Delord, J; | Pembrolizumab for previously treated advanced anal squamous cell carcinoma: Pooled results from the KEYNOTE-028 and KEYNOTE-158 studies. | JCO | PD-L1 positivity). Baseline PD-L1 expression was assessed using a prototype IHC assay (QualTek) in KEYNOTE-028 and the PD-L1 IHC 22C3 pharmDx assay (Agilent Technologies) in KEYNOTE-158. Pts received pembro | Full Paper | |
2020 | Greenstein, A;Munster, P;Sachdev, J;Fleming, G;Grauer, A;Shepherd, S; | Impact of relacorilant, a selective glucocorticoid receptor antagonist, on the immunosuppressive effects of endogenous cortisol. | JCO | Tina K. Schlafly of Corcept Therapeutics. Funding for editorial, design, and production support for this poster was provided by Corcept to MedVal Scientific Information Services, LLC, Princeton, NJ. Experiments were conducted at Ardigen SA, QualTek M | Full Paper | |
2020 | Dudek, AZ;Liu, LC;Gupta, S;Logan, TF;Singer, EA;Joshi, M;Zakharia, YN;Lang, JM;Schwarz, JK;Al-Janadi, A;Alva, AS; | Phase Ib/II Clinical Trial of Pembrolizumab With Bevacizumab for Metastatic Renal Cell Carcinoma: BTCRC-GU14-003 | J. Clin. Oncol. | 32097091 | Events (CTCAE; version 4.0). Exploratory Studies. Expression of PD-L1 in archived diagnostic tumor tissue was determined by immunohistochemistry (IHC) using a 22C3 antibody (Qualtek Electronics, Newton, PA). Both a modified ;logy Criteria for Ad | Full Paper |
2020 | Tolaney, SM;Barroso-Sousa, R;Keenan, T;Li, T;Trippa, L;Vaz-Luis, I;Wulf, G;Spring, L;Sinclair, NF;Andrews, C;Pittenger, J;Richardson, ET;Dillon, D;Lin, NU;Overmoyer, B;Partridge, AH;Van Allen, E;Mittendorf, EA;Winer, EP;Krop, IE; | Effect of Eribulin With or Without Pembrolizumab on Progression-Free Survival for Patients With Hormone Receptor-Positive, ERBB2-Negative Metastatic Breast Cancer: A Randomized Clinical Trial | JAMA oncology | 32880602 | A total of 65 patients (74%) had PD-L1 testing assessed centrally by QualTek using the 22C3 antibody, and results were reported as a modified pro- portion score (MPS), defined as the proportion of cells, includ- ing both tumor and mononuclear inflamm | Full Paper |
2020 | Zsiros, E;Lynam, S;Attwood, KM;Wang, C;Chilakapati, S;Gomez, EC;Liu, S;Akers, S;Lele, S;Frederick, PJ;Odunsi, K; | Efficacy and Safety of Pembrolizumab in Combination With Bevacizumab and Oral Metronomic Cyclophosphamide in the Treatment of Recurrent Ovarian Cancer: A Phase 2 Nonrandomized Clinical Trial | JAMA oncology | 33211063 | A modified proportion score threshold of at least 1% using the 22C3 antibody (QualTekMolecular Laboratories) was adopted similarly to previously described protocols.6 | Full Paper |
2020 | Jabbour, SK;Berman, AT;Decker, RH;Lin, Y;Feigenberg, SJ;Gettinger, SN;Aggarwal, C;Langer, CJ;Simone, CB;Bradley, JD;Aisner, J;Malhotra, J; | Phase 1 Trial of Pembrolizumab Administered Concurrently With Chemoradiotherapy for Locally Advanced Non-Small Cell Lung Cancer: A Nonrandomized Controlled Trial | JAMA Oncol | 32077891 | Exploratory analyses included PD-L1 status, by mean proportion score. Immunohistochemical staining for PD-L1 used a mouse monoclonal anti-PD-L1 antibody (clone 22C3).21 Furthermore, TILs were scored on a continuum from 0 to 3 (0 indicates absent TILs | Full Paper |
2020 | Kelly, CM;Antonescu, CR;Bowler, T;Munhoz, R;Chi, P;Dickson, MA;Gounder, MM;Keohan, ML;Movva, S;Dholakia, R;Ahmad, H;Biniakewitz, M;Condy, M;Phelan, H;Callahan, M;Wong, P;Singer, S;Ariyan, C;Bartlett, EK;Crago, A;Yoon, S;Hwang, S;Erinjeri, JP;Qin, LX;Tap, WD;D'Angelo, SP; | Objective Response Rate Among Patients With Locally Advanced or Metastatic Sarcoma Treated With Talimogene Laherparepvec in Combination With Pembrolizumab: A Phase 2 Clinical Trial | JAMA Oncol | 31971541 | Paraffin-embedded tumor material taken before and after treatment was examined for TIL immune biomarker expression, including PD-L1, PD-1, CD3, CD4, FOXP3, CD8, CD68, CD163, and MHC1 by Qualtek Laboratory. Programmed death-ligand 1 tumor membranous e | Full Paper |
2020 | Mancuso, F;Ogbah, Z;Fasani, R;Lo Giacco, D;Ramos, L;Oaknin, A;Alsina, M;Elez, E;Mercade, T;Saura, C;Capdevila, J;Vieito, M;Felip, E;Dienstmann, R;Gros, A;Seoane, J;Nuciforo, P;Tabernero, J;Garralda, E;Vivancos, A; | 581P VHIO immune gene expression profiling (VIGex) panel, a tool to explore tumour immune microenvironment | Annals of Oncology | self), Speaker Bureau/Expert testimony, Research grant/Funding (self), Travel/Accommodation/ Expenses: Novartis; Honoraria (self), Speaker Bureau/Expert testimony, Research grant/Funding (self), Travel/Accommodation/Expenses: Targos Molecular Patholo | Full Paper | |
2020 | Jotte, R;Cappuzzo, F;Vynnychenko, I;Stroyakovskiy, D;Rodríguez-Abreu, D;Hussein, M;Soo, R;Conter, HJ;Kozuki, T;Huang, KC;Graupner, V;Sun, SW;Hoang, T;Jessop, H;McCleland, M;Ballinger, M;Sandler, A;Socinski, MA; | Atezolizumab in Combination With Carboplatin and Nab-Paclitaxel in Advanced Squamous NSCLC (IMpower131): Results From a Randomized Phase III Trial | J Thorac Oncol | 32302702 | Skip to Main Content ;This work was supported by F. Hoffmann-La Roche Ltd/Genentech, Inc., a member of the Roche Group. The authors would like to acknowledge Targos Molecular Pathology GmbH (Kassel, Germany) for performing central PD-L1 and T-ef | Full Paper |
2020 | M.C.Liu, G.R.Oxnard, E.A.Klein, C.Swanton, M.V.Seiden | Sensitive and specific multi-cancer detection and localization using methylation signatures in cell-free DNA | Annals of Oncology | Background: Early cancer detection could identify tumors at a time when outcomes are superior and treatment is less morbid. This prospective case-control sub-study (from NCT02889978 and NCT03085888) assessed the performance of targeted methylation an | Full Paper | |
2020 | Taylor, WC; | Comment on "Sensitive and specific multi-cancer detection and localization using methylation signatures in cell-free DNA"" by M. C. Liu et al" | Ann. Oncol. | 32371122 | cfDNA [n = 2628 (1493 cancer; 1135 non-cancer)], formalin fixed paraffin embedded (FFPE) tumor biopsies (n = 242), and WBCs (n = 70) from the first CCGA sub-study; commercial tissue or cells [n = 227; Discovery Life Sciences (formerly Conversant Biol | Full Paper |
2020 | Draz, MS;Vasan, A;Muthupandian, A;Kanakasabapathy, MK;Thirumalaraju, P;Sreeram, A;Krishnakumar, S;Yogesh, V;Lin, W;Yu, XG;Chung, RT;Shafiee, H; | Virus detection using nanoparticles and deep neural network-enabled smartphone system | Science advances | 33328239 | Deidentified HCV-infected and HBV-infected patient plasma/ serum samples were obtained from Discovery Life Sciences Inc | Full Paper |
2020 | Chung, HC;Piha-Paul, SA;Lopez-Martin, J;Schellens, JHM;Kao, S;Miller, WH;Delord, JP;Gao, B;Planchard, D;Gottfried, M;Zer, A;Jalal, SI;Penel, N;Mehnert, JM;Matos, I;Bennouna, J;Kim, DW;Xu, L;Krishnan, S;Norwood, K;Ott, PA; | Pembrolizumab After Two or More Lines of Previous Therapy in Patients With Recurrent or Metastatic SCLC: Results From the KEYNOTE-028 and KEYNOTE-158 Studies | J Thorac Oncol | 31870883 | In KEYNOTE-028, tumor samples were assessed using a laboratory-developed prototype immunohistochemistry assay (QualTek Molecular Laboratories, Goleta, CA) with the 22C3 antibody clone (Merck Sharp & Dohme Corp., a subsidiary of Merck & Co., Inc., Ken | Full Paper |
2020 | Freeman, ZT;Nirschl, TR;Hovelson, DH;Johnston, RJ;Engelhardt, JJ;Selby, MJ;Kochel, CM;Lan, RY;Zhai, J;Ghasemzadeh, A;Gupta, A;Skaist, AM;Wheelan, SJ;Jiang, H;Pearson, AT;Snyder, LA;Korman, AJ;Tomlins, SA;Yegnasubramanian, S;Drake, CG; | A conserved intratumoral regulatory T cell signature identifies 4-1BB as a pan-cancer target | J. Clin. Invest. | 32015231 | Study approval. All human tumors were collected with approval from the Johns Hopkins University IRB with the following protocol IDs: renal clear cell carcinoma (IRB00033839), prostate cancer (NA_00082175), bladder cancer (NA_00026693), and glioblasto | Full Paper |
2020 | Weiss, J;Sheth, S;Deal, AM;Grilley Olson, JE;Patel, S;Hackman, TG;Blumberg, JM;Galloway, T;Patel, S;Zanation, AM;Shen, CJ;Hayes, DN;Hilliard, C;Mehra, R;McKinnon, KP;Wang, HH;Weissler, MC;Bauman, JR;Chera, BS;Vincent, BG; | Concurrent definitive immunoradiotherapy for patients with Stage III-IV Head and Neck Cancer and Cisplatin contraindication | Clin. Cancer Res. | 32371539 | withdrawal of permission. Correlative Analysis PDL1 staining was conducted by Qualtek Molecular Laboratories (Newtown, PA) as previously described 5 and required by Merck in supported investigator initiated trials. For both | Full Paper |
2020 | Graff, JN;Beer, TM;Alumkal, JJ;Slottke, RE;Redmond, WL;Thomas, GV;Thompson, RF;Wood, MA;Koguchi, Y;Chen, Y;Latour, E;Bergan, RC;Drake, CG;Moran, AE; | A phase II single-arm study of pembrolizumab with enzalutamide in men with metastatic castration-resistant prostate cancer progressing on enzalutamide alone | J Immunother Cancer | 32616555 | retained. Formalin-fixed, paraffin-embedded tumor samples were sent to a commercial vendor (Qualtek) for PD-L1 quantification by immunohistochemistry (clone 22C3). Additional methods details are described elsewhere.30 | Full Paper |
2020 | Majd, N;Waguespack, S;Janku, F;Fu, S;Penas-Prado, M;Xu, M;Alshawa, A;Kamiya-Matsuoka, C;Raza, S;McCutcheon, I;Naing, A; | Efficacy of pembrolizumab in patients with pituitary carcinoma: report of four cases from a phase II study | Journal for ImmunoTherapy of Cancer | PD-L1 staining was performed by Qualtek using Merck 22C3 antibody for PD-L1 | Full Paper | |
2020 | Lokeshwar, VB;Morera, DS;Hasanali, SL;Yates, TJ;Hupe, MC;Knapp, J;Lokeshwar, SD;Wang, J;Hennig, MJP;Baskar, R;Escudero, DO;Racine, RR;Dhir, N;Jordan, AR;Hoye, K;Azih, I;Manoharan, M;Klaassen, Z;Kavuri, S;Lopez, LE;Ghosh, S;Lokeshwar, BL; | A Novel Splice Variant of HYAL-4 Drives Malignant Transformation and Predicts Outcome in Patients with Bladder Cancer | Clin. Cancer Res. | 32094233 | Present address: Travis Yates: QualTek Molecular Laboratories, King of Prussia, PA; Diogo Escudero: George Washington University Kelly Hoye: University of North Carolina Lineberger Comprehensive Cancer Center; Ronny Racine: Astellas Institute for Reg | Full Paper |
2020 | Fong, LY;Taccioli, C;Palamarchuk, A;Tagliazucchi, GM;Jing, R;Smalley, KJ;Fan, S;Altemus, J;Fiehn, O;Huebner, K;Farber, JL;Croce, CM; | Abrogation of esophageal carcinoma development in miR-31 knockout rats | Proc. Natl. Acad. Sci. U.S.A. | 32123074 | lia isolated using the DNeasy Blood & Tissue Kit (Qiagen). WGS. DNA library preparation, library quality control, and nonhuman WGS to yield ∼30× coverage were performed on the Illumina HiSeq X at HudsonAlpha Genomic Services Laboratory. WGS Analysi | Full Paper |
2020 | Rodriguez, CP;Wu, QV;Voutsinas, J;Fromm, JR;Jiang, X;Pillarisetty, VG;Lee, SM;Santana-Davila, R;Goulart, B;Baik, CS;Chow, LQM;Eaton, K;Martins, R; | A Phase II Trial of Pembrolizumab and Vorinostat in Recurrent Metastatic Head and Neck Squamous Cell Carcinomas and Salivary Gland Cancer | Clin. Cancer Res. | 31796519 | Submission of archived tissue was required prior to study entry. In patient with no available archived tissue, fresh tissue biopsies were recommended. Biopsies were attempted after three cycles of therapy were completed, in patients who consented. PD | Full Paper |
2020 | Huetter, J;Gritzan, U;Gutcher, I;Doecke, WD;Luetke-Eversloh, MV;Golfier, S;Roider, HG;Frisk, AL;Hunter, J;Pow, A;Drake, A;Levine, Z;Levy, O;Azulay, M;Barbiro, I;Cojocaru, G;Vaknin, I;Kreft, B;Roese, L; | Characterization of BAY 1905254, an immune checkpoint inhibitor targeting the immunoglobulin-like domain containing receptor 2 (ILDR2) | Cancer Immunol Res | 32312711 | cancer patients, and commercially available cryopreserved human lymph node single- cell preparations from melanoma patients (Folio Conversant, USA) using the PrimeFlow™ RNA Assay technology (Invitrogen, CA, USA). Following enzymatic | Full Paper |
2020 | Ozkan-Dagliyan, I;Diehl, JN;George, SD;Schaefer, A;Papke, B;Klotz-Noack, K;Waters, AM;Goodwin, CM;Gautam, P;Pierobon, M;Peng, S;Gilbert, TSK;Lin, KH;Dagliyan, O;Wennerberg, K;Petricoin, EF;Tran, NL;Bhagwat, SV;Tiu, RV;Peng, SB;Herring, LE;Graves, LM;Sers, C;Wood, KC;Cox, AD;Der, CJ; | Low-Dose Vertical Inhibition of the RAF-MEK-ERK Cascade Causes Apoptotic Death of KRAS Mutant Cancers | Cell Rep | 32553168 | CRISPR sequencing was performed at UNC (High-Throughput Sequencing Facility, Chapel Hill, NC) and Hudson Alpha (HudsonAlpha Genomic Services Laboratory, Huntsville, AL) | Full Paper |
2020 | Wang, X;Kelkar, YD;Xiong, X;Martinson, EO;Lynch, J;Zhang, C;Werren, JH;Wang, X; | Genome Report: Whole Genome Sequence and Annotation of the Parasitoid Jewel Wasp Nasonia giraulti Laboratory Strain RV2X[u] | G3 (Bethesda) | 32571804 | and Helen Wisch Professorship. X.X. is supported by the Auburn University Presidential Graduate Research Fellowship and Auburn University College of Veterinary Medicine Dean’s Fellowship. We thank HudsonAlpha Discovery for assistance with Illumina se | Full Paper |
2020 | Ulasov, I;Borovjagin, A;Fares, J;Yakushov, S;Malin, D;Timashev, P;Lesniak, MS; | MicroRNA 345 (miR345) regulates KISS1-E-cadherin functional interaction in breast cancer brain metastases | Cancer Lett. | 32246957 | One hundred and eleven tumor samples, representing invasive ductal carcinoma (IDC) were subjected for evaluation as a part of brain tissue microarrays presented by: US Biomax (BR812), Folio Biosciences (AY-HH0137) and biobank at the University of Chi | Full Paper |
2020 | Chiang, J;Ahmed, N;Foote, J;Prasad, N;Karri, S;Pagidas, K;Wiltshire, A;Gunn, D;Singh, K; | OVARIAN AGING AND REPRODUCTIVE SENESCENCE IN MOUSE MODEL OF MITOCHONDRIAL DYSFUNCTION | Fertility and Sterility | 2 HudsonAlpha Discovery, Huntsville, AL; 3 TCM University, Lincoln, RI | Full Paper | |
2020 | Ho, AY;Barker, CA;Arnold, BB;Powell, SN;Hu, ZI;Gucalp, A;Lebron-Zapata, L;Wen, HY;Kallman, C;D'Agnolo, A;Zhang, Z;Flynn, J;Dunn, SA;McArthur, HL; | A phase 2 clinical trial assessing the efficacy and safety of pembrolizumab and radiotherapy in patients with metastatic triple-negative breast cancer | Cancer | 31747077 | PD‐L1 tumor expression was evaluated in prospectively collected samples of metastatic biopsies by a central laboratory (QualTek Molecular Laboratories, Goleta, California) using a previously described prototype assay using the 22C3 antibody (Merck an | Full Paper |
2020 | Kasimir-Bauer, S;Roder, J;Obermayr, E;Mahner, S;Vergote, I;Loverix, L;Braicu, E;Sehouli, J;Concin, N;Kimmig, R;Net, L;Roder, H;Zeillinger, R;Aust, S;On Behalf Of The Ovcad Ovarian Cancer Diagnosis Initiative, ; | Definition and Independent Validation of a Proteomic-Classifier in Ovarian Cancer | Cancers | 32899818 | These samples were obtained from commercial biobanks (Conversant Bio (Huntsville, AL, USA) and Oncology Metrics (Forth Worth, TX, USA)), under their ethics-approved protocols | Full Paper |
2020 | Jimenez, C;Subbiah, V;Stephen, B;Ma, J;Milton, D;Xu, M;Zarifa, A;Akhmedzhanov, FO;Tsimberidou, A;Habra, MA;Rodon Anhert, J;Fu, S;Naing, A; | Phase II Clinical Trial of Pembrolizumab in Patients with Progressive Metastatic Pheochromocytomas and Paragangliomas | Cancers | 32824391 | tissue samples or newly obtained biopsy specimens (if archival tissue was not available) were evaluated by immunohistochemical analysis to determine the expression of PDL-1 in tumor cells and tumor-infiltrating mononuclear inflammatory cells by Qualt | Full Paper |
2020 | Jordan, AR;Wang, J;Yates, TJ;Hasanali, SL;Lokeshwar, SD;Morera, DS;Shamaladevi, N;Li, CS;Klaassen, Z;Terris, MK;Thangaraju, M;Singh, AB;Soloway, MS;Lokeshwar, VB; | Molecular targeting of renal cell carcinoma by an oral combination | Oncogenesis | 32427869 | Department of Biochemistry and Molecular Biology, Medical College of Georgia, Augusta University, 1410 Laney Walker Blvd., Augusta, GA, 30912, USA.||Sheila and David Fuente Graduate Program in Cancer Biology, University of Miami-Miller School of Medi | Full Paper |
2020 | Mehnert, JM;Bergsland, E;O'Neil, BH;Santoro, A;Schellens, JHM;Cohen, RB;Doi, T;Ott, PA;Pishvaian, MJ;Puzanov, I;Aung, KL;Hsu, C;Le Tourneau, C;Hollebecque, A;Élez, E;Tamura, K;Gould, M;Yang, P;Stein, K;Piha-Paul, SA; | Pembrolizumab for the treatment of programmed death-ligand 1-positive advanced carcinoid or pancreatic neuroendocrine tumors: Results from the KEYNOTE-028 study | Cancer | 32320048 | PD was confirmed by repeat radiographic imaging ≥4 weeks after the initial scan. Investigators could opt to keep clinically stable patients on treatment until confirmed PD. Safety was monitored through 30 days after the last treatment dose (90 days f | Full Paper |
2020 | Wen, X;Ou, Y;Zarick, H;Zhang, X;Hmelo, A;Victor, Q;Paul, E;Slocik, J;Naik, R;Bellan, L;Lin, E;Bardhan, R; | PRADA: Portable Reusable Accurate Diagnostics with nanostar Antennas for multiplexed biomarker screening | Bioeng Transl Med | labor intensive, and cost prohibitive.39,40 We chose to measure the accuracy of PRADA in commercially available de-identified human patient serum (Discovery Life Sciences Inc.) to recapitulate clinical diagnostics where biomarkers of interest compete | Full Paper | |
2020 | Gonzalez-Ericsson, PI;Stovgaard, ES;Sua, LF;Reisenbichler, E;Kos, Z;Carter, JM;Michiels, S;Le Quesne, J;Nielsen, TO;Laenkholm, AV;Fox, SB;Adam, J;Bartlett, JM;Rimm, DL;Quinn, C;Peeters, D;Dieci, MV;Vincent-Salomon, A;Cree, I;Hida, AI;Balko, JM;Haynes, HR;Frahm, I;Acosta-Haab, G;Balancin, M;Bellolio, E;Yang, W;Kirtani, P;Sugie, T;Ehinger, A;Castaneda, CA;Kok, M;McArthur, H;Siziopikou, K;Badve, S;Fineberg, S;Gown, A;Viale, G;Schnitt, SJ;Pruneri, G;Penault-Llorca, F;Hewitt, S;Thompson, EA;Allison, KH;Symmans, WF;Bellizzi, AM;Brogi, E;Moore, DA;Larsimont, D;Dillon, DA;Lazar, A;Lien, H;Goetz, MP;Broeckx, G;El Bairi, K;Harbeck, N;Cimino-Mathews, A;Sotiriou, C;Adams, S;Liu, SW;Loibl, S;Chen, IC;Lakhani, SR;Juco, JW;Denkert, C;Blackley, EF;Demaria, S;Leon-Ferre, R;Gluz, O;Zardavas, D;Emancipator, K;Ely, S;Loi, S;Salgado, R;Sanders, M;, ; | The path to a better biomarker: application of a risk management framework for the implementation of PD-L1 and TILs as immuno-oncology biomarkers in breast cancer clinical trials and daily practice | J. Pathol. | 32129476 | PANACEA NCT02129556 58 Pembrolizumab + trastuzumab single arm phase Ib/II PreTx LAdv or mHER2+ BC Ib: PD‐L1+ (6) II: PD‐L1+ & PD‐L1‐ (52) PD‐L1 (QualTek/ 22C3) tested prospectively at BTx (58). TILs were evaluated retrospectively (48). II: H | Full Paper |
2020 | Lu, H;Molony, RD;Chen, D;Jang, S;Wolf, B;Ewert, S;Flaherty, M;Xu, F;Isim, S;Shim, Y;Dornelas, C;Balke, N;Leber, XC;Scharenberg, M;Koelln, J;Choi, E;Ward, R;Johnson, J;Calzascia, T;Isnardi, I;Williams, JA;Lindenbergh, PL;van de Donk, NWCJ;Mutis, T;Huet, H;Lees, E;Meyer, MJ; | Development of anti-CD32b antibodies with enhanced Fc function for the treatment of B and plasma cell malignancies | Mol. Cancer Ther. | 32847974 | detect CD32b expression on primary cells and cell lines. Patient samples for CD32b expression analysis were purchased from Conversant Bio, now part of Discovery Life Science. 2B6 binding to normal human plasma cells from | Full Paper |
2020 | Hutchins, B;Starling, GC;McCoy, MA;Herzyk, D;Poulet, FM;Dulos, J;Liu, L;Kang, SP;Fayadat-Dilman, L;Hsieh, M;Andrews, CL;Ayanoglu, G;Cullen, C;Malefyt, RW;Kastelein, RA;Saux, SL;Lee, J;Li, S;Malashock, D;Sadekova, S;Soder, G;van Eenennaam, H;Willingham, A;Yu, Y;Streuli, M;Carven, GJ;van Elsas, A; | Biophysical and Immunological Characterization and In Vivo Pharmacokinetics and Toxicology in Nonhuman Primates of the Anti-PD-1 Antibody Pembrolizumab | Molecular cancer therapeutics | 32229606 | See Supplementary Data for additional details. Primary tumor cell culture assay Fresh non-small cell lung cancer (NSCLC) tumor tissues were collected and shipped overnight in AQIX media (AQIX) by collection providers (Folio Biosciences, Bio-Options, | Full Paper |
