Asset 1

Publications

Discovery has worked with hundreds of researchers on thousands of projects to help uncover valuable insights that accelerate research and development programs across several disease indications, including cancer, infectious disease, autoimmune disease, women’s health, cardiovascular disease, inflammatory diseases and many others.

YearAuthorsTitleJournalPubMed IDSnippetLink
2023Bellet-Ezquerra, M;Pardo, P;Fasani, R;Villacampa, G;Portu, M;Serna, G;Joval, L;Petit, A;Ortega, A;Jimenez, J;Zamora, E;Gil, M;Gomez, L;Viaplana, C;Gallego, F;Cámara, V;Manich, C;Simon, S;Nuciforo, P;62P KI67 in ER+HER2-negative pure invasive lobular breast carcinoma (ILC). What’s the best Ki67 threshold to differentiate prognosis?ESMO Opena, Novartis, Daiichi Sankyo; Non-Financial Interests, Invited Speaker: SOLTI. P.G. Nuciforo: Financial Interests, Personal, Invited Speaker: Novartis; Financial Interests, Personal, Advisory Board: MSD Oncology, Bayer; Financial Interests, Personal,Full Paper
2023Cieniewicz, B;Bhatta, A;Torabi, D;Baichoo, P;Saxton, M;Arballo, A;Nguyen, L;Thomas, S;Kethar, H;Kukutla, P;Shoaga, O;Yu, B;Yang, Z;Fate, M;Oliveira, E;Ning, H;Corey, L;Corey, D;Chimeric TIM-4 receptor-modified T cells targeting phosphatidylserine mediates both cytotoxic anti-tumor responses and phagocytic uptake of tumor-associated antigen for T cell cross-presentationMolecular therapy : the journal of the American Society of Gene Therapy37194236Healthy donor T cells were positively selected from fresh leukopak provided by AllCells (Alameda, CA) by using anti-CD4 and CD8 antibodies through the Prodigy TCT program. All related reagents and instruments were purchased from Miltenyi. After selecFull Paper
2023Overbeck, TR;Reiffert, A;Schmitz, K;Rittmeyer, A;Körber, W;Hugo, S;Schnalke, J;Lukat, L;Hugo, T;Hinterthaner, M;Reuter-Jessen, K;Schildhaus, HU;NTRK Gene Fusions in Non-Small-Cell Lung Cancer: Real-World Screening Data of 1068 Unselected PatientsCancers37296928r or speaker from: Amgen, AstraZeneca, Bayer, Daiichi-Sankyo, Diaceutics, Incyte, Janssen-Cilag, Eli Lilly, Merck Sharp and Dohme, Novartis Pharma, Pfizer, PharmaMar, Roche Pharma, Servier, Stemline, Targos GmbH, and ZytoVision. A.R. received grantsFull Paper
2023Wagner, R;McKindles, K;Bullerjahn, G;Effects of water movement and temperature on Rhizophydium infection of Planktothrix in a shallow hypereutrophic lakeFrontiers in Microbiologysent to HudsonAlpha Discovery Life Sciences (Hudson, AL, United States) for sequencing. Amplicon sequencing and QC was performed by HudsonAlpha Discovery Life Save;- Discovery Life Sciences (Hudson, AL, United States) for sequencing. Amplicon seFull Paper
2023de Vries, EGE;Rüschoff, J;Lolkema, M;Tabernero, J;Gianni, L;Voest, E;de Groot, DJA;Castellano, D;Erb, G;Naab, J;Donica, M;Deurloo, R;van der Heijden, MS;Viale, G;Phase II study (KAMELEON) of single-agent T-DM1 in patients with HER2-positive advanced urothelial bladder cancer or pancreatic cancer/cholangiocarcinomaCancer medicine37119523Department of Medical Oncology, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands.++Targos Molecular Pathology GmbH, Kassel, Germany.++Department of Medical Oncology, Erasmus MC Cancer Institute, Rotterdam, TheFull Paper
2023Wang, S;Huang, Z;Liu, Y;Sun, H;Zhou, Y;Shi, J;Sustainably released nanoparticle-based rhynchophylline limits pulmonary fibrosis by inhibiting the TEK-PI3K/AKT signaling pathwayTranslational lung cancer research37057119/tlcr-22-675/rc). Methods Solution groups For better apply to the clinic, 0.9% saline solution was used as the solvent. Because of the extremely low concentration for cell, 1 mg of Rhy (CAS 76-66-4; Allcells, Shanghai, China) was directly dissolvedFull Paper
2023Naik, NN;Vadloori, B;Poosala, S;Srivastava, P;Coecke, S;Smith, A;Akhtar, A;Roper, C;Radhakrishnan, S;Bhyravbhatla, B;Damle, M;Pulla, VK;Hackethal, J;Horland, R;Li, AP;Pati, F;Singh, MS;Occhetta, P;Bisht, R;Dandekar, P;Bhagavatula, K;Pajkrt, D;Johnson, M;Weber, T;Huang, J;Hysenaj, L;Mallar, B;Ramray, B;Dixit, S;Joshi, S;Kulkarni, M;Advances in Animal Models and Cutting-Edge Research in Alternatives: Proceedings of the Third International Conference on 3Rs Research and Progress, Vishakhapatnam, 2022Alternatives to laboratory animals : ATLA37282515Dr Li highlighted the discovery focus of Discovery Life Sciences LLC, namely the liver and intestine. He further described the properties of their two major novel human in SaveFull Paper
2023Guler, S;DiPoto, MC;Crespo, A;Caldwell, R;Doerfel, B;Grossmann, N;Ho, K;Huck, B;Jones, CC;Lan, R;Musil, D;Potnick, J;Schilke, H;Sherer, B;Simon, S;Sirrenberg, C;Zhang, Z;Liu-Bujalski, L;Selective Wee1 Inhibitors Led to Antitumor Activity In Vitro and Correlated with MyelosuppressionACS medicinal chemistry letters37197456We acknowledge Bettina Hoelke, Brian Dill, Ioannis Gounaris, and Emer Clarke (ReachBio) for their technical support and discussionsFull Paper
2023Tang, PZ;Ding, B;Reyes, C;Papp, D;Potter, J;Target-seq: single workflow for detection of genome integration site, DNA translocation and off-target eventsBioTechniques37161298Peripheral blood mononuclear cells (PBMCs) were purified from leukopak (ALLCELLS, CA, USA) using CTS™ Rotea™ Counterflow Centrifugation System (Thermo Fisher Scientific, MA, USA) and were then activated for 3 days to enrich the T cells (at 1 × 106 ceFull Paper
2023Singh, P;MSC and HSPC Coculture: Mimicking Ex Vivo Bone Marrow NicheMethods in molecular biology (Clifton, N.J.)36255702CD34+ cells with micromagnetic beads-conjugated CD34 antibody and placing with the labeled cells into a magnetic field according to the specific manual instruction. Always use fresh BM samples (within 30 h of withdrawal) for CD34+ cell isolation. HumFull Paper
2023Simmons, KT;Chan, J;Hussain, S;Rose, EL;Markham, K;Byun, TS;Panicker, S;Parry, GC;Storek, M;Anti-C1s humanized monoclonal antibody SAR445088: A classical pathway complement inhibitor specific for the active form of C1sClinical immunology (Orlando, Fla.)37149117First, 1 mL of type O- hRBCs (Allcells, Alameda, CA) was washed in 4.5 mL GVB++ by centrifuging at 600 g for 5 min. The wash step was repeated three times and the cells were resuspended to a final volume of 5 mL in GVB++ after the third washFull Paper
2023Sikkema, L;Ramírez-Suástegui, C;Strobl, DC;Gillett, TE;Zappia, L;Madissoon, E;Markov, NS;Zaragosi, LE;Ji, Y;Ansari, M;Arguel, MJ;Apperloo, L;Banchero, M;Bécavin, C;Berg, M;Chichelnitskiy, E;Chung, MI;Collin, A;Gay, ACA;Gote-Schniering, J;Hooshiar Kashani, B;Inecik, K;Jain, M;Kapellos, TS;Kole, TM;Leroy, S;Mayr, CH;Oliver, AJ;von Papen, M;Peter, L;Taylor, CJ;Walzthoeni, T;Xu, C;Bui, LT;De Donno, C;Dony, L;Faiz, A;Guo, M;Gutierrez, AJ;Heumos, L;Huang, N;Ibarra, IL;Jackson, ND;Kadur Lakshminarasimha Murthy, P;Lotfollahi, M;Tabib, T;Talavera-López, C;Travaglini, KJ;Wilbrey-Clark, A;Worlock, KB;Yoshida, M;Lung Biological Network Consortium, ;van den Berge, M;Bossé, Y;Desai, TJ;Eickelberg, O;Kaminski, N;Krasnow, MA;Lafyatis, R;Nikolic, MZ;Powell, JE;Rajagopal, J;Rojas, M;Rozenblatt-Rosen, O;Seibold, MA;Sheppard, D;Shepherd, DP;Sin, DD;Timens, W;Tsankov, AM;Whitsett, J;Xu, Y;Banovich, NE;Barbry, P;Duong, TE;Falk, CS;Meyer, KB;Kropski, JA;Pe'er, D;Schiller, HB;Tata, PR;Schultze, JL;Teichmann, SA;Misharin, AV;Nawijn, MC;Luecken, MD;Theis, FJ;An integrated cell atlas of the lung in health and diseaseNature medicine3729121419-ms2/?ds=full&meta=SampleName, https://figshare.com/articles/dataset/Single-cell_RNA-Seq_of_human_primary_lung_and_bronchial_epithelium_cells/11981034/1, https://covid19.lambrechtslab.org/downloads/Allcells.counts.rds, https://s3.amazonaws.com/dp-lFull Paper