2020 | Smith, SD;Till, BG;Shadman, MS;Lynch, RC;Cowan, AJ;Wu, QV;Voutsinas, J;Rasmussen, HA;Blue, K;Ujjani, CS;Shustov, A;Cassaday, RD;Fromm, JR;Gopal, AK; | Pembrolizumab with R-CHOP in previously untreated diffuse large B-cell lymphoma: potential for biomarker driven therapy | Br. J. Haematol. | 32030732 | PD‐L1 immunohistochemistry was performed centrally by QualTek Molecular Laboratories using the mouse monoclonal antibody clone 22c3 by previously described methods (Supplementary Appendix, Section B) (Dolled‐Filhart et al. , 2016). Statistical consid | Full Paper |
2020 | Vijayvergia, N;Dasari, A;Deng, M;Litwin, S;Al-Toubah, T;Alpaugh, RK;Dotan, E;Hall, MJ;Ross, NM;Runyen, MM;Denlinger, CS;Halperin, DM;Cohen, SJ;Engstrom, PF;Strosberg, JR; | Pembrolizumab monotherapy in patients with previously treated metastatic high-grade neuroendocrine neoplasms: joint analysis of two prospective, non-randomised trials | Br. J. Cancer | 32152503 | For patients enrolled into FC, PD-L1 immunohistochemistry (IHC) assay was performed at Qualtek Research Laboratories on formalin-fixed, paraffin-embedded tissue sections using anti-PD-L1 monoclonal antibody clone 22C3 [Merck Research Laboratories] | Full Paper |
2020 | Schruf, E;Schroeder, V;Le, HQ;Schönberger, T;Raedel, D;Stewart, EL;Fundel-Clemens, K;Bluhmki, T;Weigle, S;Schuler, M;Thomas, MJ;Heilker, R;Webster, MJ;Dass, M;Frick, M;Stierstorfer, B;Quast, K;Garnett, JP; | Recapitulating idiopathic pulmonary fibrosis related alveolar epithelial dysfunction in a human iPSC-derived air-liquid interface model | FASEB J. | 32297676 | Formalin-fixed and paraffin embedded lung samples from human IPF patients were purchased from Folio Biosciences (Powell, OH, US) under the regulatory conditions of the Boehringer Ingelheim corporate policy regarding the acquisition and use of human b | Full Paper |
2020 | Kang, J;Yeom, G;Jang, H;Park, C;Kim, M; | Highly sensitive and universal detection strategy based on a colorimetric assay using target-specific heterogeneous sandwich DNA aptamer | Analytica Chimica Acta | All reagent concentrations were the same as those analyzed in the developed method. 2.8. Evaluation of clinical samples. We obtained patient samples containing NPs of influenza A and B viruses from Discovery Life Sciences, Inc (Huntsville, AL, USA) | Full Paper | |
2020 | Seyger, M;Abramovits, W;Liljedahl, M;Hoejen, MN;Teng, J; | Safety and efficacy of fixed-dose combination calcipotriol (50 μg/g) and betamethasone dipropionate (0.5 mg/g) cutaneous foam in adolescent patients (aged 12 to <17 years) with plaque psoriasis: results of a phase II, open-label trial | J Eur Acad Dermatol Venereol | 32074665 | W. Abramovits has received honoraria or fees for serving on advisory boards as a speaker and as a consultant, and has received grants as an investigator from AbbVie, Akros, Allergan, Amgen, Anacor Pharm, Aqua Pharma, Celgene, Centocor, Conversant Bio | Full Paper |
2020 | Piha-Paul, SA;Oh, DY;Ueno, M;Malka, D;Chung, HC;Nagrial, A;Kelley, RK;Ros, W;Italiano, A;Nakagawa, K;Rugo, HS;de Braud, F;Varga, AI;Hansen, A;Wang, H;Krishnan, S;Norwood, KG;Doi, T; | Efficacy and safety of pembrolizumab for the treatment of advanced biliary cancer: Results from the KEYNOTE-158 and KEYNOTE-028 studies | Int. J. Cancer | 32359091 | In KEYNOTE‐028, a prototype immunohistochemistry assay (QualTek, Goleta, California) was used to prospectively detect PD‐L1 expression, with positivity defined as membranous PD‐L1 expression in ≥1% of tumor and associated inflammatory cells or positi | Full Paper |
2020 | Agnello, G;Alters, SE;Rowlinson, SW; | Preclinical safety and antitumor activity of the arginine-degrading therapeutic enzyme pegzilarginase, a PEGylated, cobalt-substituted recombinant human arginase 1 | Transl Res | 31954097 | CD8 IHC analysis of FFPE sections was performed by QualTek Molecular Laboratories (Goleta, Calif) and LC3B IHC analysis of FFPE sections was performed by GoPath Laboratories (Buffalo Grove, Ill). Statistical analyses | Full Paper |
2020 | Ross, AE;Hurley, PJ;Tran, PT;Rowe, SP;Benzon, B;Neal, TO;Chapman, C;Harb, R;Milman, Y;Trock, BJ;Drake, CG;Antonarakis, ES; | A pilot trial of pembrolizumab plus prostatic cryotherapy for men with newly diagnosed oligometastatic hormone-sensitive prostate cancer | Prostate Cancer Prostatic Dis. | 31611635 | pathologist. Post-treatment biopsies were evaluated for PD-L1, CD4, CD8, and FoxP3 proteins by single-stain semiquantitative immunohistochemistry performed by QualTek Molecular and Clinical Laboratories (Santa Barbara, CA) ;re assessed by a geni | Full Paper |
2020 | Scheffler, M;Holzem, A;Kron, A;Nogova, L;Ihle, MA;von Levetzow, C;Fassunke, J;Wömpner, C;Bitter, E;Koleczko, S;Abdulla, DSY;Michels, S;Fischer, R;Riedel, R;Weber, JP;Westphal, T;Gerigk, U;Kern, J;Kaminsky, B;Randerath, W;Kambartel, KO;Merkelbach-Bruse, S;Büttner, R;Wolf, J; | Co-occurrence of targetable mutations in Non-small cell lung cancer (NSCLC) patients harboring MAP2K1 mutations | Lung Cancer | 32361034 | Reinhard Büttner: RB has been a consultant for Pfizer and Novartis regarding MET inhibitors and is a co-founder and CSO of Targos Molecular Pathology, Kassel Germany | Full Paper |
2020 | Lee, EK;Xiong, N;Cheng, SC;Barry, WT;Penson, RT;Konstantinopoulos, PA;Hoffman, MA;Horowitz, N;Dizon, DS;Stover, EH;Wright, AA;Campos, SM;Krasner, C;Morrissey, S;Whalen, C;Quinn, R;Matulonis, UA;Liu, JF; | Combined pembrolizumab and pegylated liposomal doxorubicin in platinum resistant ovarian cancer: A phase 2 clinical trial | Gynecol. Oncol. | 32771276 | Tumor infiltrating lymphocytes (TILs) were estimated as an overall average of the sample and reported on a scale of 0 (absent TILs) to 3 (profuse infiltration). PD-L1 and TIL analysis was performed at QualTek Molecular Laboraties, PA | Full Paper |
2020 | Frumovitz, M;Westin, SN;Salvo, G;Zarifa, A;Xu, M;Yap, TA;Rodon, AJ;Karp, DD;Abonofal, A;Jazaeri, AA;Naing, A; | Phase II study of pembrolizumab efficacy and safety in women with recurrent small cell neuroendocrine carcinoma of the lower genital tract | Gynecol. Oncol. | 32534809 | Adverse events were assessed using the National Cancer Institute Common Terminology Criteria for Adverse Events version 4.03. When fresh or archived tissue was available, PD-L1 biomarker analysis was performed by Qualtek assay using Merck 22C3 antibo | Full Paper |
2020 | Gaillard, S;Broadwater, G;Andrews, W;Starr, M;Previs, R;Havrilesky, L;Davidson, B;Berchuck, A;Yi, J;Nixon, A;Secord, A; | Pembrolizumab window study: Illuminating the immunologic landscape in gynecologic cancers | Gynecologic Oncology | changes in PD-L1 expression (by immunohistochemistry with monoclonal antibody clone 22C3 on FFPE specimens;l Qualtek, PA) scored using a quantitative modified proportion score (MPS) | Full Paper | |
2020 | Pillarisetti, K;Powers, G;Luistro, L;Babich, A;Baldwin, E;Li, Y;Zhang, X;Mendonça, M;Majewski, N;Nanjunda, R;Chin, D;Packman, K;Elsayed, Y;Attar, R;Gaudet, F; | Teclistamab is an active T cell-redirecting bispecific antibody against B-cell maturation antigen for multiple myeloma | Blood Adv | 32956453 | Plasma samples were from normal subjects (n = 39) and patients with MM (n = 40); donors were acquired from Conversant Biologics and subjected to proteolysis and subsequent mass spectrometry using a reference multiple reaction monitoring sequence (YCN | Full Paper |
2020 | Svrzikapa, N;Longo, K;Prasad, N;Boyanapalli, R;Brown, J;Dorset, D;Yourstone, S;Powers, J;Levy, S;Morris, A;Vargeese, C;Goyal, J; | Investigational assay for haplotype phasing of the huntingtin gene | Molecular Therapy - Methods & Clinical Development | 4 1 Wave Life Sciences Ltd., Cambridge, MA, 02138 USA; 2 Department of Paediatrics, Medical 5 Sciences Division, University of Oxford, Oxford, OX3 9DU UK; 3 HudsonAlpha Discovery, 6 Discovery Life Sciences, Huntsville, AL, 35806 USA; 4 Genomic Servic | Full Paper | |
2020 | Sebest, P;Fojt, L;Ostatna, V;Fojta, M;Danhel, A; | Electrodeposited silver amalgam particles on pyrolytic graphite in (spectro)electrochemical detection of 4-nitrophenol, DNA and green fluorescent protein | Bioelectrochemistry | 31855832 | electrode setup composed of: i) a bPGE or edge-plane PGE (ePGE, both Momentive) working electrode, together with ii) a refillable miniature Ag/AgCl/3M KCl reference electrode (eDAQ) placed into the salt bridge composed of a heat shrink Teflon tube (Q | Full Paper |
2020 | Xicoy, H;Brouwers, JF;Wieringa, B;Martens, GJM; | Explorative Combined Lipid and Transcriptomic Profiling of Substantia Nigra and Putamen in Parkinson's Disease | Cells | 32858884 | Total RNA samples were spectrophotometrically analyzed and their 260/280 ratio was typically above 1.9. RNA-seq directionality library preparation and sequencing with Poly (A) selection was performed by HudsonAlpha Genomic Services Laboratory (Huntsv | Full Paper |
2020 | Elgharably, H;Okamoto, T;Ayyat, KS;Niikawa, H;Meade, S;Farver, C;Chan, ER;Aldred, MA;McCurry, KR; | Human Lungs Airway Epithelium Upregulate MicroRNA-17 and MicroRNA-548b in Response to Cold Ischemia and Ex Vivo Reperfusion | Transplantation | 32590607 | We thank Tracey Bonfield, PhD from CWRU for performing the cytokines analysis. We thank Gerard J. Nuovo, MD, and Adel Mikhail, PhD from Phylogeny Inc. for performing the in situ hybridization assays of the microRNA | Full Paper |
2020 | Grigorieva, J;Asmellash, S;Net, L;Tsypin, M;Roder, H;Roder, J; | Mass Spectrometry-Based Multivariate Proteomic Tests for Prediction of Outcomes on Immune Checkpoint Blockade Therapy: The Modern Analytical Approach | Int J Mol Sci | 32012941 | 50] PSEA reference set NSCLC patients; samples obtained from commercial biobanks Conversant Bio (Huntsville, AL) and Oncology Metrix (Fort Worth, TX) 100 Grigorieva et al., 2019 [51] 3. BDX008 Test and ICB Test BDX008 | Full Paper |
2020 | Awty-Carroll, D;Ravella, S;Clifton-Brown, J;Robson, P; | Using a Taguchi DOE to investigate factors and interactions affecting germination in Miscanthus sinensis | Sci Rep | 32005862 | All dishes were prepared and tested at the same time to limit extraneous sources of variation. The Taguchi design of experiment (DOE) was produced and primarily analysed using Qualtek-4 (Nutek inc., Michigan, USA) with secondary analysis in R34 ;Ful | Full Paper |
2020 | Noto, PB;Sikorski, TW;Zappacosta, F;Wagner, CD;Montes de Oca, R;Szapacs, ME;Annan, RS;Liu, Y;McHugh, CF;Mohammad, HP;Piccoli, SP;Creasy, CL; | Identification of hnRNP-A1 as a pharmacodynamic biomarker of type I PRMT inhibition in blood and tumor tissues | Scientific reports | 33335114 | nd Treatment of Laboratory Animals and were reviewed by the Institutional Animal Care and Use Committee at GSK. Immunohistochemistry Both total and ADM-R225-hnRNP-A1 IHC assays were developed and at QualTek Molecular Laboratories using anti-hnRNP-A1 | Full Paper |
2020 | Rüschoff, J;Lebeau, A;Sinn, P;Schildhaus, HU;Decker, T;Ammann, J;Künzel, C;Koch, W;Untch, M; | Statistical modelling of HER2-positivity in breast cancer: Final analyses from two large, multicentre, non-interventional studies in Germany | Breast | 31918324 | Institut für Pathologie Nordhessen and Targos Molecular Pathology GmbH, Germaniastr. 7, D-34119, Kassel, Germany. Electronic address: rueschoff@patho-nordhessen.de.++Institut für Pathologie, Universitätsklinikum Hamburg-Eppendorf, Martinistr. 52, 202 | Full Paper |
2020 | Emancipator, K; | Keytruda and PD-L1: a Real-World Example of Co-development of a Drug with a Predictive Biomarker | The AAPS journal | 33222057 | two clinical trial assays were used (Table I). The first, described in the literature as the "prototype assay" (4), was developed in-house at Merck & Co., Inc., Kenilworth, NJ, USA, and eventually placed and refined in an accredited clinical laborato | Full Paper |
2020 | Gebauer, F;Krämer, M;Bruns, C;Schlößer, HA;Thelen, M;Lohneis, P;Schröder, W;Zander, T;Alakus, H;Buettner, R;Loeser, H;Quaas, A; | Lymphocyte activation gene-3 (LAG3) mRNA and protein expression on tumour infiltrating lymphocytes (TILs) in oesophageal adenocarcinoma | J. Cancer Res. Clin. Oncol. | 32592066 | Reinhard Büttner: Co-Founder and Co-Owner of Targos Molecular Pathology Inc. Kassel/Germany. Hans Schlösser: Funding for Research from Astra Zeneca for research outside this study. Thomas Zander: BMS: advisory board, clinical trial; Novartis: advisor | Full Paper |
2020 | Wang, X;Jaimes, M;Gu, H;Shults, K;Putta, S;Sharma, V;Chow, W;Gogoi, P;Handique, K;Patterson, BK; | Cell by cell immuno- and cancer marker profiling of non-small cell lung cancer tissue: Checkpoint marker expression on CD103+, CD4+ T-cells predicts circulating tumor cells | Translational oncology | 33217647 | of a total of 72 biomarkers that result from using combinations of cellular markers in our algorithm to predict CTCs. Material and methods Samples Fresh tissues were obtained from 10 NSCLC cases by Folio Biosciences [Powell, OH] with paired peripher | Full Paper |
2020 | MacCarty, N;Bentson, S;Cushman, K;Au, J;Li, C;Murugan, G;Still, D; | Stratification of particulate matter in a kitchen: A comparison of empirical to predicted concentrations and implications for cookstove emissions targets | Energy for Sustainable Development | the top perimeter (Fig. 3). Small computer fans (Qualtek FAD1-06020CSHW11 rated at 1.44 W @12 V and 16 CFM) covered the holes at the top perimeter to force air out of the test kitchen at a constant rate. In Phase 1 of the | Full Paper | |
2020 | Jia, Y;Liu, L;Shan, B; | Future of immune checkpoint inhibitors: focus on tumor immune microenvironment | Annals of translational medicine | 33145314 | The TNBC cohort in KEYNOTE-012 phase Ib trial enrolled 32 cases of heavily pre-treated patients with PD-L1 positivity in the stroma or PD-L1 ≥1% tumor cells using their Qualtek assay | Full Paper |
2020 | Sebest, P;Ostatna, V;Fojta, M;Danhel, A; | Constant-current chronopotentiometric stripping detection of bovine serum albumin on silver amalgam particles | Journal of Electroanalytical Chemistry | in three-electrode setup composed of: i) base plane PGE (bPGE,od 3.0 mm, Momentive) as working electrode, together with ii) refillable miniature Ag/AgCl/3 M KCl reference electrode (eDAQ) placed into the salt bridge composed of heat shrink Teflon tub | Full Paper | |
2020 | Rehkaemper, J;Korenkov, M;Quaas, A;Rueschoff, J;Pamuk, A;Zander, T;Hillmer, AM;Buettner, R;Hoelscher, AH;Bruns, CJ;Loeser, H;Alakus, H;Schoemig-Markiefka, B; | Amplification of KRAS and its heterogeneity in non-Asian gastric adenocarcinomas | BMC Cancer | 32571252 | Institute of Pathology, University Hospital Cologne, Cologne, Germany. jan.rehkaemper@uk-koeln.de.++Department of General, Visceral and Cancer Surgery, University Hospital Cologne, Cologne, Germany.++Institute of Pathology, University Hospital Cologn | Full Paper |
2020 | Montalban-Bravo, G;Class, CA;Ganan-Gomez, I;Kanagal-Shamanna, R;Sasaki, K;Richard-Carpentier, G;Naqvi, K;Wei, Y;Yang, H;Soltysiak, KA;Chien, K;Bueso-Ramos, C;Do, KA;Kantarjian, H;Garcia-Manero, G; | Transcriptomic analysis implicates necroptosis in disease progression and prognosis in myelodysplastic syndromes | Leukemia | 31719677 | BM samples from healthy individuals were obtained from AllCells (Emeryville, CA). Patient characteristics are detailed in Supplementary Table S1. Informed consent was obtained Save | Full Paper |
2020 | Arumugam, A;Faron, ML;Yu, P;Markham, C;Wu, M;Wong, S; | A Rapid SARS-CoV-2 RT-PCR Assay for Low Resource Settings | Diagnostics (Basel, Switzerland) | 32987722 | No. 10006606) were purchased from Integrated DNA Technologies (Coralville, IA, USA). The clinical specimens of Influenza A (DLS16-85584), Influenza B (DLS15-33890), and RSV (KH19-00715) were obtained from Discovery Life Sciences Inc Cached | Full Paper |
2020 | Bio, S;Nunes, B; | Acute effects of diclofenac on zebrafish: Indications of oxidative effects and damages at environmentally realistic levels of exposure | Environ. Toxicol. Pharmacol. | 32320907 | With the increasing awareness about the contamination of the aquatic environment by pharmaceuticals, there is a growing need to study their adverse effects on aquatic organisms. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID), whose wide | Full Paper |
2020 | Piedade, F;Bio, S;Nunes, B; | Effects of common pharmaceutical drugs (paracetamol and acetylsalicylic acid) short term exposure on biomarkers of the mussel Mytilus spp | Environ. Toxicol. Pharmacol. | 31704586 | Pharmaceutical drugs in the wild may pose significant risks to non-target exposed organisms. This situation is even more troublesome for coastal marine or estuarine environments, located in the vicinity of large human conglomerates, for which the put | Full Paper |
2020 | Lin, J;Song, AJ;Hoffman-Censits, J;Leiby, BE;Tuluc, M;Shaw, C;Harshyne, L;Kean, R;Bar-Ad, V;Den, RB;Hurwitz, MD;Louie, J;Philipose, S;Deshmukh, SP;Johnson, JM;Dicker, AP;Hooper, DC;Kelly, WK;Lu, B; | A Pilot Study of Radiation Therapy in Combination With Pembrolizumab in Patients With Metastatic Renal Cell Cancer | Am. J. Clin. Oncol. | 31693508 | When possible preradiation and post- radiation biopsy material was compared. Biopsy samples were analyzed by a QualTek pathologist (King of Prussia, PA) and Merck 22C3 antibody was used to score PD-L1 membrane expression | Full Paper |
2020 | Johnston, G;Ramsey, HE;Liu, Q;Wang, J;Stengel, KR;Sampathi, S;Acharya, P;Arrate, M;Stubbs, MC;Burn, T;Savona, MR;Hiebert, SW; | Nascent transcript and single-cell RNA-seq analysis defines the mechanism of action of the LSD1 inhibitor INCB059872 in myeloid leukemia | Gene | 32422235 | Samples were submitted to HudsonAlpha Genomic Services Laboratory for library preparation with Nugen Ovation RNA-Seq System V2 kit (cat# 7102-08) and sequencing on Illumina NovaSeq6000. Data analysis was performed as described above. 2.13 Data availa | Full Paper |
2020 | Lin, H;Damen, JE;Walasek, MA;Szilvassy, SJ;Turhan, AG;Louis, SA;Eaves, AC;Wognum, AW; | Feeder-free and serum-free in vitro assay for measuring the effect of drugs on acute and chronic myeloid leukemia stem/progenitor cells | Exp. Hematol. | 32798646 | CML. 1, Folio Conversant, 3.64 × 10 6, 4.9%, 81.2%, 15 × 10 3, 84, Male, Pre treatment, 112.2; 1764.4. 2, Folio Conversant, 3.17 × 10 6, 6.8%, 79.3%, 18.5 × 10 3, 70, Male, Pre treatment, 44.3; 2380.1. 3, Folio Conversant, 1.38 × 10 6, 18.8%, 78.7%, | Full Paper |
2020 | Barroso-Sousa, R;Krop, IE;Trippa, L;Tan-Wasielewski, Z;Li, T;Osmani, W;Andrews, C;Dillon, D;Richardson, ET;Pastorello, RG;Winer, EP;Mittendorf, EA;Bellon, JR;Schoenfeld, JD;Tolaney, SM; | A Phase II Study of Pembrolizumab in Combination With Palliative Radiotherapy for Hormone Receptor-positive Metastatic Breast Cancer | Clin. Breast Cancer | 32113750 | Clinical benefit is defined as complete response, partial response, or stable disease ≥ 24 weeks according to RECIST 1.1. Exploratory Biomarkers. Five patients had PD-L1 testing assessed centrally by QualTek using the 22C3 antibody | Full Paper |