2023Sternberg, CN;Petrylak, DP;Bellmunt, J;Nishiyama, H;Necchi, A;Gurney, H;Lee, JL;van der Heijden, MS;Rosenbaum, E;Penel, N;Pang, ST;Li, JR;García Del Muro, X;Joly, F;Pápai, Z;Bao, W;Ellinghaus, P;Lu, C;Sierecki, M;Coppieters, S;Nakajima, K;Ishida, TC;Quinn, DI;FORT-1: Phase II/III Study of Rogaratinib Versus Chemotherapy in Patients With Locally Advanced or Metastatic Urothelial Carcinoma Selected Based on FGFR1/3 mRNA ExpressionJournal of clinical oncology : official journal of the American Society of Clinical Oncology36240478ted prevalence of PIK3CA and/or RAS resistance mutations, we reconfirmed absence or presence in all enrolled patients using a targeted Illumina MiSeq panel (Illumina, Inc, San Diego, CA) performed by TARGOS Molecular Pathology GmbH (Kassel, Germany).Full Paper
2023Ho, C;Fromm, J;Fang, M;Till, B;Shadman, M;Cowan, A;Lynch, R;Wu, V;Voutsinas, J;Rasmussen, H;Blue, K;Ujjani, C;Shustov, A;Cassaday, R;Gopal, A;Smith, S;Long-term efficacy and safety of pembrolizumab with R-CHOP as first-line therapy for DLBCL.Journal of Clinical OncologyAdditionally, prognostic factors including tumor PD-L1 expression (Qualtek/Merck) were re-analyzed. Results: 30 patients were treated (13/30 with IPI 3-5). Median follow SaveFull Paper
2023Zhang, Y;Zhao, Z;Huang, LA;Liu, Y;Yao, J;Sun, C;Li, Y;Zhang, Z;Ye, Y;Yuan, F;Nguyen, TK;Garlapati, NR;Wu, A;Egranov, SD;Caudle, AS;Sahin, AA;Lim, B;Beretta, L;Calin, GA;Yu, D;Hung, MC;Curran, MA;Rezvani, K;Gan, B;Tan, Z;Han, L;Lin, C;Yang, L;Molecular mechanisms of snoRNA-IL-15 crosstalk in adipocyte lipolysis and NK cell rejuvenationCell metabolism37329887Healthy and obese human serum Coriell Biorepository See Table S1 Human breast cancer tumor tissues and paired plasma samples Discovery Life Sciences See Table S2 Primary human pre-adipocytes Zen-Bio See Table S3Full Paper
2023Libreros, S;Nshimiyimana, R;Lee, B;Serhan, CN;Infectious Neutrophil deployment is regulated by Resolvin D4Blood37295018Fresh BM aspirates from deidentified individuals were purchased from AllCells, Inc (Alameda, CA) with Mass General Brigham investigational review board protocol no. 1999P0001279. For information on donor demographics, see Supplemental Table-1. HumanFull Paper
2023Dunbar, AJ;Kim, D;Lu, M;Farina, M;Bowman, RL;Yang, JL;Park, Y;Karzai, A;Xiao, W;Zaroogian, Z;O'Connor, K;Mowla, S;Gobbo, F;Verachi, P;Martelli, F;Sarli, G;Xia, L;Elmansy, N;Kleppe, M;Chen, Z;Xiao, Y;McGovern, E;Snyder, J;Krishnan, A;Hill, C;Cordner, K;Zouak, A;Salama, ME;Yohai, J;Tucker, E;Chen, J;Zhou, J;McConnell, T;Migliaccio, AR;Koche, R;Rampal, R;Fan, R;Levine, RL;Hoffman, R;CXCL8/CXCR2 signaling mediates bone marrow fibrosis and is a therapeutic target in myelofibrosisBlood36800567ple was independently verified by a hematopathologist (W.X.) or pulled directly from clinical pathology reports at the time of sample collection. Deidentified, healthy CD34+ cells were purchased from AllCells. CD34+ selection was carried out using FiFull Paper
2023Kiridena, S;Wijayaratna, U;Levon, E;Moschella, P;Pirrallo, R;Tzeng, T;Anker, J;X?Ray Visualized Sensors for Peritoneal Dialysis Catheter InfectionAdvanced Functional MaterialsDeidentified human peritoneal fluid was obtained from Discovery Life Sciences, Huntsville, AL, a commercial biospecimen source. Tantalum beads (0.394 mm diameter) SaveFull Paper
2023Tarafder, S;Ghataure, J;Langford, D;Brooke, R;Kim, R;Eyen, SL;Bensadoun, J;Felix, JT;Cook, JL;Lee, CH;Advanced bioactive glue tethering Lubricin/PRG4 to promote integrated healing of avascular meniscus tearsBioactive materials37214259?S-encapsulating TGF?3 (R&D systems) (2.5 ?g per 500 mg PLGA) was applied to the incised tissues. Then the meniscus explants were placed on top of monolayer-cultured P2 - P3 syMSCs or hBMSCs (AllCells, Alameda, CA) at 80-90% confluence per our previoFull Paper
2023Sarno, J;Domizi, P;Liu, Y;Merchant, M;Pedersen, CB;Jedoui, D;Jager, A;Nolan, GP;Gaipa, G;Bendall, SC;Bava, FA;Davis, KL;Dasatinib overcomes glucocorticoid resistance in B-cell acute lymphoblastic leukemiaNature communications37217509Healthy human bone marrow samples (n = 3 for RNA-Seq, n = 4 for CyTOF) were purchased through AllCells. De-identified bone marrow samples from pediatric patients SaveFull Paper