2020 | Patel, JJ;Levy, DA;Nguyen, SA;Knochelmann, HM;Day, TA; | Impact of PD-L1 expression and human papillomavirus status in anti-PD1/PDL1 immunotherapy for head and neck squamous cell carcinoma-Systematic review and meta-analysis | Head Neck | 31762164 | Oro Valley, Arizona). One study28 did not specify the assay utilized for PD‐L1 expression, but rather reported the laboratory where analysis occurred (QualTek Molecular Laboratories, Goleta, California). This lab confirmed the | Full Paper |
2020 | Adekanmbi, EO;Giduthuri, AT;Srivastava, SK; | Dielectric Characterization and Separation Optimization of Infiltrating Ductal Adenocarcinoma via Insulator-Dielectrophoresis | Micromachines (Basel) | 32218322 | The DEP suspending medium (dextrose solution) was prepared and characterized as described in our previous article [38]. The prepared 100 mL suspending medium was divided into five separate beakers. Into each beaker, except the first, calculated volum | Full Paper |
2020 | Jasani, B;Bänfer, G;Fish, R;Waelput, W;Sucaet, Y;Barker, C;Whiteley, JL;Walker, J;Hovelinck, R;Diezko, R; | Evaluation of an online training tool for scoring programmed cell death ligand-1 (PD-L1) diagnostic tests for lung cancer | Diagn Pathol | 32303234 | Correspondence: rolf.diezko@targos-gmbh.de 2Advance - Training and Consulting Unit, Targos Molecular Pathology GmbH, Kassel, Germany Full list of author information is available at the end of the article Jasani et al ;Correspondence: rolf.diezko | Full Paper |
2020 | Schöniger, S;Degner, S;Zhang, Q;Schandelmaier, C;Aupperle-Lellbach, H;Jasani, B;Schoon, HA; | Tumor Infiltrating Lymphocytes in Pet Rabbit Mammary Carcinomas: A Study with Relevance to Comparative Pathology | Animals : an open access journal from MDPI | 32824521 | 1. Targos Molecular Pathology GmbH, Germaniastrasse 7, 34119 Kassel, Germany. 2. Institute of Veterinary Pathology, University of Leipzig, An den Tierkliniken, 04109 Leipzig, Germany. 3. Institute of Anatomy, Experimental Neurobiology Cached | Full Paper |
2020 | Schöniger, S;Schoon, HA; | The Healthy and Diseased Equine Endometrium: A Review of Morphological Features and Molecular Analyses | Animals : an open access journal from MDPI | 32260515 | Targos Molecular Pathology GmbH, Germaniastrasse 7, 34119 Kassel, Germany.++Institute of Veterinary Pathology, Faculty of Veterinary Medicine, Leipzig University, An den Tierkliniken 33, 04103 Leipzig, Germany | Full Paper |
2020 | Fish, EJ;Martinez-Romero, EG;DeInnocentes, P;Koehler, JW;Prasad, N;Smith, AN;Bird, RC; | Circulating microRNA as biomarkers of canine mammary carcinoma in dogs | J. Vet. Intern. Med. | 32342546 | Extracted RNA was stored at −80°C until being shipped on dry ice to the Genomic Services Laboratory at HudsonAlpha Discovery for deep‐sequencing as previously described.14 Briefly, RNA libraries were processed extracted RNA using a NEBNext Small RNA | Full Paper |
2020 | Nuovo, G; | A broad-based approach to differentiate CIN from its mimics: The utility of in situ hybridization and immunohistochemistry | Ann Diagn Pathol | 32330660 | study was the review of 100 consecutive cases of formalin fixed, paraffin embedded tissues cervical biopsies done for either an abnormal Pap smear and/or a high risk HPV DNA positive result where the diagnosis was listed as CIN 1 or CIN 2. Folio Bios | Full Paper |
2020 | Inceer, H;Ozcan, M; | Taxonomic evaluations on the anatomical characters of leaf and achene in Turkish Tripleurospermum with its relative Matricaria (Asteraceae) | Flora | Besides, both genera have appeared well separated in different and supported clades based on molecular phylogeny (Inceer et al., 2018) | Full Paper | |
2020 | Roder, J;Net, L;Oliveira, C;Meyer, K;Asmellash, S;Kasimir-Bauer, S;Pass, H;Weber, J;Roder, H;Grigorieva, J; | A proposal for score assignment to characterize biological processes from mass spectral analysis of serum | Clinical Mass Spectrometry | Samples were obtained from the commercial biobanks Conversant Bio (Huntsville, AL) and Oncology Metrics (Fort Worth, TX). b They were purchased from commercial biobanks, including Conversant Bio (Huntsville, AL), AdeptBio (Memphis, TN), and ProMedD | Full Paper | |
2020 | Köhne, M;Mönnig, F;Papin, J;Schöniger, S;Tönissen, A;Rohn, K;Martinsson, G;Schoon, HA;Sieme, H; | Effects of Hysteroscopic and Uterine Body Insemination on the Presence of Selected Immune Cells in the Equine Endometrium | J. Equine Vet. Sci. | 32534786 | Current affiliation: Targos Molecular Pathology GmbH, 34119 Kassel, Germany | Full Paper |
2020 | Schildhaus, HU; | [Immunohistochemistry-based predictive biomarkers for lung cancer] | Pathologe | 31989233 | Interessenkonflikt. H.-U. Schildhaus erhielt Honorare von MSD, BMS, Abbvie, ZytoVision, Zytomed, Pfizer, Abbott Molecular, Novartis Oncology und Roche. Der Autor ist Board Member bzw. Assessor bei QuIP, NordiQC und UKNEQAS sowie Angestellter der Targ | Full Paper |
2020 | Tsai, AG;Glass, DR;Juntilla, M;Hartmann, FJ;Oak, JS;Fernandez-Pol, S;Ohgami, RS;Bendall, SC; | Multiplexed single-cell morphometry for hematopathology diagnostics | Nature medicine | 32161403 | Healthy bone marrow samples from AllCells were ordered, delivered and processed the same day. Healthy bone marrow 1 and 2 refer to the AllCells 9878 and 10874 samples, Save | Full Paper |
2020 | Reyes, M;Filbin, MR;Bhattacharyya, RP;Billman, K;Eisenhaure, T;Hung, DT;Levy, BD;Baron, RM;Blainey, PC;Goldberg, MB;Hacohen, N; | An immune-cell signature of bacterial sepsis | Nature medicine | 32066974 | De-identified BMMC samples were purchased from AllCells or Stemcell Technologies. This study was approved by the Institutional Review Boards at the Broad Institute of MIT and Save | Full Paper |
2020 | Travaglini, KJ;Nabhan, AN;Penland, L;Sinha, R;Gillich, A;Sit, RV;Chang, S;Conley, SD;Mori, Y;Seita, J;Berry, GJ;Shrager, JB;Metzger, RJ;Kuo, CS;Neff, N;Weissman, IL;Quake, SR;Krasnow, MA; | A molecular cell atlas of the human lung from single-cell RNA sequencing | Nature | 33208946 | For bulk RNA-seq of canonical immune populations, whole blood from healthy human donors was obtained commericially (AllCells) in EDTA tubes. Patient tissues were obtained under Save | Full Paper |
2020 | Link, JO;Rhee, MS;Tse, WC;Zheng, J;Somoza, JR;Rowe, W;Begley, R;Chiu, A;Mulato, A;Hansen, D;Singer, E;Tsai, LK;Bam, RA;Chou, CH;Canales, E;Brizgys, G;Zhang, JR;Li, J;Graupe, M;Morganelli, P;Liu, Q;Wu, Q;Halcomb, RL;Saito, RD;Schroeder, SD;Lazerwith, SE;Bondy, S;Jin, D;Hung, M;Novikov, N;Liu, X;Villaseñor, AG;Cannizzaro, CE;Hu, EY;Anderson, RL;Appleby, TC;Lu, B;Mwangi, J;Liclican, A;Niedziela-Majka, A;Papalia, GA;Wong, MH;Leavitt, SA;Xu, Y;Koditek, D;Stepan, GJ;Yu, H;Pagratis, N;Clancy, S;Ahmadyar, S;Cai, TZ;Sellers, S;Wolckenhauer, SA;Ling, J;Callebaut, C;Margot, N;Ram, RR;Liu, YP;Hyland, R;Sinclair, GI;Ruane, PJ;Crofoot, GE;McDonald, CK;Brainard, DM;Lad, L;Swaminathan, S;Sundquist, WI;Sakowicz, R;Chester, AE;Lee, WE;Daar, ES;Yant, SR;Cihlar, T; | Clinical targeting of HIV capsid protein with a long-acting small molecule | Nature | 32612233 | Human peripheral blood mononuclear cells (PBMCs) were collected from healthy volunteers under informed consent; their use was approved by an institutional review board at AllCells Save | Full Paper |
2020 | Ferrari, S;Jacob, A;Beretta, S;Unali, G;Albano, L;Vavassori, V;Cittaro, D;Lazarevic, D;Brombin, C;Cugnata, F;Kajaste-Rudnitski, A;Merelli, I;Genovese, P;Naldini, L; | Efficient gene editing of human long-term hematopoietic stem cells validated by clonal tracking | Nature biotechnology | 32601433 | (Biovision) and 50 nM UM171 (STEMCell Technologies), unless otherwise specified. G-CSF mPB CD34+ HSPCs were purified with the CliniMACS CD34 Reagent System (Miltenyi Biotec) from Mobilized Leukopak (AllCells) upon approval by the Ospedale San Raffae | Full Paper |
2020 | Spindler, MJ;Nelson, AL;Wagner, EK;Oppermans, N;Bridgeman, JS;Heather, JM;Adler, AS;Asensio, MA;Edgar, RC;Lim, YW;Meyer, EH;Hawkins, RE;Cobbold, M;Johnson, DS; | Massively parallel interrogation and mining of natively paired human TCRαβ repertoires | Nature biotechnology | 32393905 | novel ACT. Online Methods Sourcing and Processing Human Materials De-identified peripheral blood mononuclear cells (PBMCs) in leukopaks were obtained from HLA-A*02:01 and HLA-A*24:02 healthy donors (AllCells, Alameda, CA, USA), under an Institutiona | Full Paper |
2020 | Dinh, HQ;Eggert, T;Meyer, MA;Zhu, YP;Olingy, CE;Llewellyn, R;Wu, R;Hedrick, CC; | Coexpression of CD71 and CD117 Identifies an Early Unipotent Neutrophil Progenitor Population in Human Bone Marrow | Immunity | 32814027 | Human bone marrow cells Fresh bone marrow samples from anonymous healthy adult donors were obtained from AllCells, Inc. (Alameda, CA). For information on donor characteristics, refer to Supplemental Table 1. Upon arrival, the fresh cells were immedia | Full Paper |
2020 | Glass, DR;Tsai, AG;Oliveria, JP;Hartmann, FJ;Kimmey, SC;Calderon, AA;Borges, L;Glass, MC;Wagar, LE;Davis, MM;Bendall, SC; | An Integrated Multi-omic Single-Cell Atlas of Human B Cell Identity | Immunity | 32668225 | structive sleep apnea stanfordhealthcare.org Human lymph node Stanford Hosptial, biopsy sample of recovered lymphoma patient stanfordhealthcare.org Human bone marrow from healthy donors AllCells allcells.com ------------------------- | Full Paper |
2020 | Park, HB;Wei, Z;Oh, J;Xu, H;Kim, CS;Wang, R;Wyche, TP;Piizzi, G;Flavell, RA;Crawford, JM; | Sulfamethoxazole drug stress upregulates antioxidant immunomodulatory metabolites in Escherichia coli | Nature microbiology | 32719505 | ndors supply Eurofins DiscoverX with primary human cells: Cell Applications, Inc., CellzDirect, Celsis-IVT, Leukolab, Life Technologies, Lonza, ScienCell, Hemacare Corporation, Stemcell Technologies, AllCells, Physician’s Plasma Alliance, Lifeline Ce | Full Paper |
2020 | Di Genua, C;Valletta, S;Buono, M;Stoilova, B;Sweeney, C;Rodriguez-Meira, A;Grover, A;Drissen, R;Meng, Y;Beveridge, R;Aboukhalil, Z;Karamitros, D;Belderbos, ME;Bystrykh, L;Thongjuea, S;Vyas, P;Nerlov, C; | C/EBPα and GATA-2 Mutations Induce Bilineage Acute Erythroid Leukemia through Transformation of a Neomorphic Neutrophil-Erythroid Progenitor | Cancer cell | 32330454 | derbos et al., 2017) ------------------------- Biological Samples ------------------------- AEL patient samples (OX1164; AYL050; MKH048; STB115) MDSBio NA Normal adult human bone marrow AllCells NA ------------------------- Critical | Full Paper |
2020 | Li, S;Chen, X;Wang, J;Meydan, C;Glass, JL;Shih, AH;Delwel, R;Levine, RL;Mason, CE;Melnick, AM; | Somatic Mutations Drive Specific, but Reversible, Epigenetic Heterogeneity States in AML | Cancer discovery | 32938585 | from our prior study(9), 5 of which were purchased from AllCells (Alameda, CA, USA) and 9 of which were isolated using magnetic bead positive selection for CD34+ (Miltenyi Biotec) from freshly collected bone marrow samples from individuals without kn | Full Paper |
2020 | Zhou, Y;Han, C;Wang, E;Lorch, AH;Serafin, V;Cho, BK;Gutierrez Diaz, BT;Calvo, J;Fang, C;Khodadadi-Jamayran, A;Tabaglio, T;Marier, C;Kuchmiy, A;Sun, L;Yacu, G;Filip, SK;Jin, Q;Takahashi, YH;Amici, DR;Rendleman, EJ;Rawat, R;Bresolin, S;Paganin, M;Zhang, C;Li, H;Kandela, I;Politanska, Y;Abdala-Valencia, H;Mendillo, ML;Zhu, P;Palhais, B;Van Vlierberghe, P;Taghon, T;Aifantis, I;Goo, YA;Guccione, E;Heguy, A;Tsirigos, A;Wee, KB;Mishra, RK;Pflumio, F;Accordi, B;Basso, G;Ntziachristos, P; | Posttranslational Regulation of the Exon Skipping Machinery Controls Aberrant Splicing in Leukemia | Cancer discovery | 32444465 | Our study provides a new proof-of-principle for posttranslational regulation of splicing factors independently of mutations in aggressive T-cell leukemia. It further suggests a new drug Save | Full Paper |
2020 | Tochigi, T;Miyamoto, T;Hatakeyama, K;Sakoda, T;Ishihara, D;Irifune, H;Shima, T;Kato, K;Maeda, T;Ito, T;Handa, H;Akashi, K;Kikushige, Y; | Aromatase is a novel neosubstrate of cereblon responsible for immunomodulatory drug-induced thrombocytopenia | Blood | 32219443 | Human adult bone marrow and granulocyte colony-stimulating factor-mobilized peripheral blood samples were obtained from healthy donors or purchased from AllCells. Cord blood Save | Full Paper |
2020 | Montalban Bravo, G;Kanagal-Shamanna, R;Darbaniyan, F;Ganan-Gomez, I;Sasaki, K;Naqvi, K;Wei, Y;Yang, H;Soltysiak, K;Chien, K;Bueso-Ramos, C;Kantarjian, H;Garcia-Manero, G; | Genomic and Transcriptomic Differences of Myelodysplastic Syndrome/Myeloproliferative Neoplasm with Ring Sideroblasts and Thrombocytosis (MDS/MPN-RS-T) and Myelodysplastic Syndrome with Ring Sideroblasts (MDS-RS) | Blood | CD34+ cells from bone marrow samples of 4 pts with MDS/MPN-RS-T, 7 pts with MDS-RS and 17 healthy individuals obtained from AllCells (Emeryville, CA) were isolated using the Save | Full Paper | |
2020 | Montalban Bravo, G;Darbaniyan, F;Kanagal-Shamanna, R;Ganan-Gomez, I;Sasaki, K;Naqvi, K;Wei, Y;Yang, H;Soltysiak, K;Chien, K;Bueso-Ramos, C;Kantarjian, H;Garcia-Manero, G; | Transcriptomic Features and Deregulation of Genes Involved in Monopoiesis Influence Outcomes of Patients with Chronic Myelomonocytic Leukemia | Blood | INTRODUCTION: Chronic myelomonocytic leukemia (CMML) is characterized by TET2, SRSF2, ASXL1 and RAS pathway mutations known to induce myelomonocytic bias. We have previously shown that upregulation of KDM6B, a histone demethylase that acts as an inna | Full Paper | |
2020 | Walters, M;Chui, D;Farrell, J;Lal, A;Locatelli, F;Kwiatkowski, J;Porter, J;Sauer, M;Thuret, I;Hongeng, S;Kulozik, A;Thrasher, A;Yannaki, E;Yang, J;Whitney, D;Petrusich, A;Colvin, R;Thompson, A; | Response of Patients with Transfusion-Dependent β-Thalassemia (TDT) to Betibeglogene Autotemcel (beti-cel; LentiGlobin for β-Thalassemia) Gene Therapy Based on HBB Genotype and Disease Genetic Modifiers | Blood | Introduction We investigated the impact of β-thalassemia genotypes and disease genetic modifiers including HBA and KLF1 genotype and sentinel single-nucleotide polymorphism (SNP) genotypes at 3 major HbF quantitative trait loci (QTL) o | Full Paper | |
2020 | Kanter, J;Tisdale, J;Mapara, M;Kwiatkowski, J;Krishnamurti, L;Chen, R;Gallagher, M;Ding, Y;Goyal, S;Paramore, C;Thompson, A;Walters, M; | Improvements in Health-Related Quality of Life for Patients Treated with LentiGlobin for Sickle Cell Disease (bb1111) Gene Therapy | Blood | Background In patients with sickle cell disease (SCD), health-related quality of life (HRQoL) is worse than in the general population and comparable or worse than in patients with other chronic or painful diseases such as cystic fibros | Full Paper | |
2020 | Thompson, A;Kwiatkowski, J;Porter, J;Hongeng, S;Yannaki, E;Kulozik, A;Sauer, M;Thrasher, A;Thuret, I;Lal, A;Guo, R;Liu, W;Colvin, R;Walters, M;Locatelli, F; | Favorable Outcomes in Pediatric Patients in the Phase 3 Hgb-207 (Northstar-2) and Hgb-212 (Northstar-3) Studies of Betibeglogene Autotemcel Gene Therapy for the Treatment of Transfusion-Dependent β-Thalassemia | Blood | Introduction Betibeglogene autotemcel (beti-cel; LentiGlobin for β-thalassemia) gene therapy is being evaluated for the treatment of transfusion-dependent β-thalassemia (TDT). Initial positive results of beti-cel in the phase 3 studies | Full Paper | |
2020 | Kwiatkowski, J;Walters, M;Hongeng, S;Locatelli, F;Rasko, J;Cavazzana, M;Chen, Y;Colvin, R;Thompson, A; | Long-Term Efficacy and Safety of Betibeglogene Autotemcel Gene Therapy for the Treatment of Transfusion-Dependent β-Thalassemia: Results in Patients with up to 6 Years of Follow-up | Blood | Introduction The goal of betibeglogene autotemcel (beti-cel; LentiGlobin for β-thalassemia) gene therapy in patients with transfusion-dependent β-thalassemia (TDT) is lifelong, stable production of functional adult hemoglobin (Hb) suff | Full Paper | |
2020 | Thompson, A;Walters, M;Mapara, M;Kwiatkowski, J;Krishnamurti, L;Aygun, B;Kasow, K;Rifkin-Zenenberg, S;Schmidt, M;DelCarpini, J;Pierciey, F;Miller, A;Gallagher, M;Chen, R;Goyal, S;Kanter, J;Tisdale, J; | Resolution of Serious Vaso-Occlusive Pain Crises and Reduction in Patient-Reported Pain Intensity: Results from the Ongoing Phase 1/2 HGB-206 Group C Study of LentiGlobin for Sickle Cell Disease (bb1111) Gene Therapy | Blood | Background Sickle cell disease (SCD) is caused by abnormal sickle hemoglobin (HbS) and results in chronic hemolytic anemia, painful vaso-occlusive events (VOEs), and progressive vasculopathy that lead to significant morbidity. While ac | Full Paper | |
2020 | Rothe, K;Babaian, A;Nakamichi, N;Chen, M;Chafe, SC;Watanabe, A;Forrest, DL;Mager, DL;Eaves, CJ;Dedhar, S;Jiang, X; | Integrin-Linked Kinase Mediates Therapeutic Resistance of Quiescent CML Stem Cells to Tyrosine Kinase Inhibitors | Cell stem cell | 32413332 | Full Paper | |
2020 | Nakao, S;Arai, Y;Tasaki, M;Yamashita, M;Murakami, R;Kawase, T;Amino, N;Nakatake, M;Kurosaki, H;Mori, M;Takeuchi, M;Nakamura, T; | Intratumoral expression of IL-7 and IL-12 using an oncolytic virus increases systemic sensitivity to immune checkpoint blockade | Science translational medicine | 31941828 | hIL-7/hIL-12-VV at MOI 1.0 and cultured for 2 days. Then, the supernatant was filtered through 0.1-μm polyvinylidene difluoride membrane (Millipore) and added to 1 × 105 human PBMCs (AllCells) in a 96-well plate. Seven days later, secretion of human | Full Paper |
2020 | Geng, J;Liu, W;Zhou, H;Zhang, T;Wang, L;Zhang, M;Li, Y;Shen, B;Li, X;Xiao, B; | A Plug-and-Latch Mechanism for Gating the Mechanosensitive Piezo Channel | Neuron | 32142647 | HEK293T Xiao et al., 2011 N/A HEK293T-Piezo1-KO Cahalan et al., 2015 N/A HUVEC Allcells Cat# H-001F-C HeLa Xiao et al., 2011 N/A N2A Coste et al., 2010 N/A C2C12 National Infrastructure of Cell line Source, China Cat# GNM26 | Full Paper |
2020 | Fang, C;Wang, Z;Han, C;Safgren, SL;Helmin, KA;Adelman, ER;Serafin, V;Basso, G;Eagen, KP;Gaspar-Maia, A;Figueroa, ME;Singer, BD;Ratan, A;Ntziachristos, P;Zang, C; | Cancer-specific CTCF binding facilitates oncogenic transcriptional dysregulation | Genome biology | 32933554 | Human CD4 + T cells were purchased from AllCells. Primary human samples were collected with informed consent and analyzed under the supervision of the Institutional Review Board Save | Full Paper |
2020 | Li, M;Liu, W;Bauch, T;Graviss, EA;Arduino, RC;Kimata, JT;Chen, M;Wang, J; | Clearance of HIV infection by selective elimination of host cells capable of producing HIV | Nature communications | 32792548 | pecific-pathogen-free barrier animal facility at the Houston Methodist Research Institute. Newborn male and female mice were injected intrahepatically with CD34+ human stem cells (5 × 104/mouse; AllCells LLC). Three months later, reconstitution of hu | Full Paper |
2020 | Scharenberg, SG;Poletto, E;Lucot, KL;Colella, P;Sheikali, A;Montine, TJ;Porteus, MH;Gomez-Ospina, N; | Engineering monocyte/macrophage-specific glucocerebrosidase expression in human hematopoietic stem cells using genome editing | Nature communications | 32620863 | Human CD34+ HSPCs mobilized from peripheral blood were purchased frozen from AllCells (Almeda, CA, USA) and thawed per manufacturer's instructions. Human Cord blood was Save | Full Paper |
2020 | Wienert, B;Nguyen, DN;Guenther, A;Feng, SJ;Locke, MN;Wyman, SK;Shin, J;Kazane, KR;Gregory, GL;Carter, MAM;Wright, F;Conklin, BR;Marson, A;Richardson, CD;Corn, JE; | Timed inhibition of CDC7 increases CRISPR-Cas9 mediated templated repair | Nature communications | 32355159 | Cryopreserved wildtype human mobilized peripheral blood CD34 + HSPCs from volunteer donors were purchased from Allcells, and were cultured in SFEMII + CC110 (StemCell Save | Full Paper |