2023Yang, Y;Yang, H;Alcaina, Y;Puc, J;Birt, A;Vedvyas, Y;Gallagher, M;Alla, S;Riascos, MC;McCloskey, JE;Du, K;Gonzalez-Valdivieso, J;Min, IM;de Stanchina, E;Britz, M;von Hofe, E;Jin, MM;Inducible expression of interleukin-12 augments the efficacy of affinity-tuned chimeric antigen receptors in murine solid tumor modelsNature communications37045815quoted and stored at ?80?°C. CAR-T cells were generated by transducing activated T cells with lentivirus. Primary T cells were enriched from commercially obtained leukopaks from healthy donors (AllCells) via MACS separation using CD4 (Miltenyi BioteFull Paper
2023Lee, JY;Jonus, HC;Sadanand, A;Branella, GM;Maximov, V;Suttapitugsakul, S;Schniederjan, MJ;Shim, J;Ho, A;Parwani, KK;Fedanov, A;Pilgrim, AA;Silva, JA;Schnepp, RW;Doering, CB;Wu, R;Spencer, HT;Goldsmith, KC;Identification and targeting of protein tyrosine kinase 7 (PTK7) as an immunotherapy candidate for neuroblastomaCell reports. Medicine37343516Bacterial and virus strains ------------------------- Stbl3 Competent Cells Spencer Lab N/A ------------------------- Biological samples ------------------------- Healthy PBMC AllCells LP,CR,MNC, 10M COG-424s (Neuroblastoma PDX) ChiFull Paper
2023Chen, SS;Barrientos, JC;Ferrer, G;King-Richards, M;Chen, YJ;Ravichandran, P;Ibrahim, M;Kieso, Y;Waters, S;Kutok, JL;Peluso, M;Sharma, S;Weaver, DT;Pachter, JA;Rai, KR;Chiorazzi, N;Duvelisib Eliminates CLL B Cells, Impairs CLL-Supporting Cells, and Overcomes Ibrutinib Resistance in a Xenograft ModelClinical cancer research : an official journal of the American Association for Cancer Research37071496Human PBMCs obtained from whole blood of CLL donors were purchased from a commercial source (Bioreclamation IVT or ALLCELLS) were resuspended (1 × 10 6 cells/ SaveFull Paper
2023Xiang, J;Liu, Q;Shaknovich, R;Venn, O;Abstract 779: Clonal B-cell expansion and the potential challenges to blood-based early cancer detectionCancer Researchht tubes of frozen buffy coat for a young healthy donor (18-35; no pre-existing health conditions; nonsmoker; viral negative) was sourced commercially (Discovery Life Sciences, Huntsville, AL, USA) and used as the backgrouFull Paper
2023Fahl, S;Colwell, K;Smith, C;Ott, C;Moore, A;Williams, K;Abstract 602: Single cell evaluation of intratumoral B cells across solid tumor indicationsCancer Research1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, HuntsvillFull Paper
2023Li, A;Wei, H;Abstract 5338: A novel in vitro assay to evaluate the roles of hepatic metabolism on anticancer drug safety and efficacyCancer Research1Discovery Life Sciences LLC, Columbia, MD.++1Discovery Life Sciences LLC, Columbia, MDFull Paper
2023Roy, G;Kadekar, P;Douglas, L;Frappier, M;Currie, J;Dhillon, J;Cesarone, G;Siderits, R;Kirchner, K;Demeule, M;Marsolais, C;Abstract 3942: Differential expression of a novel transport receptor, SORT1 (sortilin), in cancer versus healthy tissues that can be utilized for targeted delivery of anti-cancer drugsCancer Research1Theratechnologies Inc., Montreal, Quebec, Canada;++1Theratechnologies Inc., Montreal, Quebec, Canada;++1Theratechnologies Inc., Montreal, Quebec, Canada;++1Theratechnologies Inc., Montreal, Quebec, Canada;++1Theratechnologies Inc., Montreal, Quebec,Full Paper
2023Cheng, C;Chen, H;Kirchner, K;Cesarone, G;Abstract 2763: Characterization of a novel immunohistochemistry (IHC) assay for CEACAM5 using a commercial antibodyCancer Research[Abcam], and 327 [Sino Biological]) to evaluate CEACAM5 detection in formalin-fixed, paraffin-embedded (FFPE) human cancer tissues from Discovery Life Sciences SaveFull Paper
2023Zielinski, D;Vogtmann, R;Siemon, A;Koppel, C;Schipper, C;Tereshchenko, A;Platero, S;Schildhaus, H;Abstract 1018: Multiplex immunofluorescence and image analysis to investigate the role of the immune contexture and fibroblast activation for tumor cell budding in colorectal cancerCancer Research1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, Huntsville, AL.++1Discovery Life Sciences, HuntsvillFull Paper