2020 | Lareau, CA;Ma, S;Duarte, FM;Buenrostro, JD; | Inference and effects of barcode multiplets in droplet-based single-cell assays | Nature communications | 32054859 | lues have been published, these values were approximated from an examination of a plot previously reported2. Profiling PBMCs using 10× scATAC-seq For 10× scATAC-seq experiments with PBMCs (PB003F, Allcells), frozen cells were quickly thawed in a 37 | Full Paper |
2020 | Mahuron, KM;Moreau, JM;Glasgow, JE;Boda, DP;Pauli, ML;Gouirand, V;Panjabi, L;Grewal, R;Luber, JM;Mathur, AN;Feldman, RM;Shifrut, E;Mehta, P;Lowe, MM;Alvarado, MD;Marson, A;Singer, M;Wells, J;Jupp, R;Daud, AI;Rosenblum, MD; | Layilin augments integrin activation to promote antitumor immunity | The Journal of experimental medicine | 32539073 | Human peripheral blood mononuclear cells (PBMCs) from two individual donors were purchased from AllCells. CD8 + T cells were enriched from these samples using a negative Save | Full Paper |
2020 | Poran, A;Scherer, J;Bushway, ME;Besada, R;Balogh, KN;Wanamaker, A;Williams, RG;Prabhakara, J;Ott, PA;Hu-Lieskovan, S;Khondker, ZS;Gaynor, RB;Rooney, MS;Srinivasan, L; | Combined TCR Repertoire Profiles and Blood Cell Phenotypes Predict Melanoma Patient Response to Personalized Neoantigen Therapy plus Anti-PD-1 | Cell reports. Medicine | 33294862 | Patient PBMCs from NT-001 trial Ott et al., 2020 N/A Healthy Donor PBMCs Precision for Medicine Cat # 93000-10M Healthy Donor PBMCs StemExpress Cat # LE010F Healthy Donor PBMCs AllCells https://www.allcells.com/tissue-products/ | Full Paper |
2020 | Huang, H;Zhu, H;Xie, Q;Tian, X;Yang, X;Feng, F;Jiang, Q;Sheng, X;Yang, Z; | Evaluation of 124I-JS001 for hPD1 immuno-PET imaging using sarcoma cell homografts in humanized mice | Acta pharmaceutica Sinica. B | 32874831 | The human OS-732 cell line was purchased from the Institute of Cancer, Chinese Academy of Medical Sciences (Beijing, China). Normal peripheral blood T cells and CD3+ pan T cells were obtained from AllCells (PB009-1F-C, Emeryville, CA, USA). Phytohema | Full Paper |
2020 | Poran, A;Harjanto, D;Malloy, M;Arieta, CM;Rothenberg, DA;Lenkala, D;van Buuren, MM;Addona, TA;Rooney, MS;Srinivasan, L;Gaynor, RB; | Sequence-based prediction of SARS-CoV-2 vaccine targets using a mass spectrometry-based bioinformatics predictor identifies immunogenic T cell epitopes | Genome medicine | 32791978 | Human PBMCs from HLA-A02:01-positive human donors were isolated using Ficoll separation from apheresis material (AllCells, USA). Twenty-three SARS-CoV-2 peptides predicted to Save | Full Paper |
2020 | Goodwin, M;Lee, E;Lakshmanan, U;Shipp, S;Froessl, L;Barzaghi, F;Passerini, L;Narula, M;Sheikali, A;Lee, CM;Bao, G;Bauer, CS;Miller, HK;Garcia-Lloret, M;Butte, MJ;Bertaina, A;Shah, A;Pavel-Dinu, M;Hendel, A;Porteus, M;Roncarolo, MG;Bacchetta, R; | CRISPR-based gene editing enables FOXP3 gene repair in IPEX patient cells | Science advances | 32494707 | families. Additional healthy donor HSPCs were isolated from umbilical cord blood donors provided by the Binns Program for Cord Blood Research at the Stanford University or purchased commercially from AllCells or StemCell Technologies. For HSPC isolat | Full Paper |
2020 | Grozdanovic, MM;Doyle, CB;Liu, L;Maybruck, BT;Kwatia, MA;Thiyagarajan, N;Acharya, KR;Ackerman, SJ; | Charcot-Leyden crystal protein/galectin-10 interacts with cationic ribonucleases and is required for eosinophil granulogenesis | The Journal of allergy and clinical immunology | 31982451 | Purified human CD34 + cord blood-derived hematopoietic progenitor cells were purchased from AllCells (Emeryville, Calif) and cultured in Iscove modified Dulbecco medium Save | Full Paper |
2020 | Lundin, V;Sugden, WW;Theodore, LN;Sousa, PM;Han, A;Chou, S;Wrighton, PJ;Cox, AG;Ingber, DE;Goessling, W;Daley, GQ;North, TE; | YAP Regulates Hematopoietic Stem Cell Formation in Response to the Biomechanical Forces of Blood Flow | Developmental cell | 32032546 | Cord Blood CD34+ Cells AllCells Cat. CB008F mPB CD34+ Cells AllCells Cat. mPB015F Mouse Embryonic Fibroblasts GlobalStem Cat. 6001G Primary Human Umbilical Vein Endothelial Cells ThermoFisher Cat. C0155C | Full Paper |
2020 | Duncan, RM;Reyes, L;Moats, K;Robinson, RM;Murphy, SA;Kaur, B;Stessman, HAF;Dolloff, NG; | ATF3 Coordinates Antitumor Synergy between Epigenetic Drugs and Protein Disulfide Isomerase Inhibitors | Cancer research | 32561529 | T cells were expanded from human peripheral blood monoleukocytes purchased from AllCells LLC (PB006F). All cells were maintained at 37C and 5% CO 2 . Experiments were Save | Full Paper |
2020 | Yeung, YA;Krishnamoorthy, V;Dettling, D;Sommer, C;Poulsen, K;Ni, I;Pham, A;Chen, W;Liao-Chan, S;Lindquist, K;Chin, SM;Chunyk, AG;Hu, W;Sasu, B;Chaparro-Riggers, J;Djuretic, I; | An Optimized Full-Length FLT3/CD3 Bispecific Antibody Demonstrates Potent Anti-leukemia Activity and Reversible Hematological Toxicity | Molecular therapy : the journal of the American Society of Gene Therapy | 31981494 | After tumor engraftment (day 6-7), animals were administered 2 × 10 7 expanded human T cells (T cells purchased from Allcells; activated according to Miltenyi manufacturing protocol) Save | Full Paper |
2020 | Morgan, RA;Unti, MJ;Aleshe, B;Brown, D;Osborne, KS;Koziol, C;Ayoub, PG;Smith, OB;O'Brien, R;Tam, C;Miyahira, E;Ruiz, M;Quintos, JP;Senadheera, S;Hollis, RP;Kohn, DB; | Improved Titer and Gene Transfer by Lentiviral Vectors Using Novel, Small β-Globin Locus Control Region Elements | Molecular therapy : the journal of the American Society of Gene Therapy | 31628051 | All BM aspirates were obtained from voluntary healthy donors supplied by AllCells (Alameda, CA), which obviated the need for Instituional Review Board review. BM mononuclear cells Save | Full Paper |
2020 | Sinnakannu, JR;Lee, KL;Cheng, S;Li, J;Yu, M;Tan, SP;Ong, CCH;Li, H;Than, H;Anczuków-Camarda, O;Krainer, AR;Roca, X;Rozen, SG;Iqbal, J;Yang, H;Chuah, C;Ong, ST; | SRSF1 mediates cytokine-induced impaired imatinib sensitivity in chronic myeloid leukemia | Leukemia | 32051529 | at the Singapore General Hospital, cord blood samples were obtained from the Singapore Cord Blood Bank, and normal bone marrow cells were obtained commercially from AllCells ( Save | Full Paper |
2020 | Korotchkina, L;Kazyulkin, D;Komarov, PG;Polinsky, A;Andrianova, EL;Joshi, S;Gupta, M;Vujcic, S;Kononov, E;Toshkov, I;Tian, Y;Krasnov, P;Chernov, MV;Veith, J;Antoch, MP;Middlemiss, S;Somers, K;Lock, RB;Norris, MD;Henderson, MJ;Haber, M;Chernova, OB;Gudkov, AV; | OT-82, a novel anticancer drug candidate that targets the strong dependence of hematological malignancies on NAD biosynthesis | Leukemia | 31896781 | Normal human bone marrow mononuclear cells (BM-MNC) were obtained from ALLCELLS, LLC (Almeda CA, USA). Patients’ BM-MNC were procured at the Hematologic Bank of RPCCC and NAMPT monoclonal antibody (clone OMNI 379) was obtained from Cayman Chemicals ( | Full Paper |
2020 | Kravtsova-Ivantsiv, Y;Goldhirsh, G;Ivantsiv, A;Ben Itzhak, O;Kwon, YT;Pikarsky, E;Ciechanover, A; | Excess of the NF-ĸB p50 subunit generated by the ubiquitin ligase KPC1 suppresses tumors via PD-L1- and chemokines-mediated mechanisms | Proceedings of the National Academy of Sciences of the United States of America | 33168738 | Human PBMCs as a source for isolating human NK cells were from AllCells. Mouse anti-CD274 (PD-L1) (29E.2A3) and mouse anti-CD45 (HI30) for mass cytometry were from Bio Save | Full Paper |
2020 | Ojaghi, A;Carrazana, G;Caruso, C;Abbas, A;Myers, DR;Lam, WA;Robles, FE; | Label-free hematology analysis using deep-ultraviolet microscopy | Proceedings of the National Academy of Sciences of the United States of America | 32561645 | bone marrow aspirate was collected from healthy donors (AllCells) and added to Na heparin anticoagulant solution. Smears were made on uncoated quartz slides using 10 μL of whole Save | Full Paper |
2020 | Huang, P;Zhao, Y;Zhong, J;Zhang, X;Liu, Q;Qiu, X;Chen, S;Yan, H;Hillyer, C;Mohandas, N;Pan, X;Xu, X; | Putative regulators for the continuum of erythroid differentiation revealed by single-cell transcriptome of human BM and UCB cells | Proceedings of the National Academy of Sciences of the United States of America | 32457162 | CD34 + stem/progenitor cells (AllCells) were obtained from three mobilized BM and three neonate UCB samples from independent donors. Cells were expanded at 37 C and 5% CO 2 Save | Full Paper |
2020 | Belling, JN;Heidenreich, LK;Tian, Z;Mendoza, AM;Chiou, TT;Gong, Y;Chen, NY;Young, TD;Wattanatorn, N;Park, JH;Scarabelli, L;Chiang, N;Takahashi, J;Young, SG;Stieg, AZ;De Oliveira, S;Huang, TJ;Weiss, PS;Jonas, SJ; | Acoustofluidic sonoporation for gene delivery to human hematopoietic stem and progenitor cells | Proceedings of the National Academy of Sciences of the United States of America | 32358194 | Mixed donor umbilical cord CD34+ Hematopoietic stem and progenitor cells (Allcells Inc.) were thawed and prestimulated as described by Hoban et al. (44). Postacoustofluidic treatment, HSPCs were cultured in X-VIVO 15 supplemented with 50 ng/μL recomb | Full Paper |
2020 | Borodovsky, A;Barbon, CM;Wang, Y;Ye, M;Prickett, L;Chandra, D;Shaw, J;Deng, N;Sachsenmeier, K;Clarke, JD;Linghu, B;Brown, GA;Brown, J;Congreve, M;Cheng, RK;Dore, AS;Hurrell, E;Shao, W;Woessner, R;Reimer, C;Drew, L;Fawell, S;Schuller, AG;Mele, DA; | Small molecule AZD4635 inhibitor of A2AR signaling rescues immune cell function including CD103+ dendritic cells enhancing anti-tumor immunity | Journal for immunotherapy of cancer | 32727810 | 01 individuals. As previously described,38 naïve CD8+ T cells were co-cultured with autologous monocyte-derived DCs, both cell populations isolated from PBMC from HLA-A*0201 positive healthy donors (AllCells, Research Blood Components). Monocytes wer | Full Paper |
2020 | Kotanides, H;Li, Y;Malabunga, M;Carpenito, C;Eastman, SW;Shen, Y;Wang, G;Inigo, I;Surguladze, D;Pennello, AL;Persaud, K;Hindi, S;Topper, M;Chen, X;Zhang, Y;Bulaon, DK;Bailey, T;Lao, Y;Han, B;Torgerson, S;Chin, D;Sonyi, A;Haidar, JN;Novosiadly, RD;Moxham, CM;Plowman, GD;Ludwig, DL;Kalos, M; | Bispecific Targeting of PD-1 and PD-L1 Enhances T-cell Activation and Antitumor Immunity | Cancer immunology research | 32873605 | Monocytes were isolated from frozen normal peripheral blood mononuclear cells (PBMC) purchased from AllCells (PB005F) using Monocyte Isolation Kit (Miltenyi Biotec; 130-091-153). Immature DCs were generated by culturing the monocytes in RPMI1640 medi | Full Paper |
2020 | Liu, Y;Lv, S;Liu, D;Song, F; | Recent development of amorphous metal coordination polymers for cancer therapy | Acta biomaterialia | 32942012 | e) IC 50 values obtained from cytotoxicity assays against Jurkat human ALLcells after incubating with free MTX, Gd-MTX, [email protected]/DOPE, and [email protected]/DOPE-AA. f) Save | Full Paper |
2020 | Fujita, H;Sasaki, T;Miyamoto, T;Akutsu, SN;Sato, S;Mori, T;Nakabayashi, K;Hata, K;Suzuki, H;Kosaki, K;Matsuura, S;Matsubara, Y;Amagai, M;Kubo, A; | Premature aging syndrome showing random chromosome number instabilities with CDC20 mutation | Aging cell | 33094908 | An age-matched normal control bone marrow mononuclear cell sample was obtained from AllCells. Cells were cultured in MethoCult H4034 Optimum (STEMCELL Technologies) at 1 × Save | Full Paper |
2020 | Yao, X;Ding, J; | Effects of Microstripe Geometry on Guided Cell Migration | ACS applied materials & interfaces | 32479054 | Primary rat mesenchymal stem cells (rMSCs) were purchased from Shanghai Allcells Tech. (China) and cultured in minimum essential medium α (MEM α, Gibco). Mouse embryo fibroblast cell line (NIH3T3) and human cervix epithelial carcinoma cell line (Hela | Full Paper |
2020 | Yang, H;Qing, K;Keeler, GD;Yin, L;Mietzsch, M;Ling, C;Hoffman, BE;Agbandje-McKenna, M;Tan, M;Wang, W;Srivastava, A; | Enhanced Transduction of Human Hematopoietic Stem Cells by AAV6 Vectors: Implications in Gene Therapy and Genome Editing | Molecular therapy. Nucleic acids | 32276210 | D, USA) supplemented with 10% fetal bovine serum (FBS; Sigma, St. Louis, MO, USA) and 1% penicillin-streptomycin (Invitrogen, Grand Island, NY, USA). Human bone marrow CD34+ cells were purchased from AllCells (AllCells Technologies, Emeryville, CA, U | Full Paper |
2020 | Shin, JJ;Schröder, MS;Caiado, F;Wyman, SK;Bray, NL;Bordi, M;Dewitt, MA;Vu, JT;Kim, WT;Hockemeyer, D;Manz, MG;Corn, JE; | Controlled Cycling and Quiescence Enables Efficient HDR in Engraftment-Enriched Adult Hematopoietic Stem and Progenitor Cells | Cell reports | 32877675 | RNA-sequencing datasets This paper BioProject ID PRJNA498122 ------------------------- Experimental Models ------------------------- Mobilized peripheral blood CD34+ Stem/Progenitor cells AllCells mPB015F NOD.Cg-PrkdcscidIl2rgtm1Wjl/Sz | Full Paper |
2020 | Nie, W;Zan, X;Yu, T;Ran, M;Hong, Z;He, Y;Yang, T;Ju, Y;Gao, X; | Synergetic therapy of glioma mediated by a dual delivery system loading α-mangostin and doxorubicin through cell cycle arrest and apoptotic pathways | Cell death & disease | 33116114 | animals The glioma cell lines C6, Gl261 and U87 and human umbilical vein endothelial cells (HUVECs) were purchased from the American Type Culture Collection (ATCC). Primary HUVECs were purchased from ALLCELLS (Shanghai, China). An EGM-2 BulletKit (Lo | Full Paper |
2020 | Zhang, XY;Rajagopalan, D;Chung, TH;Hooi, L;Toh, TB;Tian, JS;Rashid, MBMA;Sahib, NRBM;Gu, M;Lim, JJ;Wang, W;Chng, WJ;Jha, S;Chow, EK; | Frequent upregulation of G9a promotes RelB-dependent proliferation and survival in multiple myeloma | Experimental hematology & oncology | 32477831 | e), 1% Pen Strep (Invitrogen). For adherent cell lines, trypsin (Thermo Scientific, cat# 25200-056) was used to dissociate cells each passage. Cryopreserved Peripheral Blood Mononuclear Cells (PBMCs, AllCells) were cultured in RPMI 1640 medium (BioWe | Full Paper |
2020 | Qian, Z;Fei, J;Zong, S;Yang, K;Li, L;Liu, R;Wang, Z;Cui, Y; | In Situ Visualization and SERS Monitoring of the Interaction between Tumor and Endothelial Cells Using 3D Microfluidic Networks | ACS sensors | 31885254 | Human umbilical vein endothelial cells (HUVEC) were purchased from Shanghai AllCells Biotech. Co., Ltd. Breast cancer cells (MCF7) were purchased from Nanjing KeyGen Biotech. Co., Ltd. The Roswell Park Memorial Institute (RMPI) 1640 cell culture medi | Full Paper |
2020 | Kim, YH;Park, GY;Rabinovitch, N;Tarafder, S;Lee, CH; | Effect of local anesthetics on viability and differentiation of various adult stem/progenitor cells | Stem cell research & therapy | 32894184 | udy that directly compared the effects of LAs across various stem/progenitor cells. Materials and methods Cell isolation Human bone marrow mesenchymal stem/progenitor cells (MSCs) were obtained from AllCells (Alameda, CA). With the Institutional Rev | Full Paper |
2020 | Xiong, MG;Xu, ZS;Li, YH;Wang, SY;Wang, YY;Ran, Y; | RNF152 positively regulates TLR/IL-1R signaling by enhancing MyD88 oligomerization | EMBO reports | 31930677 | HEK293T cells were purchased from ATCC. Human PBMCs were purchased from ALLCELLS. HFFs provided by Prof. Min‐Hua Luo (Wuhan Institute of Virology, CAS) were derived from human foreskins (male) 30. These cells were cultured in DMEM (HyClone) supplemen | Full Paper |
2020 | Han, Y;Gong, T;Zhang, C;Dissanayaka, WL; | HIF-1α Stabilization Enhances Angio-/Vasculogenic Properties of SHED | Journal of dental research | 32298193 | SHED were purchased from AllCells at passage 2 and characterized for mesenchymal origin. The results were published in our previous study (Xu et al. 2017). The cells were cultured in α-Modified Eagle’s Medium supplemented with 10% (v/v) fetal bovine | Full Paper |
2020 | Maser, IP;Hoves, S;Bayer, C;Heidkamp, G;Nimmerjahn, F;Eckmann, J;Ries, CH; | The Tumor Milieu Promotes Functional Human Tumor-Resident Plasmacytoid Dendritic Cells in Humanized Mouse Models | Frontiers in immunology | 33013879 | sulfan (Busilvex ,Pierre Faber) diluted in 0.9% Saline (Braun) was injected intraperitoneally (i.p.). Twenty-four hours later 105 human CD34+ umbilical cord blood-derived HSC (Stem Cell Technologies/Allcells) in 100 μl phosphate-buffered saline (PBS) | Full Paper |
2020 | Ghelani, A;Bates, D;Conner, K;Wu, MZ;Lu, J;Hu, YL;Li, CM;Chaudhry, A;Sohn, SJ; | Defining the Threshold IL-2 Signal Required for Induction of Selective Treg Cell Responses Using Engineered IL-2 Muteins | Frontiers in immunology | 32582190 | CD8+ T cells were purified from PBMCs isolated from healthy human donor derived leukopaks (AllCells) using EasySep CD8+ T cell Negative selection kit (STEMCELL Technologies) Save | Full Paper |
2020 | Shen, S;Sckisel, G;Sahoo, A;Lalani, A;Otter, DD;Pearson, J;DeVoss, J;Cheng, J;Casey, SC;Case, R;Yang, M;Low, R;Daris, M;Fan, B;Agrawal, NJ;Ali, K; | Engineered IL-21 Cytokine Muteins Fused to Anti-PD-1 Antibodies Can Improve CD8+ T Cell Function and Anti-tumor Immunity | Frontiers in immunology | 32457754 | Mismatched donor pair leukopaks were obtained from AllCells Inc., Donor's T cells were isolated using Pan T-cell Isolation Kit (Miltenyi Biotec, # 130-096-535) and a mismatched donor' Save | Full Paper |
2020 | Porcellini, S;Asperti, C;Corna, S;Cicoria, E;Valtolina, V;Stornaiuolo, A;Valentinis, B;Bordignon, C;Traversari, C; | CAR T Cells Redirected to CD44v6 Control Tumor Growth in Lung and Ovary Adenocarcinoma Bearing Mice | Frontiers in immunology | 32117253 | in of the ΔLNGFr (12). Generation of CD44v6 and CD19 CAR T Cells Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats or leukapheresis of healthy donors (San Raffaele Hospital; AllCells) by density gradient centrifugation (Lymph | Full Paper |
2020 | Baslan, T;Kendall, J;Volyanskyy, K;McNamara, K;Cox, H;D'Italia, S;Ambrosio, F;Riggs, M;Rodgers, L;Leotta, A;Song, J;Mao, Y;Wu, J;Shah, R;Gularte-Mérida, R;Chadalavada, K;Nanjangud, G;Varadan, V;Gordon, A;Curtis, C;Krasnitz, A;Dimitrova, N;Harris, L;Wigler, M;Hicks, J; | Novel insights into breast cancer copy number genetic heterogeneity revealed by single-cell genome sequencing | eLife | 32401198 | ta (i.e. ploidy) to achieve absolute copy number values. T-cell and B-cell sample processing and analysis Purified CD8+/CD4+ T-cells and CD19+/CD27+ memory B-cells purified cells were purchased from ALLCELLS (California, USA). Cells were thawed on i | Full Paper |
2020 | Münchow, EA;da Silva, AF;Piva, E;Cuevas-Suárez, CE;de Albuquerque, MTP;Pinal, R;Gregory, RL;Breschi, L;Bottino, MC; | Development of an antibacterial and anti-metalloproteinase dental adhesive for long-lasting resin composite restorations | Journal of materials chemistry. B | 33169763 | Human dental pulp stem cells (hDPSCs, AllCells, LLC, Alameda, CA, USA) obtained from permanent third molars were cultured in low glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Invitrogen Corporation, Grand Island, NY, USA) supplemented with | Full Paper |
2020 | Warnecke, A;Harre, J;Staecker, H;Prenzler, N;Strunk, D;Couillard-Despres, S;Romanelli, P;Hollerweger, J;Lassacher, T;Auer, D;Pachler, K;Wietzorrek, G;Köhl, U;Lenarz, T;Schallmoser, K;Laner-Plamberger, S;Falk, CS;Rohde, E;Gimona, M; | Extracellular vesicles from human multipotent stromal cells protect against hearing loss after noise trauma in vivo | Clinical and translational medicine | 33377658 | Human bone marrow (BM)-derived MSCs for the production of research-grade EV preparations were purchased from AllCells (Alameda, CA). Immunophenotype and viability analysis of Save | Full Paper |
2020 | Pinho, AC;Fonseca, AC;Caseiro, AR;Pedrosa, SS;Amorim, I;Branquinho, MV;Domingos, M;Maurício, AC;Santos, JD;Serra, AC;Coelho, JFJ; | Innovative tailor made dextran based membranes with excellent non-inflammatory response: In vivo assessment | Materials science & engineering. C, Materials for biological applications | 31761159 | Human dental pulp stem cells (hDPSCs) were obtained from AllCells, LLC (Cat. DP0037F, Lot No. DPSC090411-01). Minimum Essential Medium (MEM) α, GlutaMAX™ Supplement, no nucleosides, Streptomycin, Amphotericin B and HEPES buffer solution were purchase | Full Paper |
2020 | Wang, J;Ganaie, SS;Cheng, F;Xu, P;Ning, K;Wang, X;Kleiboeker, S;Cheng, S;Qiu, J; | RNA Binding Motif Protein RBM45 Regulates Expression of the 11-Kilodalton Protein of Parvovirus B19 through Binding to Novel Intron Splicing Enhancers | mBio | 32156816 | se conditions are dependent on RBM45. MATERIALS AND METHODS Ethics statement. Primary CD34+ hematopoietic stem cells were isolated from bone marrow of healthy human donors. We purchased the cells at AllCells (AllCells LLC, Alameda, CA). All of the c | Full Paper |
2020 | Dubrovsky, L;Ward, A;Choi, SH;Pushkarsky, T;Brichacek, B;Vanpouille, C;Adzhubei, AA;Mukhamedova, N;Sviridov, D;Margolis, L;Jones, RB;Miller, YI;Bukrinsky, M; | Inhibition of HIV Replication by Apolipoprotein A-I Binding Protein Targeting the Lipid Rafts | mBio | 31964734 | PBMCs from donors with the following HLA-B genotypes were purchased from AllCells Inc.: B*35 positive (B*15:17:01/B*35:01:01, B*35:01:01/B*55:01:01, B*35:01:01/B*35:01:01, B*35: Save | Full Paper |
2020 | Han, KH;Arlian, BM;Lin, CW;Jin, HY;Kang, GH;Lee, S;Lee, PC;Lerner, RA; | Agonist Antibody Converts Stem Cells into Migrating Brown Adipocyte-Like Cells in Heart | Cells | 31968623 | one, Chicago, IL, USA) and 1% penicillin and streptomycin (Invitrogen, Carlsbad, CA, USA). Expi293F cells were cultured in Expi293 Expression Media (Invitrogen, Carlsbad, CA, USA). Human CD34+ cells (AllCells, Alameda, CA, USA) were purchased and rep | Full Paper |
2020 | Zimran, E;Papa, L;Djedaini, M;Patel, A;Iancu-Rubin, C;Hoffman, R; | Expansion and preservation of the functional activity of adult hematopoietic stem cells cultured ex vivo with a histone deacetylase inhibitor | Stem cells translational medicine | 31950644 | Cryopreserved CD34+ cells from mPB or ABM from healthy adult donors were purchased from AllCells (Alameda, California) and stored in liquid nitrogen. The highly purified (90%-98% Save | Full Paper |
2020 | George, MJ;Prabhakara, K;Toledano-Furman, NE;Gill, BS;Wade, CE;Cotton, BA;Cap, AP;Olson, SD;Cox, CS; | Procoagulant in vitro effects of clinical cellular therapeutics in a severely injured trauma population | Stem cells translational medicine | 31903737 | Bone marrow mononuclear cells (BM MNCs) were isolated from fresh whole bone marrow from a commercial source (AllCells, Emeryville, California) according to common protocols Save | Full Paper |
2020 | Hou, L;Voit, RA;Sankaran, VG;Springer, TA;Yuki, K; | CD11c regulates hematopoietic stem and progenitor cells under stress | Blood advances | 33351105 | Human bone marrow cells and whole blood were purchased from AllCells (Quincy, MA). Lineage marker for human hematopoietic system includes: anti-hCD2 (RPA-2.10), anti-hCD3 ( Save | Full Paper |
2020 | Mascarenhas, JO;Rampal, RK;Kosiorek, HE;Bhave, R;Hexner, E;Wang, ES;Gerds, A;Abboud, CN;Kremyanskaya, M;Berenzon, D;Odenike, O;Farnoud, N;Krishnan, A;Weinberg, RS;McGovern, E;Salama, ME;Najfeld, V;Medina-Martinez, JS;Arango Ossa, JE;Levine, MF;Zhou, Y;Sandy, L;Heaney, ML;Levine, RL;Mesa, RA;Dueck, AC;Hoffman, R; | Phase 2 study of ruxolitinib and decitabine in patients with myeloproliferative neoplasm in accelerated and blast phase | Blood advances | 33104796 | Six control plasma samples (3 male, 3 female) collected from healthy donors between the ages of 30 and 50 years were procured from Allcells. Samples from 8 chronic-phase MF Save | Full Paper |
2020 | Marion, W;Boettcher, S;Ruiz-Torres, S;Lummertz da Rocha, E;Lundin, V;Morris, V;Chou, S;Zhao, AM;Kubaczka, C;Aumais, O;Zhang, Y;Shimamura, A;Schlaeger, TM;North, TE;Ebert, BL;Wells, SI;Daley, GQ;Rowe, RG; | An induced pluripotent stem cell model of Fanconi anemia reveals mechanisms of p53-driven progenitor cell differentiation | Blood advances | 33002135 | Institutional Review Board at Boston Children’s Hospital, after informed consent was obtained. This study was performed in accordance with the Declaration of Helsinki. Normal healthy BM mononuclear cells were purchased from AllCells | Full Paper |
2020 | Goldstein, RL;Goyos, A;Li, CM;Deegen, P;Bogner, P;Sternjak, A;Thomas, O;Klinger, M;Wahl, J;Friedrich, M;Rattel, B;Lamas, E;Min, X;Sudom, A;Farshbaf, M;Coxon, A;Balazs, M;Arvedson, T; | AMG 701 induces cytotoxicity of multiple myeloma cells and depletes plasma cells in cynomolgus monkeys | Blood advances | 32886754 | For staining of human PCs, human BM (AllCells) was stained with a fluorochrome-labeled antibody cocktail (supplemental Table 5). For analysis, doublets were gated out, and dead Save | Full Paper |
2020 | Walker, ZJ;VanWyngarden, MJ;Stevens, BM;Abbott, D;Hammes, A;Langouët-Astrie, C;Smith, CA;Palmer, BE;Forsberg, PA;Mark, TM;Jordan, CT;Sherbenou, DW; | Measurement of ex vivo resistance to proteasome inhibitors, IMiDs, and daratumumab during multiple myeloma progression | Blood advances | 32311014 | Normal donor samples were purchased from AllCells. For viability comparison with MM cells in MNC cultures, selection for CD138-positive cells was performed by using magnetic bead Save | Full Paper |
2020 | Romero-Masters, JC;Huebner, SM;Ohashi, M;Bristol, JA;Benner, BE;Barlow, EA;Turk, GL;Nelson, SE;Baiu, DC;Van Sciver, N;Ranheim, EA;Gumperz, J;Sherer, NM;Farrell, PJ;Johannsen, EC;Kenney, SC; | B cells infected with Type 2 Epstein-Barr virus (EBV) have increased NFATc1/NFATc2 activity and enhanced lytic gene expression in comparison to Type 1 EBV infection | PLoS pathogens | 32059024 | ized NSG mice Immunodeficient NSG (NOD/LtSz-scid/IL2Rγnull) mice were purchased from Jackson labs (catalogue number: 005557). Commercially available CD34-depleted human cord blood mononuclear cells (AllCells, LLC) were infected with various amounts o | Full Paper |
2020 | Shao, S;Qin, T;Qian, W;Li, X;Li, W;Han, L;Zhang, D;Wang, Z;Ma, Q;Wu, Z;Wu, E;Lei, J; | Cav-1 Ablation in Pancreatic Stellate Cells Promotes Pancreatic Cancer Growth through Nrf2-Induced shh Signaling | Oxidative medicine and cellular longevity | 32377291 | iated Hospital of Xi'an Jiaotong University, China. 2.3. Cell Lines Aspc-1 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), and HUVECs were obtained from ALLCELLS (Emeryville, California, USA). In our exp | Full Paper |
2020 | Liu, H;Cheng, Q;Xu, DS;Wang, W;Fang, Z;Xue, DD;Zheng, Y;Chang, AH;Lei, YJ; | Overexpression of CXCR7 accelerates tumor growth and metastasis of lung cancer cells | Respiratory research | 33129326 | Human umbilical vein endothelial cells (HUVECs) and its completed medium were obtained from AllCells biological technology (Shanghai) co., LTD. And all these cell lines were Save | Full Paper |
2020 | Cheng, B;Ren, Y;Cao, H;Chen, J; | Discovery of novel resorcinol diphenyl ether-based PROTAC-like molecules as dual inhibitors and degraders of PD-L1 | European journal of medicinal chemistry | 32388281 | CD3 single chain variable fragment) and human PD-L1 (hPD-L1). Fresh PBMCs were purchased from ALLCELLS. Centrifuge at 350g for 10 min, discard the supernatant and resuspend in EasySep buffer at a density of 5 x107/mL. CD3+ T cells were isolated from | Full Paper |
2020 | Zhang, D;Qi, BY;Zhu, WW;Huang, X;Wang, XZ; | Crocin alleviates lipopolysaccharide-induced acute respiratory distress syndrome by protecting against glycocalyx damage and suppressing inflammatory signaling pathways | Inflammation research : official journal of the European Histamine Research Society ... [et al.] | 31925528 | HUVECs were cultured in complete culture medium (AllCells, Shanghai, China) in an incubator with a humidified atmosphere of 95% air and 5% CO 2 at 37 C. Cells at 80-90% Save | Full Paper |
2020 | Kuang, Z;Jing, H;Wu, Z;Wang, J;Li, Y;Ni, H;Zhang, P;Wu, W;Wu, M;Zhou, S;Qiu, X;Wu, D;Prinz, B;Baruah, H;Chen, B;Yu, M;Liu, J; | Development and characterization of a novel anti-OX40 antibody for potent immune activation | Cancer immunology, immunotherapy : CII | 32078015 | Two million LoVo cells suspended in 0.2 ml PBS were mixed with 0.66 million human peripheral blood mononuclear cells (PBMCs, ALLCELLS) and co-implanted subcutaneously in the Save | Full Paper |
2020 | Yao, Y;Yang, J;Qin, Q;Tang, C;Li, Z;Chen, L;Li, K;Ren, C;Chen, L;Rao, S; | Functional annotation of genetic associations by transcriptome-wide association analysis provides insights into neutrophil development regulation | Communications biology | 33340029 | Human CD34 + HSPCs from mobilized peripheral blood of deidentified healthy donors were purchased from AllCells. CD34 + HSPCs were cultured in StemSpan SFEM medium ( Save | Full Paper |
2020 | Mendes, LP;Rostamizadeh, K;Gollomp, K;Myerson, JW;Marcos-Contreras, OA;Zamora, M;Luther, E;Brenner, JS;Filipczak, N;Li, X;Torchilin, VP; | Monoclonal antibody 2C5 specifically targets neutrophil extracellular traps | mAbs | 33323006 | Whole blood was purchased from AllCells (AllCells utilizes standardized operating HIPAA compliance and approved protocols are followed by AllCells' collection facilities. The staff Save | Full Paper |
2020 | Zang, L;Song, Y;Yu, F;Liu, X; | Emodin relieved lipopolysaccharide-evoked inflammatory damage in WI-38 cells by up-regulating taurine up-regulated gene 1 | BioFactors (Oxford, England) | 31912578 | The human fibroblasts cell line WI-38 (AllCells, Shanghai, China) was hatched in a mixture of Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand Island, NY), endothelial cell development supplement (Sigma, St. Louis, MO) (60 μg/ml), streptomycin | Full Paper |
2020 | Subhi, H;Husein, A;Mohamad, D;Nurul, A; | Physicochemical, mechanical and cytotoxicity evaluation of chitosan-based accelerated portland cement | Journal of Materials Research and Technology | Stem cells from human exfoliated deciduous teeth (SHED) was purchased from AllCells, USA. The cells were cultured in alpha minimum essential medium [Invitrogen, USA (GIBCO)] Save | Full Paper | |
2020 | Hu, S;Cavanagh, BL;Harrington, R;Ahmad, M;Kearns, G;Meaney, S;Wynne, C; | A Novel Pool of Microparticle Cholesterol Is Elevated in Rheumatoid Arthritis but Not in Systemic Lupus Erythematosus Patients | International journal of molecular sciences | 33287382 | Microparticles are sub-micron, membrane-bound particles released from virtually allcells and which are present in the circulation. In several autoimmune disorders their amountand Save | Full Paper |
2020 | Wen, W;Song, S;Han, Y;Chen, H;Liu, X;Qian, Q; | An efficient Screening System in Yeast to Select a Hyperactive piggyBac Transposase for Mammalian Applications | International journal of molecular sciences | 32357554 | fied eagle medium (DMEM; Corning, Corning, NY, USA) supplemented with 10% fetal calf serum (FBS, Gibco, USA). The human peripheral blood mononuclear cells (PBMC) of healthy donors were purchased from AllCells (AllCells, Silicon Valley, CA, USA) under | Full Paper |
2020 | Damodharan, SN;Walker, KL;Forsberg, MH;McDowell, KA;Bouchlaka, MN;Drier, DA;Sondel, PM;DeSantes, KB;Capitini, CM; | Analysis of ex vivo expanded and activated clinical-grade human NK cells after cryopreservation | Cytotherapy | 32536506 | All cellular expansions occurred at the WBF under current Good Manufacturing Practice (GMP) quality system guidelines. Fresh leukopacks were commercially obtained (AllCells, Alameda, CA, USA, and Key Biologics, Memphis, TN, USA) from paid human apher | Full Paper |
2020 | Chen, Q;Jia, G;Zhao, X;Bao, Y;Zhang, Y;Ozkan, C;Minev, B;Ma, W; | Novel Survivin Peptides Screened With Computer Algorithm Induce Cytotoxic T Lymphocytes With Higher Cytotoxic Efficiency to Cancer Cells | Frontiers in molecular biosciences | 33102521 | PBMCs from five healthy donors were provided by San Diego Blood Bank and Scripps Green Hospital (San Diego, CA, United States). Normal human umbilical cord blood (UCB) CD34+ cells were purchased from AllCells (Alameda, CA, United States). This study | Full Paper |
2020 | Papa, L;Djedaini, M;Martin, TC;Zangui, M;Beaumont, KG;Sebra, R;Parsons, R;Schaniel, C;Hoffman, R; | Limited Mitochondrial Activity Coupled With Strong Expression of CD34, CD90 and EPCR Determines the Functional Fitness of ex vivo Expanded Human Hematopoietic Stem Cells | Frontiers in cell and developmental biology | 33384995 | Cryopreserved CD34 + cells from G-CSF mobilized peripheral blood (PB) or bone marrow (BM) aspirates harvested from healthy adult donors were purchased from AllCells. Save | Full Paper |
2020 | Yao, X;Xie, L;Zeng, Y; | MiR-9 Promotes Angiogenesis via Targeting on Sphingosine-1- Phosphate Receptor 1 | Frontiers in cell and developmental biology | 32850858 | and S1P3 in those normal ECs and tumor ECs were compared. The relationships between the significant differentially expressed miR-9 loci and specific S1P receptors were analyzed. Cell Culture HUVECs (Allcells, Shanghai, China) were cultured in HUVEC | Full Paper |
2020 | Juillerat, A;Tkach, D;Yang, M;Boyne, A;Valton, J;Poirot, L;Duchateau, P; | Straightforward Generation of Ultrapure Off-the-Shelf Allogeneic CAR-T Cells | Frontiers in bioengineering and biotechnology | 32671047 | ndependent T-cell donors. Significance is determined by a standard unpaired t-test, *p ≤ 0.05, **p ≤ 0.01. Materials and Methods T-Cell Proliferation Cryopreserved human PBMCs were acquired from ALLCELLS (cat #PB006F) and used in accordance with Cel | Full Paper |
2020 | Kuang, Z;Pu, P;Wu, M;Wu, Z;Wang, L;Li, Y;Zhang, S;Jing, H;Wu, W;Chen, B;Liu, J; | A Novel Bispecific Antibody with PD-L1-assisted OX40 Activation for Cancer Treatment | Molecular cancer therapeutics | 32999045 | Monocyte-derived immature dendrite cells (DC) isolated from human PBMCs (ALLCELLS) were maintained in AIM V medium CTS medium supplemented with GM-CSF (10 ng/mL, R&D Save | Full Paper |
2020 | Kotanides, H;Sattler, RM;Lebron, MB;Carpenito, C;Shen, J;Li, J;Surguladze, D;Haidar, JN;Burns, C;Shen, L;Inigo, I;Pennello, AL;Forest, A;Chen, X;Chin, D;Sonyi, A;Topper, M;Boucher, L;Sharma, P;Zhang, Y;Burtrum, D;Novosiadly, RD;Ludwig, DL;Plowman, GD;Kalos, M; | Characterization of 7A5: A Human CD137 (4-1BB) Receptor Binding Monoclonal Antibody with Differential Agonist Properties That Promotes Antitumor Immunity | Molecular cancer therapeutics | 32241872 | Human PBMCs were isolated from whole blood or leukopak obtained from NY Blood Center, AllCells, or Biological Specialty using Ficoll density gradient centrifugation (Ficoll-Paque Save | Full Paper |
2020 | Bian, W;Jing, X;Yang, Z;Shi, Z;Chen, R;Xu, A;Wang, N;Jiang, J;Yang, C;Zhang, D;Li, L;Wang, H;Wang, J;Sun, Y;Zhang, C; | Downregulation of LncRNA NORAD promotes Ox-LDL-induced vascular endothelial cell injury and atherosclerosis | Aging | 32267831 | (Shanghai, China). The C57BL/6 J mice fed with a normal diet were labeled as the WT control group. Cell culture, RNA interference and Adenovirus infection Primary HUVECs were obtained from Shanghai AllCells Biotech Co., Ltd. (Shanghai, China) and cu | Full Paper |
2020 | Karuna, R;Yokokawa, F;Wang, K;Zhang, J;Xu, H;Wang, G;Ding, M;Chan, WL;Abdul Ghafar, N;Leonardi, A;Seh, CC;Seah, PG;Liu, W;Srinivasa, RPS;Lim, SP;Lakshminarayana, SB;Growcott, E;Babu, S;Fenaux, M;Zhong, W;Gu, F;Shi, PY;Blasco, F;Chen, YL; | A Cyclic Phosphoramidate Prodrug of 2'-Deoxy-2'-Fluoro-2'-C-Methylguanosine for the Treatment of Dengue Virus Infection | Antimicrobial agents and chemotherapy | 32958712 | PBMCs (individual donors) were purchased from AllCells (Alameda, CA) or ReachBio (Seattle, WA). Written consent from the donors was available for all samples. All experiments involving human matrices were approved by the Institutional Review Board of | Full Paper |
2020 | Sebrow, J;Goff, SP;Griffin, DO; | Successfully transfected primary peripherally mobilized human CD34+ hematopoietic stem and progenitor cells (HSPCs) demonstrate increased susceptibility to retroviral infection | Virology journal | 32039735 | We obtained 293 T cells and Jurkat cells from ATCC, and peripherally mobilized CD34+ HSPCs from individual donors from AllCells (pre-isolated). 293 T cells were cultured in 20 mm X Save | Full Paper |
2020 | Zhong, C;Yu, Q;Jia, W;Yu, X;Yu, D;Yang, M;Wang, L;Ling, C;Zhu, L; | Mechanism for enhanced transduction of hematopoietic cells by recombinant adeno-associated virus serotype 6 vectors | FASEB journal : official publication of the Federation of American Societies for Experimental Biology | 32960474 | Primary human cord blood-derived CD34 + hematopoietic progenitors (mixed, 80% purity) were purchased from AllCells (Alameda, CA, USA) and cultured in C-IMDM in the presence of 1 ng/mL of recombinant human stem cell factor (rhSCF, BD Bioscience, San D | Full Paper |
2020 | Li, L;Wu, Z;Wu, M;Qiu, X;Wu, Y;Kuang, Z;Wang, L;Sun, T;Liu, Y;Yi, S;Jing, H;Zhou, S;Chen, B;Wu, D;Wu, W;Liu, J; | IBI112, a selective anti-IL23p19 monoclonal antibody, displays high efficacy in IL-23-induced psoriasiform dermatitis | International immunopharmacology | 33069927 | Mouse (C57BL/6, Beijing Vital River Laboratory Animal Technology) or cynomolgus monkey splenocytes (AllCells, USA) were cultured in the presence of IL-2 (R&D, USA). Different Save | Full Paper |
2020 | Kaneko, Y;Fukahori, H;Yamagami, K;Kawashima, T;Ito, M;Akamatsu, M;Marui, T;Kato, K;Takahashi, F;Morokata, T; | Effects of AS2819899, a novel selective PI3Kδ inhibitor, in a NZB/W F1 mouse lupus-like nephritis model | International immunopharmacology | 32736191 | Peripheral blood-derived frozen normal pan-T cells (AllCells, Alameda, CA, USA) were thawed according to the manufacturer’s instructions. The cell suspension (1 × 105 cells/well) was mixed with AS2819899 at designated concentrations in the anti-CD3 a | Full Paper |
2020 | Goydel, RS;Weber, J;Peng, H;Qi, J;Soden, J;Freeth, J;Park, H;Rader, C; | Affinity maturation, humanization, and co-crystallization of a rabbit anti-human ROR2 monoclonal antibody for therapeutic applications | The Journal of biological chemistry | 32193207 | Thr-245 and Ala-245, which arise from an SNP (rs10820900) in the frizzled domain of human ROR2 (hROR2-Fz). Human PBMCs were purchased from AllCells and cultured in X-VIVO 20 medium (Lonza) with 5% (v/v) off-the-clot human AB serum (Gemini Bio-Product | Full Paper |
2020 | Čuperlović-Culf, M;Khieu, NH;Surendra, A;Hewitt, M;Charlebois, C;Sandhu, JK; | Analysis and Simulation of Glioblastoma Cell Lines-Derived Extracellular Vesicles Metabolome | Metabolites | 32131411 | Normal human astrocytes (NHA, Lonza, Walkersville, MD, USA) were used as normal counterparts and were grown in astrocyte medium-containing supplements (Allcells) and 5% FBS. Save | Full Paper |
2020 | Liu, J;Kozhaya, L;Torres, VJ;Unutmaz, D;Lu, M; | Structure-based discovery of a small-molecule inhibitor of methicillin-resistant Staphylococcus aureus virulence | The Journal of biological chemistry | 32179646 | Blood samples were obtained from healthy, consenting donors as buffy coats (New York Blood Center) and leukopaks (AllCells, Alameda, CA). Human PBMCs were isolated from peripheral blood by density gradient centrifugation using Ficoll-Paque Plus (GE L | Full Paper |