2023Kumar, A;Taghi Khani, A;Duault, C;Aramburo, S;Sanchez Ortiz, A;Lee, SJ;Chan, A;McDonald, T;Huang, M;Lacayo, NJ;Sakamoto, KM;Yu, J;Hurtz, C;Carroll, M;Tasian, SK;Ghoda, L;Marcucci, G;Gu, Z;Rosen, ST;Armenian, S;Izraeli, S;Chen, CW;Caligiuri, MA;Forman, SJ;Maecker, HT;Swaminathan, S;Intrinsic suppression of type I interferon production underlies the therapeutic efficacy of IL-15-producing natural killer cells in B-cell acute lymphoblastic leukemiaJournal for immunotherapy of cancer37217248opoietic Tissue Biorepository and University of Pennsylvania Stem Cell and Xenograft Core after informed consent per Institutional Review Board policies. Age-matched healthy BMMCs were purchased from AllCells (Alameda, California, USA) and Stem CellFull Paper
2023Nirschl, CJ;Brodkin, HR;Domonkos, C;Dwyer, CJ;Hicklin, DJ;Ismail, N;Seidel-Dugan, C;Steiner, P;Steuert, Z;Sullivan, JM;Winston, WM;Salmeron, A;mWTX-330, an IL 12 INDUKINE Molecule, Activates and Reshapes Tumor-infiltrating CD8+ T and NK Cells to Generate Antitumor ImmunityCancer immunology research37074216Dissociated human tumor samples were purchased from Discovery Life Sciences and included the following indications: bladder cancer, glioblastoma multiforme, gastric SaveFull Paper
2023Diwanji, R;O'Brien, NA;Choi, JE;Nguyen, B;Laszewski, T;Grauel, AL;Yan, Z;Xu, X;Wu, J;Ruddy, DA;Piquet, M;Pelletier, MR;Savchenko, A;Charette, L;Rodrik-Outmezguine, V;Baum, J;Millholland, JM;Wong, CC;Martin, AM;Dranoff, G;Pruteanu-Malinici, I;Cremasco, V;Sabatos-Peyton, C;Jayaraman, P;Targeting the IL1? Pathway for Cancer Immunotherapy Remodels the Tumor Microenvironment and Enhances Antitumor Immune ResponsesCancer immunology research37040466Dissociated human microsatellite-stable colorectal carcinoma (MSS-CRC) samples were obtained from Discovery Life Sciences from five donors. Between 25,000 and SaveFull Paper
2023Huang, W;Lin, W;Chen, B;Zhang, J;Gao, P;Fan, Y;Lin, Y;Wei, P;NFAT and NF-?B dynamically co-regulate TCR and CAR signaling responses in human T cellsCell reports37347664K562 Laboratory of Wendell Lim N/A Jurkat Laboratory of Arthur Weiss N/A Human PBMC ALLCELLS PB004F-CFull Paper
2023Raj, N;Chan, JA;Wang, SJ;Aggarwal, RR;Calabrese, S;DeMore, A;Fong, L;Grabowsky, J;Hope, TA;Kolli, KP;Mulvey, CK;Munster, PN;Perez, K;Punn, S;Reidy-Lagunes, D;Von Fedak, S;Zhang, L;Bergsland, EK;Pembrolizumab alone and pembrolizumab plus chemotherapy in previously treated, extrapulmonary poorly differentiated neuroendocrine carcinomasBritish journal of cancer37208512Background To date, single-agent immune checkpoint inhibitor (CPI) therapy has proven to be ineffective against biomarker-unselected extrapulmonary poorly SaveFull Paper
2023Reissig, TM;Tzianopoulos, I;Liffers, ST;Rosery, VK;Guyot, M;Ting, S;Wiesweg, M;Kasper, S;Meister, P;Herold, T;Schmidt, HH;Schumacher, B;Albers, D;Markus, P;Treckmann, J;Schuler, M;Schildhaus, HU;Siveke, JT;Smaller panel, similar results: genomic profiling and molecularly informed therapy in pancreatic cancerESMO open37148593stock ownership: none; honoraries for CME presentations: Amgen, Boehringer Ingelheim, Bristol-Myers Squibb, Janssen, Novartis; research funding to institution: AstraZeneca, Bristol Myers-Squibb. HUS: Targos Molecular Pathology, Inc. (employment); RocFull Paper
2023Han, R;Guo, H;Shi, J;Wang, H;Zhao, S;Jia, Y;Liu, X;Li, J;Cheng, L;Zhao, C;Li, X;Zhou, C;Tumour microenvironment changes after osimertinib treatment resistance in non-small cell lung cancerEuropean journal of cancer (Oxford, England : 1990)37320935Fresh PBMCs of three healthy donors were purchased from Allcells (China). A total of 2 × 10 6 PBMC cells/well were seeded into 24-well plated and were treated with: SaveFull Paper
2023Geoerger, B;Marshall, LV;Nysom, K;Makin, G;Bouffet, E;Defachelles, AS;Amoroso, L;Aerts, I;Leblond, P;Barahona, P;Van-Vlerken, K;Fu, E;Solca, F;Lorence, RM;Ziegler, DS;Afatinib in paediatric patients with recurrent/refractory ErbB-dysregulated tumours: Results of a phase I/expansion trialEuropean journal of cancer (Oxford, England : 1990)37178647Biomarker assays were performed centrally by TARGOS Molecular Pathology GmbH using tissue samples from archived tumour blocks, or tissue sections [20]. SaveFull Paper