2020 | Thwin, KKM;Ishida, T;Uemura, S;Yamamoto, N;Lin, KS;Tamura, A;Kozaki, A;Saito, A;Kishimoto, K;Mori, T;Hasegawa, D;Kosaka, Y;Nino, N;Takafuji, S;Iijima, K;Nishimura, N; | Level of Seven Neuroblastoma-Associated mRNAs Detected by Droplet Digital PCR Is Associated with Tumor Relapse/Regrowth of High-Risk Neuroblastoma Patients | The Journal of molecular diagnostics : JMD | 31837427 | 1 sample from BioChain (Newark, CA), 2 samples from STEMCELL (Vancouver, Canada), 56 samples from AllCells (Alameda, CA), 16 samples from ReachBio (Seattle, WA), and 28 samples from Loza (Walkersville, MD) (Supplemental Table S1). All PB samples from | Full Paper |
2020 | Xue, WL;Chen, RQ;Zhang, QQ;Li, XH;Cao, L;Li, MY;Li, Y;Lin, G;Chen, Y;Wang, MJ;Zhu, YC; | Hydrogen sulfide rescues high glucose-induced migration dysfunction in HUVECs by upregulating miR-126-3p | American journal of physiology. Cell physiology | 32186933 | Primary human umbilical vein endothelial cells (HUVECs) were purchased from Allcells (Shanghai, China) (35). These HUVECs were cultured in endothelial complete medium (Allcells, Save | Full Paper |
2020 | Satani, N;Giridhar, K;Cai, C;Wewior, N;Norris, DD;Aronowski, J;Savitz, SI; | Medications for Hypertension Change the Secretome Profile from Marrow Stromal Cells and Peripheral Blood Monocytes | Stem cells international | 32802081 | MSCs were isolated from commercially available fresh human bone marrow aspirates (AllCells, Alameda, CA) using density centrifugation and plastic adherence as previously Save | Full Paper |
2020 | Diaz, MF;Horton, PD;Dumbali, SP;Kumar, A;Livingston, M;Skibber, MA;Mohammadalipour, A;Gill, BS;Zhang, S;Cox, CS;Wenzel, PL; | Bone marrow stromal cell therapy improves survival after radiation injury but does not restore endogenous hematopoiesis | Scientific reports | 33335275 | t received wet feed on days 4-30 post-exposure. Culture of human MSCs Human MSCs used for cell therapy were derived from whole bone marrow from independent human donors (commercially obtained from AllCells, LLC, Alameda, CA). Cells were isolated and | Full Paper |
2020 | Dzimianski, JV;Lorig-Roach, N;O'Rourke, SM;Alexander, DL;Kimmey, JM;DuBois, RM; | Rapid and sensitive detection of SARS-CoV-2 antibodies by biolayer interferometry | Scientific reports | 33303951 | dy at UCSC. All participants agreed to sample banking and future research use. The convalescent seropositive (SP) panel comprised 10 de-identified plasma samples from nine individuals, purchased from AllCells (Alameda, CA, USA). To be eligible for pl | Full Paper |
2020 | Diaz, MF;Horton, PD;Kumar, A;Livingston, M;Mohammadalipour, A;Xue, H;Skibber, MA;Ewere, A;Toledano Furman, NE;Aroom, KR;Zhang, S;Gill, BS;Cox, CS;Wenzel, PL; | Injury intensifies T cell mediated graft-versus-host disease in a humanized model of traumatic brain injury | Scientific reports | 32612177 | Bone marrow stromal cells were derived from whole bone marrow from independent human donors (AllCells, Alameda, CA). Mononuclear cells from whole bone marrow were enriched Save | Full Paper |
2020 | Allen, A;Vaninov, N;Li, M;Nguyen, S;Singh, M;Igo, P;Tilles, AW;O'Rourke, B;Miller, BLK;Parekkadan, B;Barcia, RN; | Mesenchymal Stromal Cell Bioreactor for Ex Vivo Reprogramming of Human Immune Cells | Scientific reports | 32576889 | ld times cover the range of expected delivery of the device from cell seeding location to clinical application. PBMC isolation and enrichment Peripheral blood mononuclear cells (PBMCs) obtained from AllCells LLC (AllCells, CA, USA) were freshly isol | Full Paper |
2020 | Siew Ching, H;Thirumulu Ponnuraj, K;Luddin, N;Ab Rahman, I;Nik Abdul Ghani, NR; | Early Odontogenic Differentiation of Dental Pulp Stem Cells Treated with Nanohydroxyapatite-Silica-Glass Ionomer Cement | Polymers | 32957636 | the present study was principally aimed at evaluating the effect of nanoHA-silica-GIC on the differentiation of DPSCs into odontogenic lineage. 2. Materials and Methods 2.1. Cell Culture DPSCs (AllCells, Alameda, CA, USA; Cat no. DP003F) were grown | Full Paper |
2020 | Keskar, V;Sood, A;Loghin, E;Kovacs, E;Duthie, RS;Liu, S;Park, JH;Chadwick, C;Smith, R;Brown, M;Stroncek, DF;Highfill, SL; | Novel DNA-based T-Cell Activator Promotes Rapid T-Cell Activation and Expansion | Journal of immunotherapy (Hagerstown, Md. : 1997) | 32796275 | Activation studies were conducted in 6-well tissue culture plastic plates using commercially available Pan T cells (AllCells, Alameda, CA). Cultures were diluted as needed (1:3 or 1:4) to Save | Full Paper |
2020 | Shrestha, B;Zhang, Y;Yu, B;Li, G;Boucher, JC;Beatty, NJ;Tsai, HC;Wang, X;Mishra, A;Sweet, K;Lancet, JE;Kelley, L;Davila, ML; | Generation of Antitumor T Cells For Adoptive Cell Therapy With Artificial Antigen Presenting Cells | Journal of immunotherapy (Hagerstown, Md. : 1997) | 31834208 | To investigate the ability of aAPCs to support T-cell expansion we isolated T cells from healthy donor PBMCs (ALLcells) using a Human T-cell isolation Kit (Stem Cells Inc., Cambridge, Save | Full Paper |
2020 | Park, LM;Lannigan, J;Jaimes, MC; | OMIP-069: Forty-Color Full Spectrum Flow Cytometry Panel for Deep Immunophenotyping of Major Cell Subsets in Human Peripheral Blood | Cytometry. Part A : the journal of the International Society for Analytical Cytology | 32830910 | All human PBMCs used in this study were obtained from AllCells Alameda. Ethical review and regulatory compliance were conducted by Alpha Independent Review Board under Save | Full Paper |
2020 | Nair, RR;Piktel, D;Hathaway, QA;Rellick, SL;Thomas, P;Saralkar, P;Martin, KH;Geldenhuys, WJ;Hollander, JM;Gibson, LF; | Pyrvinium Pamoate Use in a B cell Acute Lymphoblastic Leukemia Model of the Bone Tumor Microenvironment | Pharmaceutical research | 31989336 | Primary CD3+ T cells, peripheral blood mononuclear cells (PBMC) and bone marrow mononuclear cells (BMMC) were purchased from AllCells (Allcells.com) and maintained in Lymphocyte Growth Medium-3 (Lonza, Cat No: CC-3211) containing 10% FBS and 1x strep | Full Paper |
2020 | Powell, AB;Ren, Y;Korom, M;Saunders, D;Hanley, PJ;Goldstein, H;Nixon, DF;Bollard, CM;Lynch, RM;Jones, RB;Cruz, CRY; | Engineered Antigen-Specific T Cells Secreting Broadly Neutralizing Antibodies: Combining Innate and Adaptive Immune Response against HIV | Molecular therapy. Methods & clinical development | 33005704 | Peripheral blood samples were obtained from deidentified, healthy donor buffy coats from the NIH, through the Department of Transfusion Medicine, or commercially from AllCells. Save;erved. Peripheral Blood Samples Peripheral blood samples were obt | Full Paper |
2020 | Fang, Y;Zhang, Y;Guo, C;Chen, C;Gao, H;Zhou, X;Liu, T;Qian, Q; | Safety and Efficacy of an Immune Cell-Specific Chimeric Promoter in Regulating Anti-PD-1 Antibody Expression in CAR T Cells | Molecular therapy. Methods & clinical development | 32995356 | PBMCs were purchased from AllCells (USA) using a protocol approved by the Ethics Committee of the Chinese Peoples' Liberation Army General Hospital (S2019-063-01). In total, 5 × Save;Cell Isolation, Electroporation, and Ex Vivo CAR T Cell Expansion | Full Paper |
2020 | Shapiro, J;Iancu, O;Jacobi, AM;McNeill, MS;Turk, R;Rettig, GR;Amit, I;Tovin-Recht, A;Yakhini, Z;Behlke, MA;Hendel, A; | Increasing CRISPR Efficiency and Measuring Its Specificity in HSPCs Using a Clinically Relevant System | Molecular therapy. Methods & clinical development | 32478125 | (5 μL total volume). Complexes were allowed to form for 10-20 min at room temperature before electroporation. Genome Editing by RNP Electroporation in CD34+ HSPCs Mobilized human CD34+ HSPCs (AllCells, Alameda, CA, USA) were thawed and cultured for | Full Paper |
2020 | Morgan, RA;Ma, F;Unti, MJ;Brown, D;Ayoub, PG;Tam, C;Lathrop, L;Aleshe, B;Kurita, R;Nakamura, Y;Senadheera, S;Wong, RL;Hollis, RP;Pellegrini, M;Kohn, DB; | Creating New β-Globin-Expressing Lentiviral Vectors by High-Resolution Mapping of Locus Control Region Enhancer Sequences | Molecular therapy. Methods & clinical development | 32426415 | BM CD34+ Cell Culture and Transduction All BM aspirates were obtained from voluntary healthy donors supplied by AllCells (Alameda, CA, USA). BM mononuclear cells were isolated Save | Full Paper |
2020 | Mehler, VJ;Burns, CJ;Stauss, H;Francis, RJ;Moore, ML; | Human iPSC-Derived Neural Crest Stem Cells Exhibit Low Immunogenicity | Molecular therapy. Methods & clinical development | 32055644 | utamine, 2 mM L-glutamine, 50 U/mL penicillin/streptomycin, 20 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF), and 20 ng/mL IL-4. BM-MSCs were derived from bone marrow aspirates (AllCells, Alameda, CA, USA) in-house as previously des | Full Paper |
2020 | Elnaggar, M;Al-Mohannadi, A;Kizhakayil, D;Raynaud, CM;Al-Mannai, S;Gentilcore, G;Pavlovski, I;Sathappan, A;Van Panhuys, N;Borsotti, C;Follenzi, A;Grivel, JC;Deola, S; | Flow-Cytometry Platform for Intracellular Detection of FVIII in Blood Cells: A New Tool to Assess Gene Therapy Efficiency for Hemophilia A | Molecular therapy. Methods & clinical development | 31886317 | ar endothelial cells) and U937 (pre-monocytic cells) cell lines were kindly provided by Antonia Follenzi (UPO, Italy). HeLa (cervical cancer cells) were purchased from ATCC. PBMCs were purchased from AllCells (Alameda, CA, USA). Cells were cultured i | Full Paper |
2020 | Ning, K;Wang, MJ;Lin, G;Zhang, YL;Li, MY;Yang, BF;Chen, Y;Huang, Y;Li, ZM;Huang, YJ;Zhu, L;Liang, K;Yu, B;Zhu, YZ;Zhu, YC; | eNOS-Nitric Oxide System Contributes to a Novel Antiatherogenic Effect of Leonurine via Inflammation Inhibition and Plaque Stabilization | The Journal of pharmacology and experimental therapeutics | 32238453 | Primary human umbilical vein endothelial cells (HUVECs) were purchased from Allcells (H-001F-C; China) and cultured in HUVEC Growth Medium (H-004; Allcells), and 100 U/ml of Save | Full Paper |
2020 | Zhaorigetu, S;Bair, H;Jin, D;Gupta, VS;Pandit, LM;Bryan, RM;Lally, KP;Olson, SD;Cox, CS;Harting, MT; | Extracellular Vesicles Attenuate Nitrofen-Mediated Human Pulmonary Artery Endothelial Dysfunction: Implications for Congenital Diaphragmatic Hernia | Stem cells and development | 32475301 | Human MSCs were isolated from commercially available fresh human bone marrow aspirates of a 34-year-old female (AllCells, Alameda, CA) using density centrifugation and plastic Save | Full Paper |
2020 | Baumgartner, JM;Riviere, P;Lanman, RB;Kelly, KJ;Veerapong, J;Lowy, AM;Kurzrock, R; | Prognostic Utility of Pre- and Postoperative Circulating Tumor DNA Liquid Biopsies in Patients with Peritoneal Metastases | Annals of surgical oncology | 32767050 | Background Circulating tumor DNA (ctDNA) is a promising technology for treatment selection, prognostication, and surveillance after definitive therapy. Its use in the perioperative Save | Full Paper |
2020 | Hamburger, AE;DiAndreth, B;Cui, J;Daris, ME;Munguia, ML;Deshmukh, K;Mock, JY;Asuelime, GE;Lim, ED;Kreke, MR;Tokatlian, T;Kamb, A; | Engineered T cells directed at tumors with defined allelic loss | Molecular immunology | 33012527 | Leukopaks were purchased from AllCells®. Collection protocols and donor informed consent were approved by an Institutional Review Board (IRB), with strict oversight. HIPAA compliance and approved protocols were also followed. Frozen PBMCs were thawed | Full Paper |
2020 | Xu, H;Hamburger, AE;Mock, JY;Wang, X;Martin, AD;Tokatlian, T;Oh, J;Daris, ME;Negri, KR;Gabrelow, GB;Wu, ML;Nampe, DP;Asuelime, GE;McElvain, ME;Sandberg, ML;Kamb, A; | Structure-function relationships of chimeric antigen receptors in acute T cell responses to antigen | Molecular immunology | 32768859 | Collection protocols and donor informed consent were approved by an Institutional Review Board (IRB) at Allcells . Allcells also followed HIPAA compliance and approved protocols Save | Full Paper |
2020 | Wang, Z;Zhou, G;Risu, N;Fu, J;Zou, Y;Tang, J;Li, L;Liu, H;Liu, Q;Zhu, X; | Lenalidomide Enhances CAR-T Cell Activity Against Solid Tumor Cells | Cell transplantation | 32967454 | line U251 CD133-OE luc. Similarly, the tumor cell line U251 WT luc, MDA-MB-453 luc, and MDA-MB-468 luc were also obtained by nucleofection. Peripheral blood mononuclear cells (PBMCs) were bought from ALLCELLS (PB005F, Alameda, CA, USA). Following the | Full Paper |
2020 | Zhao, C;Zhao, Z;Wang, Z;Hu, L;Wang, H;Fang, Z; | Supervillin promotes tumor angiogenesis in liver cancer | Oncology reports | 32468064 | Human umbilical vein endothelial cells (HUVECs) were purchased from AllCells LLC (cat. H-004; AllCells LLC) in a 0.25% gelatin-coated culture flask. HepG2, Bel7405 and MHCC- Save | Full Paper |
2020 | Lee, KS;Lee, J;Lee, P;Kim, CU;Kim, DJ;Jeong, YJ;Park, YJ;Tesh, VL;Lee, MS; | Exosomes released from Shiga toxin 2a-treated human macrophages modulate inflammatory responses and induce cell death in toxin receptor expressing human cells | Cellular microbiology | 32772454 | Human CD14 + monocytes were purchased from AllCells LLC and maintained in RPMI 1640 medium containing 10% FBS, 5.0 μg/ml streptomycin and 5.0 U/ml penicillin. Cells (1.0 × Save | Full Paper |
2020 | Monroe, MN;Zhaorigetu, S;Gupta, VS;Jin, D;Givan, KD;Curylo, AL;Olson, SD;Cox, CS;Segura, A;Buja, LM;Grande-Allen, KJ;Harting, MT; | Extracellular vesicles influence the pulmonary arterial extracellular matrix in congenital diaphragmatic hernia | Pediatric pulmonology | 32568428 | Human mesenchymal stromal cells (hMSCs) were isolated from commercially available fresh human bone marrow aspirates of a 34-year-old female (AllCells, Alameda, CA) using Save | Full Paper |
2020 | Zaw, SYM;Kaneko, T;Zaw, ZCT;Sone, PP;Murano, H;Gu, B;Okada, Y;Han, P;Katsube, KI;Okiji, T; | Crosstalk between dental pulp stem cells and endothelial cells augments angiogenic factor expression | Oral diseases | 32248596 | Stem cells from human exfoliated deciduous teeth (SHEDs; AllCells) were cultured with a stem cell growth medium (Dulbecco's modified Eagle's medium (DMEM)/F12; Gibco) containing 15% fetal bovine serum (Gibco-BRL, Grand Island, NY), 10,000 units penic | Full Paper |
2020 | Huang, GL;Nampe, DP;Yi, J;Gabrelow, GB;Negri, KR;Kamb, A;Xu, H; | A multivariate, quantitative assay that disentangles key kinetic parameters of primary human T cell function in vitro | PloS one | 33166305 | Collection protocols and donor informed consent were approved by an Institutional Review Board (IRB) at Allcells . Allcells also followed HIPAA compliance and approved protocols Save | Full Paper |
2020 | Wang, X;Chacon, LI;Derakhshandeh, R;Rodriguez, HJ;Han, DD;Kostyushev, DS;Henry, TD;Traverse, JH;Moyé, L;Simari, RD;Taylor, DA;Springer, ML; | Impaired therapeutic efficacy of bone marrow cells from post-myocardial infarction patients in the TIME and LateTIME clinical trials | PloS one | 32841277 | Healthy de-identified donor BM MNCs were purchased from AllCells (Alameda, CA). These MNCs were manually isolated at AllCells using Ficoll conditions like that in the Sepax Save | Full Paper |
2020 | Schönherz, AA;Bødker, JS;Schmitz, A;Brøndum, RF;Jakobsen, LH;Roug, AS;Severinsen, MT;El-Galaly, TC;Jensen, P;Johnsen, HE;Bøgsted, M;Dybkær, K; | Normal myeloid progenitor cell subset-associated gene signatures for acute myeloid leukaemia subtyping with prognostic impact | PloS one | 32324791 | [18] GSE42519, [19] GSE19599, [20] GSE17054, [21] and GSE19429 [22] cohorts. For GSE63270, [18] and GSE17054, [21] human bone marrow mononuclear cells (BMMCs) from healthy donors were purchased from ALLCELLS (Emeryville, CA) where collection protocol | Full Paper |
2020 | Tani, J;Ito, Y;Tatemichi, S;Yamakami, M;Fukui, T;Hatano, Y;Kakimoto, S;Kotani, A;Sugimura, A;Mihara, K;Yamamoto, R;Tanaka, N;Minami, K;Takahashi, K;Hirato, T; | Physicochemical and biological evaluation of JR-131 as a biosimilar to a long-acting erythropoiesis-stimulating agent darbepoetin alfa | PloS one | 32302352 | fects of the test substances on colony-forming unit-erythroid (CFU-E)- and burst-forming unit-erythroid (BFU-E)-derived colony formation in human bone-marrow-derived mononuclear cells (purchased from AllCells, CA) were examined. The cells were obtain | Full Paper |
2020 | Steinberg, L; | The Effects of P. Gingivalis Ceramide Lipids on Platelet Size, Agglutination, Aggregation, and Vascular Surface Adhesion Markers | Thesis | Background: Increased bleeding on probing has been proven to be correlated with the progression of periodontal disease. Gingival bleeding in sites with periodontitis has often been attributed to chronic inflammation. Previous research has documented | Full Paper | |
2020 | Kim, DH;Kim, DH;Heck, BE;Shaffer, M;Yoo, KH;Hur, J; | PPAR-δ agonist affects adipo-chondrogenic differentiation of human mesenchymal stem cells through the expression of PPAR-γ | Regenerative therapy | 33426208 | In this experimental study, frozen human bone marrow mononuclear cells were used for isolation (AllCells, Alameda, CA, USA) [25]. Cells were resuspended in α-minimum essential Save;mation condition and its correlation with PPAR-δ. 2 Methods 2.1 Is | Full Paper |
2020 | Zhang, E;Xie, L;Qin, P;Lu, L;Xu, Y;Gao, W;Wang, L;Xie, MH;Jiang, W;Liu, S; | Quality by Design-Based Assessment for Analytical Similarity of Adalimumab Biosimilar HLX03 to Humira® | The AAPS journal | 32385732 | PMBC cells (Allcells) were incubated with mAbs with a 2-fold serial dilution for 30 min followed by TNFα-Biotin (Sinobio) incubation. After labeled by Streptavidin-PE (eBioscience), Save | Full Paper |
2020 | Dai, R;Heid, B;Xu, X;Xie, H;Reilly, CM;Ahmed, SA; | EGR2 is elevated and positively regulates inflammatory IFNγ production in lupus CD4+ T cells | BMC immunology | 32646370 | ethods Human peripheral blood mononuclear cells (PBMCs) The PBMCs of human patients of lupus (n = 4, all female) and healthy controls (n = 4, 2 male and 2 female) were purchased directly from AllCells LLC (Alameda, CA, USA). Based on the information | Full Paper |
2020 | Dong, W;Zhang, X;Lu, Z; | Effect of 532nm photodynamic therapy with hemoporfin on the expression of vascular endothelial growth factor in cultured human vascular endothelial cells | Photodiagnosis and photodynamic therapy | 32344194 | Working drug solutions (0-8 μg/ml) were prepared by diluting the stock solution with RPMI-1640 medium (AllCells). A 532 nm neodymium-doped yttrium orthovanadate (Nd:YVO 4 ) Save | Full Paper |
2020 | Pieles, O;Reck, A;Reichert, TE;Morsczeck, C; | p53 inhibits the osteogenic differentiation but does not induce senescence in human dental follicle cells | Differentiation; research in biological diversity | 32473528 | Human dental follicle cells (DFCs) were obtained from AllCells. DFCs were cultivated as described previously (Morsczeck et al., 2016). Cells were analyzed before and after the Save | Full Paper |
2020 | Lafleur, MA;Werner, J;Fort, M;Lobenhofer, EK;Balazs, M;Goyos, A; | MRGPRX2 activation as a rapid, high-throughput mechanistic-based approach for detecting peptide-mediated human mast cell degranulation liabilities | Journal of immunotoxicology | 32525431 | Human mobilized peripheral blood CD34+ cells (derived from healthy donors treated with G-CSF to mobilize CD34+ progenitor cells from the bone marrow to the peripheral blood, then isolated using anti-CD34 magnetic beads) (#mPB016F, AllCells, Alameda, | Full Paper |
2020 | Yu, Z;Yin, S;Zhang, W;Jiang, X;Hu, J; | Picosecond laser texturing on titanium alloy for biomedical implants in cell proliferation and vascularization | Journal of biomedical materials research. Part B, Applied biomaterials | 31692202 | Human umbilical vein endothelial cells (HUVECs) were purchased from ALLCells Biological Technology Limited company and cultured at 1 × 105 on plates with Dulbecco's Modified Eagle's medium supplemented with 10% fetal bovine serum, 100 U/ml streptomyc | Full Paper |