2023Robert, ME;Rüschoff, J;Jasani, B;Graham, RP;Badve, SS;Rodriguez-Justo, M;Kodach, LL;Srivastava, A;Wang, HL;Tang, LH;Troncone, G;Rojo, F;Van Treeck, BJ;Pratt, J;Shnitsar, I;Kumar, G;Karasarides, M;Anders, RA;Erratum to High Interobserver Variability Among Pathologists Using Combined Positive Score to Evaluate PD-L1 Expression in Gastric, Gastroesophageal Junction, and Esophageal Adenocarcinoma [Modern Pathology 36(5) (2023) 100154]Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc37327723Yale University School of Medicine, New Haven, Connecticut. Electronic address: marie.robert@yale.edu.++Discovery Life Sciences, Hesse, Germany.++Discovery Life Sciences, Hesse, Germany.++Mayo Clinic, Rochester, Minnesota.++Emory University School ofFull Paper
2023Dong, Q;Tong, M;Yu, X;Wang, L;Ao, J;Guan, D;Tang, Y;Liu, J;Long, L;Tong, Y;Fang, S;Zhou, H;Huang, Y;Gong, L;Lou, L;Huang, W;Carbohydrate Strengthens the Immunotherapeutic Effect of Small-Molecule PD-L1 InhibitorsJournal of medicinal chemistry37226718Stimulator cells from donor A and responder cells from donor B constitute the mixed lymphocyte reaction (MLR). Pheral Blood Mononuclear Cells (PBMCs) were purchased from Allcells (Shanghai) and used following the instruction of the manufacturer. DC cFull Paper
2023Papakonstantinou, A;Napoli, S;Joval, L;Butjosa-Espin, M;Malavila, A;Puy, M;Pimentel, I;Zamora, E;Torres, P;Rodas, N;Manich, C;Seoane, J;Nonell, L;Nuciforo, P;Oliveira, M;19P Tumor-associated microbiome composition and response to neoadjuvant chemotherapy (NACT) in early triple-negative breast cancer (TNBC)ESMO Openncer Research (AACR). P.G. Nuciforo: Financial Interests, Personal, Invited Speaker: Novartis; Financial Interests, Personal, Advisory Board: MSD Oncology, Bayer; Financial Interests, Personal, Other, Consultant: Targos Molecular Pathology GmbH. M. OFull Paper
2023Akiyama, H;Carter, BZ;Andreeff, M;Ishizawa, J;Molecular Mechanisms of Ferroptosis and Updates of Ferroptosis Studies in Cancers and LeukemiaCells37190037Another study demonstrates that progestin and adipoQ receptor 3 (PAQR3) enhances erastin- as well as RSL3-induced ferroptosis in ALLcells through the degradation of SaveFull Paper
2023Chaand, M;Fiore, C;Johnston, B;D'Ippolito, A;Moon, DH;Carulli, JP;Shearstone, JR;Erythroid lineage chromatin accessibility maps facilitate identification and validation of NFIX as a fetal hemoglobin repressorCommunications biology37316562Fetal CB-derived CD34+ cells (AllCells, LLC) were transduced with concentrated lentivirus at an MOI = 1. Transduced cells were selected in the presence of 2 µg/mL SaveFull Paper
2023Lin, W;Singh, V;Springer, R;Choonoo, G;Gupta, N;Patel, A;Frleta, D;Zhong, J;Owczarek, T;Decker, C;Macdonald, L;Murphy, A;Thurston, G;Mohrs, M;Ioffe, E;Lu, YF;Human CD4 cytotoxic T lymphocytes mediate potent tumor control in humanized immune system miceCommunications biology37185301from fetal liver or cord blood, respectively. Fetal liver CD34+ HSPC were obtained from Advanced Biosciences Resources (Alameda, CA) with proper consent66 and cord blood CD34+ HSPC were obtained from AllCells, HemaCare, or STEMCELL Technologies. HumaFull Paper
2023Maden, M;Polvadore, T;Polanco, A;Barbazuk, WB;Stanley, E;Osteoderms in a mammal the spiny mouse Acomys and the independent evolution of dermal armoriScience37378333na NovaSeq6000 platform to yield nearly 898 million paired-end, 150 bp reads (mean of 74.8 M read pairs (s = 9.1 M read pairs) per library). Library construction and sequencing were performed by HudsonAlpha Discovery in Huntsville, Alabama, USA. QuaFull Paper
2023Egelston, CA;Guo, W;Yost, SE;Ge, X;Lee, JS;Frankel, PH;Cui, Y;Ruel, C;Schmolze, D;Murga, M;Tang, A;Martinez, N;Karimi, M;Somlo, G;Lee, PP;Waisman, JR;Yuan, Y;Immunogenicity and efficacy of pembrolizumab and doxorubicin in a phase I trial for patients with metastatic triple-negative breast cancerCancer immunology, immunotherapy : CII37294342Biomarker Working Group on Breast Cancer Guidelines [18]. PD-L1 was determined by QualTek Molecular Laboratory (Goleta, CA) using immunohistochemistry (IHC) with 22C3 antibody (Merck & Co, Kenilworth, NJ). PD-L1 was positive if membrane staining wasFull Paper