2020 | Bhargav, A;Min, KS;Wen Feng, L;Fuh, JYH;Rosa, V; | Taguchi's methods to optimize the properties and bioactivity of 3D printed polycaprolactone/mineral trioxide aggregate scaffold: Theoretical predictions and experimental validation | Journal of biomedical materials research. Part B, Applied biomaterials | 31112004 | The use of human dental pulp stem cells (DPSC) from single donor (DPF003, Allcells, Alameda) was approved by NUS Institutional Review Board (Approval Number: NUS 2094). The characterization and expressions of CD34, CD73, CD90, CD105 are available els | Full Paper |
2020 | Al-Amoodi, AS;Sakashita, K;Ali, AJ;Zhou, R;Lee, JM;Tehseen, M;Li, M;Belmonte, JCI;Kusakabe, T;Merzaban, JS; | Using Eukaryotic Expression Systems to Generate Human α1,3-Fucosyltransferases That Effectively Create Selectin-Binding Glycans on Stem Cells | Biochemistry | 32901486 | leukemia cell line), THP1 (human acute monocytic leukemia), HL60 (human acute promyelocytic leukemia) (ATCC), and MSCs (primary mesenchymal stromal cells) (AllCells) were Save | Full Paper |
2020 | Behbehani, GK;Finck, R;Samusik, N;Sridhar, K;Fantl, WJ;Greenberg, PL;Nolan, GP; | Profiling myelodysplastic syndromes by mass cytometry demonstrates abnormal progenitor cell phenotype and differentiation | Cytometry. Part B, Clinical cytometry | 31917512 | in Table S2, with the risk‐based clinical status of MDS patients indicated by IPSS category and morphologic characteristics (Greenberg et al., 1997). Five healthy control samples were obtained from Allcells, Inc. using the same protocol. Normal bone | Full Paper |
2020 | Kim, DH;Kim, DH;Heck, BE;Shaffer, M;Hur, J;Yoo, KH; | A natural supplement formula reduces anti-oxidative stress and enhances osteo-chondrogenic differentiation potential in mesenchymal stem cells | Journal of clinical biochemistry and nutrition | 32523247 | rozen mononuclear cells from human bone marrow were purchased (AllCells, Emeryville, CA) and used to isolate human bone marrow-mesenchymal stem cells (hBM-MSCs). Briefly, thawed mononuclear cells were cultured in Dulbecco’s modified Eagle medium (DME | Full Paper |
2020 | Wang, P;Qin, W;Liu, T;Jiang, D;Cui, L;Liu, X;Fang, Y;Tang, X;Jin, H;Qian, Q; | PiggyBac-engineered T cells expressing a glypican-3-specific chimeric antigen receptor show potent activities against hepatocellular carcinoma | Immunobiology | 31522780 | Human peripheral blood mononuclear cells (PBMCs) from healthy donors were purchased from AllCells (AllCells, Silicon, USA). 5 × 106−1 × 107 PBMCs were electroporated with 6 μg of GPC3CAR plasmid or an equal quantity of MOCK plasmid in an electroporat | Full Paper |
2020 | Liu, H;Gemmell, L;Lin, R;Zuo, F;Balfour, HH;Woo, JC;Hayes, GM; | Development of an Improved Epstein-Barr Virus (EBV) Neutralizing Antibody Assay to Facilitate Development of a Prophylactic gp350-Subunit EBV Vaccine | Mediterranean journal of hematology and infectious diseases | 32180911 | Healthy human donor serum samples were purchased from AllCells, LLC and Bioreclamation, LLC (n=39). Samples were heated at 56 oC for 30 minutes to inactivate complement, and Save | Full Paper |
2020 | Chien, KS;Class, CA;Montalban-Bravo, G;Wei, Y;Sasaki, K;Naqvi, K;Ganan-Gomez, I;Yang, H;Soltysiak, KA;Kanagal-Shamanna, R;Do, KA;Kantarjian, HM;Garcia-Manero, G; | LILRB4 expression in chronic myelomonocytic leukemia and myelodysplastic syndrome based on response to hypomethylating agents | Leukemia & lymphoma | 32036728 | BM samples from healthy individuals were obtained from AllCells (Emeryville, CA, USA). CD34+ cells were isolated using the CD34 MicroBead Kit (Miltenyi Biotec, Bergisch Gladback, Save | Full Paper |
2020 | Wu, T; | The mean ± 1 SD was calculated for triplicate cultures. The laboratory (ReachBio LLC, Seattle, Washington) was blinded to the identify of the test compounds and docetaxel served as the positive control, with blank and vehicle as negative controls. | Thesis | The surviving mice of the “young adult” group at day 35 post-TBI were sacrificed and 5×104 BM cells acquired from femurs were plated in ColonyGEL Mouse Complete Medium (Reach Bio, Seattle, WA) as previously described [131, 135]. After 7 days of incub | Full Paper | |
2020 | White, CM;Haidekker, MA;Kisaalita, WS; | Ratiometric Nanoviscometers: Applications for Measuring Cellular Physical Properties in 3D Cultures | SLAS technology | 31997709 | Human bone marrow derived (Tulane Center for Gene Therapy) 3.2 ± 1.4 AFM indentation Spread morphology on glass coverslips; cytoplasm measured; spherical AFM tip 76 Human bone marrow derived (AllCells) 33 ± 7 AFM indentation Spread morphology on Ther | Full Paper |
2020 | Chen, Y; | NOVEL SIGNALS IN STRESS ERYTHROPOIESIS: COORDINATED CONTROL OF WNT, PGE2 AND PERK SIGNALING PATHWAYS REGULATES EXPANSION AND DIFFERENTIATION OF STRESS ERYTHROID PROGENITORS | Thesis | Human bone marrow mononuclear cells (MNCs) (ReachBio) were thawed at 37°C water according to the ReachBio instructions. MNCs were enumerated and cell concentrations were adjusted to 5 105 cells/mL. MNCs were cultured in Gibco RPMI-1640 (Invitrogen | Full Paper | |
2020 | Wu, JL;McIntyre, PW;Hong, JM;Yassen, GH;Bruzzaniti, A; | Effects of radiopaque double antibiotic pastes on the proliferation, alkaline phosphatase activity and mineral deposition of dental pulp stem cells | Archives of oral biology | 32485262 | Human DPSC were purchased from ALLCells (Alameda, CA, USA), passaged once and aliquots stored in liquid nitrogen. For each experiment, DPSC were thawed and seeded into 10-cm2 dishes and cultured in α-MEM (HyClone Laboratories Inc., South Logan, UT, U | Full Paper |
2020 | Madanagopal, TT;Franco-Obregón, A;Rosa, V; | Comparative study of xeno-free induction protocols for neural differentiation of human dental pulp stem cells in vitro | Archives of oral biology | 31600663 | The DPSC were isolated from the third molar from single donor (DPF003, AllCells, USA). Due to ethical requirements, the age, gender and ethnic group of the donor cannot be disclosed Save | Full Paper |
2020 | Pieles, O;Reck, A;Morsczeck, C; | High endogenous expression of parathyroid hormone-related protein (PTHrP) supports osteogenic differentiation in human dental follicle cells | Histochemistry and cell biology | 32710187 | Human dental follicle cells (DFCs), which were purchased from AllCells, were cultivated in DMEM (Dulbecco's modified Eagle medium) supplemented with 10% fetal bovine serum and Save | Full Paper |
2020 | Fujishiro, A;Iwasa, M;Fujii, S;Maekawa, T;Andoh, A;Tohyama, K;Takaori-Kondo, A;Miura, Y; | Menatetrenone facilitates hematopoietic cell generation in a manner that is dependent on human bone marrow mesenchymal stromal/stem cells | International journal of hematology | 32572826 | Normal human BM samples were purchased from AllCells (Alameda, CA). To confirm consistency among donors, multiple batches of BM-MSCs were isolated as described previously [ Save | Full Paper |
2020 | Yu, CI;Marches, F;Wu, TC;Martinek, J;Palucka, K; | Techniques for the generation of humanized mouse models for immuno-oncology | Methods in enzymology | 32178826 | Adult CD34 + HPCs from G-CSF mobilized peripheral blood or bone marrow may be obtained from Allcells (Alameda, CA, USA) or Lonza (Basel, Switzerland). Cord blood CD34 + Save | Full Paper |
2020 | Enezei, H;Qabbani, A;Ahmad, A;Khamis, M;Hassani, A;Hamad, H; | The Effect of Strontium on Osteoblastogenesis and Osteoclastogenesis in Dental Stem Cells-induced Epidermal Growth Factor at Molecular Level: In Vitro Study | Journal of Hard Tissue Biology | AllCells, LLC Company, Emeryville, CA, USA Dental Stem Cells (DSCs) Invitrogen, (GIBCO), Faraday Ave, Carlsbad, CA, USA Dulbecco’s modified Eagles medium (DMEM) high glucose(4.5g/l) Invitrogen, (GIBCO), Faraday Ave, Carlsbad, CA, USA Fetal bovine ser | Full Paper | |
2020 | Kuang, Z;Li, L;Zhang, P;Chen, B;Wu, M;Ni, H;Yi, S;Zou, J;Liu, J; | A novel antibody targeting TIM-3 resulting in receptor internalization for cancer immunotherapy | Antibody therapeutics | 33928230 | The antibody was purified in-house (Innovent Biologics Co., Ltd., Suzhou, China) from HEK293 cells with either transient or stable expression unless indicated otherwise. Cell culture Human PBMCs (AllCells, Alameda, CA, USA) were cultured in AIM V M | Full Paper |
2020 | Moussi, K;Abusamra, DB;Yassine, O;Merzaban, J;Kosel, J; | Strain-induced Differentiation of Mesenchymal Stem Cells | Annual International Conference of the IEEE Engineering in Medicine and Biology Society. IEEE Engineering in Medicine and Biology Society. Annual International Conference | 33018453 | Human bone marrow derived mesenchymal stem/stromal cells (hMSCs) were purchased from AllCells. All the experiments were performed using MSCs in their 3-5th passage. An Save | Full Paper |
2020 | Yang, Z;Wang, T;Wu, D;Min, Z;Tan, J;Yu, B; | RNA N6-methyladenosine reader IGF2BP3 regulates cell cycle and angiogenesis in colon cancer | Journal of experimental & clinical cancer research : CR | 32993738 | lls were cultured in RPMI 1640 medium supplemented with 10% FBS (Invitrogen, Carlsbad, CA, USA) at 37 °C in a 5% CO2 atmosphere. Human Umbilical Vein Endothelial Cells (HUVECs) were purchased from Allcells, Inc. (Alameda, CA, USA) and cultured in End | Full Paper |
2020 | MacGlashan, D; | Modulating the Human Basophil Phenotype During Its Development and Maturation: Basophils Derived from In Vitro Cultures of CD34+ Progenitor Cells | Methods in molecular biology (Clifton, N.J.) | 32766967 | CD34+ progenitor stems (commercially prepared, multiple sources, e.g., AllCells (Quincy, MA, USA), or Fred Hutchinson Cancer Research Center (Seattle, WA, USA)). 12. FBS (fetal bovine serum) (multiple sources, heat-inactivated). 13. Penicillin/stre | Full Paper |
2020 | Urkasemsin, G;Rungarunlert, S;Ferreira, JN; | Bioprinting Strategies for Secretory Epithelial Organoids | Methods in molecular biology (Clifton, N.J.) | 32207117 | hDPSC lines are commercially available through AllCells (Alameda, CA, USA) and should be used at lower passage to guarantee that their proliferation rate and phenotype are stable. 2. The same lot of FBS should be utilized during the all experiments. | Full Paper |
2020 | Han, SS;Kang, SW; | Metabolic Labeling of Live Stem Cell for In Vitro Imaging and In Vivo Tracking | Methods in molecular biology (Clifton, N.J.) | 30997638 | Stem cell therapy offers promising solutions to diseases and injuries that traditional medicines and therapies can't effectively cure. To get and explain their full therapeutic potentials, the Save | Full Paper |
2020 | Al-Mohannadi, A;Deola, S;Malki, A; | Visualization of Factor Viii with Flow-Cytometry as a tool for Novel Gene Therapy Approach in Hemophilia A | University of the Future: Re-Imagining Research and Higher Education | received as a kind gift from Antonia Follenzi, Health Sciences Department in Piemonte Orientale University in Novara-Italy. HELA cells (cervical cancer) were purchased from American Type Culture Collection (ATCC™), USA. PBMCs purchased by AllCells (C | Full Paper | |
2020 | Romito, M;Juillerat, A;Kok, Y;HIldenbeutel, M;Rhiel, M;Andrieux, G;Geiger, J;Rudolph, C;Mussolino, C;Duclert, A;Metzner, K;Duchateau, P;Cathomen, T;Cornu, T; | Clinically relevant CCR5 editing in primary CD4+ T cells with TALEN confers resistance to HIV-1 infection | Authorea, Inc. | For oligonucleotide capture assay (OCA), human PBMCs (ALLCELLS, USA) were plated at a density of 1x106 cells/ml in X-vivo-15 media (Lonza, Switzerland) supplemented with 5% Save | Full Paper | |
2020 | Turchiano, G;Andrieux, G;Blattner, G;Pennucci, V;Klermund, J;Monaco, G;Poddar, S;Mussolino, C;Cornu, T;Boerries, M;Cathomen, T; | Quantitative Evaluation of Chromosomal Rearrangements in Primary Gene-Edited Human Stem Cells by Preclinical CAST-Seq | SSRN Electronic Journal | Cell culture and transfection. Cryopreserved human CD34+ HSPCs derived from cord blood (AllCells, Cat.# CB008F; StemCell-Technologies, Cat.# 70008.3) were thawed and cultivated in a density range of 0.5-1 x 106 /ml at 37°C, 5% CO2 in GMP-grade CellG | Full Paper | |
2020 | Lu, B;Yang, H;Liu, F;Sun, Y;He, H;Ding, X;Hu, S;xia, l; | Escherichia coli Nissle 1917 secreting functional interleukin 2 targets tumours and enhances the immune response to suppress tumours | Research Square | CT26 colon carcinoma lines were maintained by our laboratory, and peripheral blood mononuclear cells (PBMCs) were purchased from Allcells Biotechnology (Shanghai) Co., Ltd. Save | Full Paper | |
2020 | Zhang, Y;Wang, P;wang, t;Fang, Y;Ding, Y;Qian, Q; | Chimeric Antigen Receptor T Cells Engineered to Secrete CD40 Agonist Antibodies Enhance Antitumor Efficacy | Research Square | Human peripheral blood mononuclear cells (PBMC) from healthy donors were purchased from AllCells (Shanghai, China) and cryopreserved in our laboratory. Save | Full Paper | |
2020 | Mangiras, D;Mattheakis, P;Ribet, P;Dimitrakopoulos, G; | Soft-Clustering Driven Flip-flop Placement Targeting Clock-induced OCV | Proceedings of the 2020 International Symposium on Physical Design | In this way, the cluster initialization of clock net n is done on AllCells that includes both the cells connected to n and the pre-defined cluster centers of the hierarchically lower clock sub- Save | Full Paper | |
2020 | Li, W;Yang, S;Xu, P;Zhang, D;Tong, Y;Chen, L;Jia, B;Li, A;Ru, D;Zhang, B;Liu, M;Lian, C;Chen, C;Fu, W;Yuan, S;Ren, X;Liang, Y;Yang, Z;Li, W;Wang, S;Zhang, X;Lu, H;Xu, J;Wang, H;Yu, W; | Human Identical Sequences of SARS-CoV-2 Promote Clinical Progression of COVID-19 by Upregulating Hyaluronan via NamiRNA-Enhancer Network | bioRxiv | HUVEC (human umbilical vein endothelial cell, bought from AllCells) was cultured in the commercial culture medium (AllCells, H-004) according to the manufacturer's guidelines. Save | Full Paper | |
2020 | Fiskin, E;Lareau, C;Eraslan, G;Ludwig, L;Regev, A; | Single-cell multimodal profiling of proteins and chromatin accessibility using PHAGE-ATAC | bioRxiv | For PBMC and CD8 T cell experiments, cryopreserved PBMCs or CD8 T cells (AllCells) were thawed, washed in PBS and resuspended in cold Flow cytometry buffer (FC buffer; PBS containing 2% FBS). All centrifugation steps were carried out at 350g, 4min, 4 | Full Paper | |
2020 | Mimitou, E;Lareau, C;Chen, K;Zorzetto-Fernandes, A;Takeshima, Y;Luo, W;Huang, T;Yeung, B;Thakore, P;Wing, J;Nazor, K;Sakaguchi, S;Ludwig, L;Sankaran, V;Regev, A;Smibert, P; | Scalable, multimodal profiling of chromatin accessibility and protein levels in single cells | bioRxiv | Cryopreserved healthy donor peripheral blood mononuclear cells (PBMCs) and bone marrow cells (BM) were obtained from AllCells (USA) or Cellular Technology Limited (CTL) and processed immediately after thawing. NIH-3T3 and HEK293FT cells were maintain | Full Paper | |
2020 | Steinbuck, M;Seenappa, L;Jakubowski, A;McNeil, L;Haqq, C;DeMuth, P; | A Lymph Node Targeted Amphiphile Vaccine Induces Potent Cellular and Humoral Immunity to SARS-CoV-2 | bioRxiv | SARS-CoV-2 infection (COVID-19) were obtained from US Biolab (Rockville, MD) and ALLCELLS (Alameda, CA), respectively. All samples were received and stored frozen at -80°C until analysis | Full Paper | |
2020 | Keating, S;Mizrahi, R;Adams, M;Asensio, M;Benzie, E;Carter, K;Chiang, Y;Edgar, R;Gautam, B;Gras, A;Leong, J;Leong, R;Lim, Y;Manickam, V;Medina-Cucurella, A;Niedecken, A;Saini, J;Simons, J;Spindler, M;Stadtmiller, K;Tinsley, B;Wagner, E;Wayham, N;Tracy, L;Lundberg, C;Büscher, D;Terencio, J;Roalfe, L;Pearce, E;Richardson, H;Goldblatt, D;Ramjag, A;Carrington, C;Simmons, G;Muench, M;Chamow, S;Monroe, B;Olson, C;Oguin, T;Lynch, H;Jeanfreau, R;Meyer, E;Adler, A;Johnson, D; | Capturing and Recreating Diverse Antibody Repertoires as Multivalent Recombinant Polyclonal Antibody Drugs | bioRxiv | Plasma-derived polyclonal antibodies are polyvalent drugs used for many important clinical indications that require modulation of multiple drug targets simultaneously, including Save | Full Paper | |
2020 | Sharma, R;Dever, D;Lee, C;Azizi, A;Pan, Y;Camarena, J;Köhnke, T;Bao, G;Porteus, M;Majeti, R; | TRACE-Seq Reveals Clonal Reconstitution Dynamics of Gene Targeted Human Hematopoietic Stem Cells | bioRxiv | For in vivo studies presented, cord blood-derived CD34 + cells were purchased from AllCells or Stemcell Technologies and were thawed according to the manufacturer's Save | Full Paper | |
2020 | Miller, I;Sun, L;Harris, A;Gamboa, L;Zamat, A;Kwong, G; | Remote control of CAR T cell therapies by thermal targeting | bioRxiv | Primary Human CD3+ cells were obtained from an anonymous donor blood after apheresis (AllCells) and were cryopreserved in 90% FBS and 10% DMSO until subsequent use. After Save | Full Paper | |
2020 | Mandal, S;Sunagawa, S;Prathipati, P;Belshan, M;Shibata, A;Destache, C; | Targeted immuno-antiretroviral HIV therapeutic approach to provide dual protection and boosts cellular immunity: A proof-of-concept study | bioRxiv | Human immunodeficiency virus (HIV)-infected active and latent CCR5 expressing long-lived T-cells are the primary barrier to HIV/AIDS eradication. Broadly neutralizing antibodies and Save | Full Paper | |
2020 | Burley, D;Campagna, C;Harte, A;Kelly, S;Spiegelhoff, M; | Effects of Erythrocyte Aggregation on Blood Rheology in Regard to Future Sepsis Diagnosis Application | Thesis | The preparation of the blood dextran solutions for the micro-ESR, capillary fill, and vibration syllectometry were all done as one big batch. Blood was obtained from AllCells, LLC, a reputable blood and marrow cell supplier from Quincy, Massachusetts | Full Paper | |
2020 | Fleischer, LC; | Engineering Novel Chimeric Antigen Receptors (CARs) for T-cell Malignancies Using Innate Immune Cells | Thesis | Methods and Materials γδ T-cell expansion. gd T cells were expanded from cryopreserved PBMCs purchased from AllCells (Alameda, California) or from fresh PBMCs isolated from 30-50 mL consented, healthy adult blood. PBMCs were isolated from blood using | Full Paper | |
2020 | O'Brien, G; | Genetic and epigenetic consequences of radiation exposure in human and mouse leukaemogenesis | Thesis | Greece with informed consent from each patient. Bone marrow aspirates were obtained from 5 normal donors (ALLCELLS, Alameda, CA) with informed consent and ethical approval from the Alpha Independent Review Board. Bone marrow aspirates from 7 AML pati | Full Paper | |
2020 | Kimmey, SC; | Mapping Single Cell Protein & Biosynthesis Dynamics Across Human Embryonic & Adult Stem Cell Specification | Thesis | Fresh bone marrow aspirates from two independent donors were obtained from AllCells (Alameda, CA) on the same day of collection, and immediately after receiving was placed in 37C 5% CO2 incubator for 30 minutes prior to SOM3B labeling. A mixture of a | Full Paper | |
2020 | Davis-Marcisak, E;Fitzgerald, A;Kessler, M;Danilova, L;Jaffee, E;Zaidi, N;Weiner, L;Fertig, E; | Transfer learning between preclinical models and human tumors identifies conserved NK cell activation signature in anti-CTLA-4 responsive tumors | bioRxiv | Fresh healthy donor NK cells were purchased from AllCells (PB012-P). These NK cells were positively selected from donor peripheral blood using CD56 positivity. Donor NK cell purity Save | Full Paper | |
2020 | Burgenson, D; | Development of a Cell-Free Protein Expression System Derived from Human Blood Cells | Thesis | A comparison between methods used to produce leukapheresis products purchased from Allcells and the New York Blood Center. From the experiments performed, the Allcells Save | Full Paper | |
2020 | Yun, ZX; | Identification of G9a as a Therapeutically Targetable Driver of Multiple Myeloma Tumorigenesis | Thesis | dissociate cells each passage. Cryopreserved Peripheral Blood Mononuclear Cells (PBMC, AllCells) were cultured in RPMI 1640 medium (BioWest, Kansas City, MO) with supplement of 10% FBS (HyClone) and 1% penicillin/streptomycin (Invitrogen) one day bef | Full Paper | |
2020 | Lindgren, A;Mohidin, D; | Applying Digital Marketing Methods in the Healthcare Industry: A Case Study at Immuneed | Thesis | Immuneed Volume Immuneed Traffic Celentyx Volume Celentyx Traffic Reachbio Volume Reachbio Traffic Eurofins Volume Eurofins Traffic Immundnz Volume Immundnz Traffic Nexelis Volume Nexelis Traffic ImmuneCarta Volume ImmuneCarta Traffic | Full Paper | |
2020 | Su, R;Dong, L;Li, Y;Gao, M;Han, L;Wunderlich, M;Deng, X;Li, H;Huang, Y;Gao, L;Li, C;Zhao, Z;Robinson, S;Tan, B;Qing, Y;Qin, X;Prince, E;Xie, J;Qin, H;Li, W;Shen, C;Sun, J;Kulkarni, P;Weng, H;Huang, H;Chen, Z;Zhang, B;Wu, X;Olsen, MJ;Müschen, M;Marcucci, G;Salgia, R;Li, L;Fathi, AT;Li, Z;Mulloy, JC;Wei, M;Horne, D;Chen, J; | Targeting FTO Suppresses Cancer Stem Cell Maintenance and Immune Evasion | Cancer cell | 32531268 | After 7 days of selection with 0.5mg/ml G418 Sulfate (10131027, Thermo Fisher Scientific) in ColonyGEL (1201, ReachBio Research Lab), the cells were collected and injected into lethally irradiated (960 rads) 8- to 10-week-old B6.SJL (CD45.1, RRID: IM | Full Paper |
2020 | Young, TM;Reyes, C;Pasnikowski, E;Castanaro, C;Wong, C;Decker, CE;Chiu, J;Song, H;Wei, Y;Bai, Y;Zambrowicz, B;Thurston, G;Daly, C; | Autophagy protects tumors from T cell-mediated cytotoxicity via inhibition of TNFα-induced apoptosis | Science immunology | 33443027 | For human tumor cell killing experiments using CD3 bispecific antibody, human T cells were isolated from peripheral blood mononuclear cells (PBMCs) (ReachBio) using Dynabeads Untouched Human T Cells Kit (Thermo Fisher Scientific) | Full Paper |
2020 | Shen, C;Sheng, Y;Zhu, AC;Robinson, S;Jiang, X;Dong, L;Chen, H;Su, R;Yin, Z;Li, W;Deng, X;Chen, Y;Hu, YC;Weng, H;Huang, H;Prince, E;Cogle, CR;Sun, M;Zhang, B;Chen, CW;Marcucci, G;He, C;Qian, Z;Chen, J; | RNA Demethylase ALKBH5 Selectively Promotes Tumorigenesis and Cancer Stem Cell Self-Renewal in Acute Myeloid Leukemia | Cell stem cell | 32402250 | Thereafter, the transduced cells were then plated into ColonyGEL methylcellulose medium (ReachBio, Seattle, WA) supplied with 10 ng/ml of murine recombinant IL-3, IL-6, GM-CSF and 30 ng/ml of murine recombinant SCF, along with 1.0 mg/ml of G418 (Gibc | Full Paper |
2020 | Chiu, D;Tavaré, R;Haber, L;Aina, OH;Vazzana, K;Ram, P;Danton, M;Finney, J;Jalal, S;Krueger, P;Giurleo, JT;Ma, D;Smith, E;Thurston, G;Kirshner, JR;Crawford, A; | A PSMA-Targeting CD3 Bispecific Antibody Induces Antitumor Responses that Are Enhanced by 4-1BB Costimulation | Cancer immunology research | 32184296 | PBMCs were obtained from ReachBio (WA) for in vivo (ReachBio). C4-2 tumor cells were subcutaneously injected with 5 × 10 6 tumor cells and 1 × 10 6 human PBMCs (ReachBio). Save | Full Paper |
2020 | Patterson, AM;Liu, L;Sampson, CH;Plett, PA;Li, H;Singh, P;Mohammad, KS;Hoggatt, J;Capitano, ML;Orschell, CM;Pelus, LM; | A Single Radioprotective Dose of Prostaglandin E2 Blocks Irradiation-Induced Apoptotic Signaling and Early Cycling of Hematopoietic Stem Cells | Stem cell reports | 32735825 | CFCs were quantitated as described by Hoggatt et al. (2013a). TNCs from non-IR mice were plated at 2 × 104 per 35-mm dish in triplicate in ColonyGEL Mouse Complete Medium (Reach Bio, Seattle, WA). Cells from IR mice were plated at 0.5-1 × 106 per dis | Full Paper |
2020 | Paulson, RF;Hariharan, S;Little, JA; | Stress erythropoiesis: definitions and models for its study | Experimental hematology | 32750404 | Control PBMCs were purchased from ReachBio. PBMCs obtained were plated at 1 x 10 6 cells/ml stress erythropoiesis differentiation media containing human growth factors. The cells Save | Full Paper |
2020 | Patterson, AM;Plett, PA;Chua, HL;Sampson, CH;Fisher, A;Feng, H;Unthank, JL;Miller, SJ;Katz, BP;MacVittie, TJ;Orschell, CM; | Development of a Model of the Acute and Delayed Effects of High Dose Radiation Exposure in Jackson Diversity Outbred Mice; Comparison to Inbred C57BL/6 Mice | Health physics | 32932286 | Colony-forming unit cell (CFU-C) analyses Functional BM progenitor number was analyzed utilizing methylcellulose colony assays as per manufacturer instructions (Colony Gel 1202, ReachBio, Seattle, WA) | Full Paper |
2020 | Radtke, S;Colonna, L;Perez, AM;Hoffman, M;Kean, LS;Kiem, HP; | Isolation of a Highly Purified HSC-enriched CD34+CD90+CD45RA- Cell Subset for Allogeneic Transplantation in the Nonhuman Primate Large-animal Model | Transplantation direct | 33134503 | CFC) assays were sorted in purity mode to prevent crosscontamination by different subsets. Colony-forming Cell Assay For CFC assays, 1000 to 1200 sorted cells were seeded into 3.5 mL ColonyGEL 1402 (ReachBio, Seattle, WA). Hematopoietic colonies wer | Full Paper |
2019 | Bonner, M;Kanter, J;Macari, E;Lane, R;Lewis, G;Coles, P;Kassenaar, S;Mynampati, S;Schulze, R;Hebert, M;Walters, M;Thompson, A;Asmal, M;Tisdale, J;Pierciey, F; | The Relationships between Target Gene Transduction, Engraftment of HSCs and RBC Physiology in Sickle Cell Disease Gene Therapy | Blood | Background LentiGlobin for Sickle Cell Disease (SCD) gene therapy contains ex-vivo lentiviral vector (LVV)-mediated addition of a modified β-globin gene (βA-T87Q) into autologous CD34+ hematopoietic stem cells (HSCs). The safety and ef | Full Paper | |
2019 | Kanter, J;Tisdale, J;Mapara, M;Kwiatkowski, J;Krishnamurti, L;Schmidt, M;Miller, A;Pierciey, F;Huang, W;Ribeil, J;Thompson, A;Walters, M; | Resolution of Sickle Cell Disease Manifestations in Patients Treated with Lentiglobin Gene Therapy: Updated Results from the Phase 1/2 Hgb-206 Group C Study | Blood | Background β-globin gene transfer into hematopoietic stem cells (HSCs) could reduce or eliminate sickle cell disease (SCD)-related manifestations. LentiGlobin for SCD gene therapy contains autologous CD34+ cells transduced with the BB3 | Full Paper | |
2019 | Walters, M;Tisdale, J;Kwiatkowski, J;Krishnamurti, L;Mapara, M;Schmidt, M;Miller, A;Pierciey, F;Huang, W;Ribeil, J;Kanter, J;Thompson, A; | Exploring the Drivers of Potential Clinical Benefit in Initial Patients Treated in the Hgb-206 Study of Lentiglobin for Sickle Cell Disease (SCD) Gene Therapy | Blood | Background LentiGlobin for SCD gene therapy contains autologous CD34+ hematopoietic stem cells (HSCs) transduced with the BB305 lentiviral vector (LVV) encoding β-globin with an anti-sickling substitution (T87Q). Its safety and efficac | Full Paper | |
2019 | Eapen, M;Neuberg, D;Mendizabal, A;Stevenson, K;Antin, J;DiFronzo, N;El Rassi, F;Lulla, P;Waller, E;Garrison, J;Smith, S;Sullivan, K;Walters, M;Krishnamurti, L; | A Phase II Trial to Compare Allogeneic Transplant Vs. Standard of Care for Severe Sickle Cell Disease: Blood and Marrow Transplant Clinical Trials Network (BMT CTN) Protocol 1503 | Blood | Background: Allogeneic hematopoietic cell transplantation (HCT) is a curative treatment for sickle cell disease (SCD). A pilot trial confirmed the suitability of a myeloablative conditioning regimen (busulfan/fludarabine/r-ATG) for HLA-matched siblin | Full Paper | |
2019 | Loi, S;Giobbie-Hurder, A;Gombos, A;Bachelot, T;Hui, R;Curigliano, G;Campone, M;Biganzoli, L;Bonnefoi, H;Jerusalem, G;Bartsch, R;Rabaglio-Poretti, M;Kammler, R;Maibach, R;Smyth, M;Di Leo, A;Colleoni, M;Viale, G;Regan, M;André, F;Fumagalli, D;Gelber, R;Goulioti, T;Hiltbrunner, A;Hui, R;Roschitzki, H;Ruepp, B;Boyle, F;Stahel, R;Aebi, S;Coates, A;Goldhirsch, A;Karlsson, P;Kössler, I;Fournarakou, S;Gasca, A;Pfister, R;Ribeli-Hofmann, S;Weber, M;Celotto, D;Comune, C;Frapolli, M;Sánchez-Hohl, M;Huang, H;Mahoney, C;Price, K;Scott, K;Shaw, H;Fischer, S;Greco, M;King, C;Andrighetto, S;Piccart-Gebhart, M;Findlay, H;Jenkins, M;Karantza, V;Mejia, J;Schneier, P; | Pembrolizumab plus trastuzumab in trastuzumab-resistant, advanced, HER2-positive breast cancer (PANACEA): a single-arm, multicentre, phase 1b–2 trial | The Lancet Oncology | PD-L1 status for the first 79 patients was assessed with the QualTek immunohistochemistry assay (QualtTek Molecular Laboratories, Santa Barbara, CA, USA) in which PD-L1 staining in at least 1% of tumour cells or any staining in stroma were defined as | Full Paper | |
2019 | Kassim, A;Walters, M;Eapen, M;Allison, B;Mendizabal, A;Brodsky, R;DeBaun, M; | Reduced Intensity Conditioning for Haploidentical Bone Marrow Transplantation in Patients with Symptomatic Sickle Cell Disease: BMT CTN Protocol 1507 | Blood | Background: Hematopoietic cell transplantation (HCT) has curative potential in sickle cell disease (SCD). A reduced intensity haploidentical bone marrow transplant (haplo-BMT) platform piloted by investigators at Johns Hopkins, addressed key barriers | Full Paper | |
2019 | Nghiem, P;Bhatia, S;Lipson, EJ;Sharfman, WH;Kudchadkar, RR;Brohl, AS;Friedlander, PA;Daud, A;Kluger, HM;Reddy, SA;Boulmay, BC;Riker, AI;Burgess, MA;Hanks, BA;Olencki, T;Margolin, K;Lundgren, LM;Soni, A;Ramchurren, N;Church, C;Park, SY;Shinohara, MM;Salim, B;Taube, JM;Bird, SR;Ibrahim, N;Fling, SP;Homet Moreno, B;Sharon, E;Cheever, MA;Topalian, SL; | Durable Tumor Regression and Overall Survival in Patients With Advanced Merkel Cell Carcinoma Receiving Pembrolizumab as First-Line Therapy | J. Clin. Oncol. | 30726175 | 21,22. PD-L1 IHC. PD-L1 staining (anti-PD-L1 clone 22C3; Merck Research Laboratories, Kenilworth, NJ) was performed at QualTek Molecular Laboratories (Newtown, PA) on formalin-fixed paraffin-embedded sections from pretreatment MCC biopsies, as previo | Full Paper |
2019 | Fedoriw, A;Rajapurkar, SR;O'Brien, S;Gerhart, SV;Mitchell, LH;Adams, ND;Rioux, N;Lingaraj, T;Ribich, SA;Pappalardi, MB;Shah, N;Laraio, J;Liu, Y;Butticello, M;Carpenter, CL;Creasy, C;Korenchuk, S;McCabe, MT;McHugh, CF;Nagarajan, R;Wagner, C;Zappacosta, F;Annan, R;Concha, NO;Thomas, RA;Hart, TK;Smith, JJ;Copeland, RA;Moyer, MP;Campbell, J;Stickland, K;Mills, J;Jacques-O'Hagan, S;Allain, C;Johnston, D;Raimondi, A;Porter Scott, M;Waters, N;Swinger, K;Boriack-Sjodin, A;Riera, T;Shapiro, G;Chesworth, R;Prinjha, RK;Kruger, RG;Barbash, O;Mohammad, HP; | Anti-tumor Activity of the Type I PRMT Inhibitor, GSK3368715, Synergizes with PRMT5 Inhibition through MTAP Loss | Cancer Cell | 31257072 | GSK3368715 was evaluated at 20, 5, 1.25, 0.3125 and 0.078 mM in a total of 10 patient samples. DLBCL patient cells from 10 unique donors were received as frozen samples from Conversant Bio. The human biological samples were sourced ethically and thei | Full Paper |
2019 | Leighl, NB;Hellmann, MD;Hui, R;Carcereny, E;Felip, E;Ahn, MJ;Eder, JP;Balmanoukian, AS;Aggarwal, C;Horn, L;Patnaik, A;Gubens, M;Ramalingam, SS;Lubiniecki, GM;Zhang, J;Piperdi, B;Garon, EB; | Pembrolizumab in patients with advanced non-small-cell lung cancer (KEYNOTE-001): 3-year results from an open-label, phase 1 study | Lancet Respir Med | 30876831 | NR=not reached. PD-L1=programmed death ligand 1. TPS=tumour proportion score. *PD-L1 TPS 1% on the basis of the QualTek assay (Molecular Laboratories, Goleta | Full Paper |
2019 | Melamed, Z;López-Erauskin, J;Baughn, MW;Zhang, O;Drenner, K;Sun, Y;Freyermuth, F;McMahon, MA;Beccari, MS;Artates, JW;Ohkubo, T;Rodriguez, M;Lin, N;Wu, D;Bennett, CF;Rigo, F;Da Cruz, S;Ravits, J;Lagier-Tourenne, C;Cleveland, DW; | Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegeneration | Nat. Neurosci. | 30643298 | ... titute for the kind contribution of the SIN18 vector. We thank B. Ren for providing the Illumina sequencing platform. We thank A. Goginashvili for valued input on the manuscript. We thank J. Nuovo at Phylogeny Inc. (Columbus, OH) for performing t | Full Paper |
2019 | Thompson, A;Walters, M;Kwiatkowski, J;Hongeng, S;Porter, J;Sauer, M;Thrasher, A;Thuret, I;Elliot, H;Tao, G;Colvin, R;Locatelli, F; | Northstar-2: Updated Safety and Efficacy Analysis of Lentiglobin Gene Therapy in Patients with Transfusion-Dependent β-Thalassemia and Non-β0/β0 Genotypes | Blood | Background Transfusion-dependent β-thalassemia (TDT) is treated with regular, lifelong red blood cell (RBC) transfusions and despite iron-chelating therapy, carries a risk of serious organ damage from iron overload and other complicati | Full Paper | |
2019 | Petermann, F;Pękowska, A;Johnson, CA;Jankovic, D;Shih, HY;Jiang, K;Hudson, WH;Brooks, SR;Sun, HW;Villarino, AV;Yao, C;Singleton, K;Akondy, RS;Kanno, Y;Sher, A;Casellas, R;Ahmed, R;O'Shea, JJ; | The Magnitude of IFN-γ Responses Is Fine-Tuned by DNA Architecture and the Non-coding Transcript of Ifng-as1 | Mol. Cell | For LCMV experiments RNA was isolated from sorted cells of LCMV-infected mice with the QIAGEN AllPrep Micro Kit. Libraries were prepared and sequenced by the HudsonAlpha Genomic Services Lab (paired-end, 150 bp reads). For all other experiments total | Full Paper | |
2019 | Kwiatkowski, J;Thompson, A;Rasko, J;Hongeng, S;Schiller, G;Anurathapan, U;Cavazzana, M;Ho, P;Schmidt, M;Kletzel, M;Vichinsky, E;Deary, B;Chen, Y;Petrusich, A;Walters, M; | Long-Term Clinical Outcomes of Lentiglobin Gene Therapy for Transfusion-Dependent β-Thalassemia in the Northstar (HGB-204) Study | Blood | Background Patients with transfusion-dependent β-thalassemia (TDT) may experience transfusional iron overload and end-organ damage. While potentially curative, allogeneic hematopoietic stem cell (HSC) transplantation is limited by tran | Full Paper | |
2019 | Furie, R;Werth, VP;Merola, JF;Stevenson, L;Reynolds, TL;Naik, H;Wang, W;Christmann, R;Gardet, A;Pellerin, A;Hamann, S;Auluck, P;Barbey, C;Gulati, P;Rabah, D;Franchimont, N; | Monoclonal antibody targeting BDCA2 ameliorates skin lesions in systemic lupus erythematosus | J. Clin. Invest. | 30645203 | ... un-exposed skin of HVs matched approximately by age and ethnicity to the BIIB059-treated cohort (mean age = 34; range, 28–37; White, 6/8; Asian, 1/8; Black or African American, 1/8; female, 8/8) by Folio Biosciences, then processed into paraffin | Full Paper |
2019 | Hudson, WH;Prokhnevska, N;Gensheimer, J;Akondy, R;McGuire, DJ;Ahmed, R;Kissick, HT; | Expression of novel long noncoding RNAs defines virus-specific effector and memory CD8+ T cells | Nat Commun | 30643116 | ... of Emory University. RNA Isolation and sequencing RNA was isolated from sorted cells of LCMV-infected mice with the Qiagen AllPrep Micro Kit. Library preparation and sequencing were performed by the HudsonAlpha Genomic Services Laboratory via th | Full Paper |
2019 | Ma, X;Shao, Y;Tian, L;Flasch, DA;Mulder, HL;Edmonson, MN;Liu, Y;Chen, X;Newman, S;Nakitandwe, J;Li, Y;Li, B;Shen, S;Wang, Z;Shurtleff, S;Robison, LL;Levy, S;Easton, J;Zhang, J; | Analysis of error profiles in deep next-generation sequencing data | Genome Biol. | 30867008 | Department of Computational Biology, St. Jude Children's Research Hospital, Memphis, TN, 38105, USA. Xiaotu.Ma@stjude.org.++Department of Computational Biology, St. Jude Children's Research Hospital, Memphis, TN, 38105, USA.++Department of Computatio | Full Paper |
2019 | Zeng, Q;Liao, C;Terhune, J;Wang, L; | Impacts of florfenicol on the microbiota landscape and resistome as revealed by metagenomic analysis | Microbiome | 31818316 | Carlsbad, CA) according to the manufacturer's instructions. The library construction and sequencing were conducted at the HudsonAlpha Genomic Services Lab (Huntsville, AL, USA). Genomic libraries were prepared with the | Full Paper |
2019 | Lee, CR;Yonk, AJ;Wiskerke, J;Paradiso, KG;Tepper, JM;Margolis, DJ; | Opposing Influence of Sensory and Motor Cortical Input on Striatal Circuitry and Choice Behavior | Curr. Biol. | 30982651 | Light was delivered to the cortical afferents and PV interneurons in the striatum through an optical fiber patchcord (Thorlabs; length 1 m; 0.50 nA; 200 mm diameter) connected to an optical cannula (described above) via a mating sleeve (Thorlabs). A | Full Paper |
2019 | Ramachandran, I;Lowther, DE;Dryer-Minnerly, R;Wang, R;Fayngerts, S;Nunez, D;Betts, G;Bath, N;Tipping, AJ;Melchiori, L;Navenot, JM;Glod, J;Mackall, CL;D'Angelo, SP;Araujo, DM;Chow, WA;Demetri, GD;Druta, M;Van Tine, BA;Grupp, SA;Abdul Razak, AR;Wilky, B;Iyengar, M;Trivedi, T;Winkle, EV;Chagin, K;Amado, R;Binder, GK;Basu, S; | Systemic and local immunity following adoptive transfer of NY-ESO-1 SPEAR T cells in synovial sarcoma | J Immunother Cancer | 31651363 | d Cross (Philadelphia, PA). NY-ESO-1 testing was performed via IHC at a Clinical Laboratory Improvement Amendments certified pathology laboratory at the National Cancer Institute (Bethesda, MD) or at QualTek Labs (Goleta, CA). Disease response was cl | Full Paper |
2019 | Spino, M;Kurz, SC;Chiriboga, L;Serrano, J;Zeck, B;Sen, N;Patel, S;Shen, G;Vasudevaraja, V;Tsirigos, A;Suryadevara, CM;Frenster, JD;Tateishi, K;Wakimoto, H;Jain, R;Riina, HA;Nicolaides, TP;Sulman, EP;Cahill, DP;Golfinos, JG;Isse, K;Saunders, LR;Zagzag, D;Placantonakis, DG;Snuderl, M;Chi, AS; | Cell Surface Notch Ligand DLL3 is a Therapeutic Target in Isocitrate Dehydrogenase-mutant Glioma | Clin. Cancer Res. | 30397180 | For the discovery set, 20 nontumor brain tissue samples and 63 glioma tumor samples were obtained from Cooperative Human Tumor Network (CHTN), Conversant Bio, and RS Diagnostics. This set of tumors included the following diagnoses: glioblastoma, WHO | Full Paper |
2019 | Habra, MA;Stephen, B;Campbell, M;Hess, K;Tapia, C;Xu, M;Rodon Ahnert, J;Jimenez, C;Lee, JE;Perrier, ND;Boraddus, RR;Pant, S;Subbiah, V;Hong, DS;Zarifa, A;Fu, S;Karp, DD;Meric-Bernstam, F;Naing, A; | Phase II clinical trial of pembrolizumab efficacy and safety in advanced adrenocortical carcinoma | J Immunother Cancer | 31533818 | PD-L1 staining was performed by Qualtek using Merck 22C3 antibody for PD-L1 and scored by a board-certified pathologist. Based on the percentage and intensity of membrane staining, H-score, ranging from 0 to 300, was assigned to tumor samples ;i | Full Paper |
2019 | Lv, JW;Li, JY;Luo, LN;Wang, ZX;Chen, YP; | Comparative safety and efficacy of anti-PD-1 monotherapy, chemotherapy alone, and their combination therapy in advanced nasopharyngeal carcinoma: findings from recent advances in landmark trials | J Immunother Cancer | 31238988 | D-L1 expression was assessed baseline on an archived formalin-fixed, paraffin-embedded tumor sample or a newly obtained biopsy sample using a laboratory-developed prototype immunohistochemical assay (QualTek Molecular Laboratories, Goleta, CA). PD-L1 | Full Paper |
2019 | Clouthier, DL;Lien, SC;Yang, SYC;Nguyen, LT;Manem, VSK;Gray, D;Ryczko, M;Razak, ARA;Lewin, J;Lheureux, S;Colombo, I;Bedard, PL;Cescon, D;Spreafico, A;Butler, MO;Hansen, AR;Jang, RW;Ghai, S;Weinreb, I;Sotov, V;Gadalla, R;Noamani, B;Guo, M;Elston, S;Giesler, A;Hakgor, S;Jiang, H;McGaha, T;Brooks, DG;Haibe-Kains, B;Pugh, TJ;Ohashi, PS;Siu, LL; | An interim report on the investigator-initiated phase 2 study of pembrolizumab immunological response evaluation (INSPIRE) | J Immunother Cancer | 30867072 | IHC. For screening biopsies only, the FFPE blocks were used for PD-L1 IHC (clone 22C3) on 4-5 μm sections mounted on positively charged ProbeOn slides (QualTek, Goleta, CA). QualTek provided a modified proportion score ;from the same site as the | Full Paper |
2019 | Rowley, MJ;Lyu, X;Rana, V;Ando-Kuri, M;Karns, R;Bosco, G;Corces, VG; | Condensin II Counteracts Cohe |