2023Becker, SA;Petrich, BG;Yu, B;Knight, KA;Brown, HC;Raikar, SS;Doering, CB;Spencer, HT;Enhancing the effectiveness of ?? T cells by mRNA transfection of chimeric antigen receptors or bispecific T cell engagersMolecular therapy oncolytics37387794ed from healthy donor blood through the Children’s Clinical Translational Discovery Core at Emory University under the core’s approved institutional review board protocol or ordered directly from AllCells. PBMCs were isolated from fresh blood using FFull Paper
2023Chervin, AS;Stone, JD;Konieczna, I;Calabrese, KM;Wang, N;Haribhai, D;Dong, F;White, MK;Rodriguez, LE;Bukofzer, GT;Ellis, PA;Cosgrove, C;Hecquet, C;Clarin, JD;Palma, JP;Reilly, EB;ABBV-184: A novel survivin-specific TCR/CD3 bispecific T cell engager is active against both solid tumor and hematological malignanciesMolecular cancer therapeutics37294945Primary frozen viable PBMCs from AML patients and including AML blasts were purchased from Discovery Life Sciences and verified for HLA-A2 expression by staining with the HLA-A2 specific monoclonal antibody BB7.2 and detecting by flow cytometryFull Paper
2023Korntner, SH;Di Nubila, A;Gaspar, D;Zeugolis, DI;Macromolecular crowding in animal component-free, xeno-free and foetal bovine serum media for human bone marrow mesenchymal stromal cell expansion and differentiationFrontiers in bioengineering and biotechnology36949882ed. 2.2 Isolation and expansion of hBMSCs Fresh human whole bone marrow from the iliac crest of two different donors (donor 1: female, 22 years old; donor 2: male, 25 years old) was purchased from AllCells (United States) and hBMSCs were isolated uFull Paper
2023Dempsey, MP;Andersen, KE;Wells, BM;Taylor, MA;Cashman, CL;Conrad, LB;Kearney, CA;Conklin, MB;Via, ER;Doe, EM;Komirisetty, R;Dearborn, S;Reddy, ST;Farias-Eisner, R;Stability Characterization of the Novel Anti-Cancer HM-10/10 HDL-Mimetic PeptideInternational journal of molecular sciences3737320382043-96OD), one plate per lot, were obtained from In Vitro ADMET Laboratories (Malden, MA, USA). The transport medium was replaced with 200 ?L of warm (37 C) SaveFull Paper
2023El Ouardi, M;Tamarit, L;Vayá, I;Miranda, MA;Andreu, I;Cellular photo(geno)toxicity of gefitinib after biotransformationFrontiers in pharmacology37351506UPV-CSIC, Universitat Politècnica de València, Valencia, Spain 2 Unidad Mixta de Investigación UPV- IIS La Fe, Hospital Universitari i Politècnic La Fe, Valencia, Spain Edited by: Albert P. Li, In Vitro ADMET Laboratories, United States Reviewed byFull Paper
2023Takei, S;Kinoshita, H;Jamal, M;Kumihashi, M;Yamashita, T;Tanaka, E;Kawahara, S;Abe, H;Tsutsui, K;Kimura, S;Case report: Fatal poisoning caused by additive effects of two barbituratesFrontiers in pharmacology37292155Medicine, Faculty of Medicine, Kagawa University, Takamatsu, Japan 2 Biodesign Inc, Tokyo, Japan 3 Kagawa Prefectural University of Health Sciences, Takamatsu, Kagawa, Japan Edited by: Albert P. Li, In Vitro ADMET Laboratories, United States ReviewFull Paper
2023Li, S;Zhan, J;Wang, Y;Oduro, PK;Owusu, FB;Zhang, J;Leng, L;Li, R;Wei, S;He, J;Wang, Q;Suxiao Jiuxin Pill attenuates acute myocardial ischemia via regulation of coronary artery toneFrontiers in pharmacology37234713vestigated. The EC50 and Rmax (maximal vasorelaxation) values were then calculated. 2.8 Cell culture and western blotting analysis Human umbilical vein endothelial cells (HUVECs) were purchased from AllCells Biotech Co., Ltd. (Shanghai, China). TheFull Paper
2023Greenstein, AE;Hunt, HJ;The glucocorticoid receptor modulator relacorilant reverses the immunosuppressive effects of cortisolInternational immunopharmacology37230031GR was assessed using a rabbit monoclonal antibody clone D8H2 from Cell Signaling Technology (Cat#3660S) as described previously [41]. CD3 (Dako, A0452), FOXP3 (eBioscience 14-4777), CD57 (ThermoFisher, MA5-12008), and PD-1 (Abcam, ab53587) were acquFull Paper
2023Cyr, MG;Wilson, HD;Spierling, AL;Chang, J;Peng, H;Steinberger, P;Rader, C;Concerted Antibody and Antigen Discovery by Differential Whole-cell Phage Display Selections and Multi-omic Target DeconvolutionJournal of molecular biology37019174Fresh healthy donor PBMCs were bought from AllCells and cryopreserved prior to use with 50% FBS, 10% DMSO in RPMI-1640 medium. SaveFull Paper
2023Isaioglou, I;Aldehaiman, MM;Li, Y;Lahcen, AA;Rauf, S;Al-Amoodi, AS;Habiba, U;Alghamdi, A;Nozue, S;Habuchi, S;Salama, KN;Merzaban, JS;CD34+ HSPCs-derived exosomes contain dynamic cargo and promote their migration through functional binding with the homing receptor E-selectinFrontiers in cell and developmental biology37181754O2 concentration of 5% v/v. The cell cultures were passaged frequently to maintain the cells at 0.8 × 106 cells/ml. Primary human AML CD34+ cells from Mobilized Peripheral Blood were purchased from AllCells, while Primary Human CD34+ cells from MobiFull Paper
2023Basu, A;Champagne, RN;Patel, NG;Nicholson, ED;Weiss, RJ;TFCP2 is a transcriptional regulator of heparan sulfate assembly and melanoma cell growthThe Journal of biological chemistry37061003in Table S4. RNA sequencing and differential gene expression analysis Total RNA extracted from wildtype and knockout cell lines was submitted for library preparation and next-generation sequencing (HudsonAlpha Discovery). Raw RNA sequencing data wasFull Paper
2023Spriano, F;Aresu, L;Cascione, L;Risi, G;Arribas, AJ;Napoli, S;Forster-Gross, N;Bachmann, F;Engelhardt, M;Lane, H;Bertoni, F;The microtubule-targeted agent lisavanbulin (BAL101553) shows anti-tumor activity in lymphoma modelsAmerican journal of cancer research37293172(TMA) (LY1001D and LY2086B, TissueArray.com) were stained for EB1 using a CE-marked immunohistochemistry Clinical Trial Assay (Discovery Life Sciences Biomarker SaveFull Paper
2023Baraibar, I;García, A;Salvà, F;Ros, J;Saoudi, N;Comas, R;Castillo, G;Sanchis, M;García-Álvarez, A;Hernando, J;Capdevila, J;Castells, MR;Martí, M;Landolfi, S;Espín, E;Navalpotro, B;Guevara, J;Dopazo, C;Nuciforo, P;Vivancos, A;Tabernero, J;Élez, E;Impact of the COVID-19 pandemic in the early-onset colorectal cancerTranslational oncology37031602Paolo Nuciforo reports personal financial interest in form of scientific consultancy role for Targos Molecular Pathology. His-institution has received research funding from Save;- Paolo Nuciforo reports personal financial interest in form of scieFull Paper
2023Pousse, L;Korfi, K;Medeiros, BC;Berrera, M;Kumpesa, N;Eckmann, J;Hutter, IK;Griesser, V;Karanikas, V;Klein, C;Amann, M;CD25 targeting with the afucosylated human IgG1 antibody RG6292 eliminates regulatory T cells and CD25+ blasts in acute myeloid leukemiaFrontiers in oncology37205201Frozen healthy BMMC were purchased from Discovery Life Sciences. All human samples were collected under the approval of the relevant Institutional Review Board (IRB SaveFull Paper
2023Kourula, S;Derksen, M;Jardi, F;Jonkers, S;van Heerden, M;Verboven, P;Theuns, V;Van Asten, S;Huybrechts, T;Kunze, A;Frazer-Mendelewska, E;Lai, KW;Overmeer, R;Roos, JL;Vries, RGJ;Boj, SF;Monshouwer, M;Pourfarzad, F;Snoeys, J;Intestinal organoids as an in vitro platform to characterize disposition, metabolism, and safety profile of small moleculesEuropean journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences37244450Intestinal organoids derived from LGR5 + adult stem cells allow for long-term culturing, more closely resemble human physiology than traditional intestinal models, like Save;- HQM Incubation Medium and co-factor N were acquired from in vitro ADMEFull Paper
2023Gnanapragasam, MN;Planutis, A;Glassberg, JA;Bieker, JJ;Identification of a genomic DNA sequence that quantitatively modulates KLF1 transcription factor expression in differentiating human hematopoietic cellsScientific reports37165057is human GRCh37/hg19 genome browser (https://main.genome-browser.bx.psu.edu/index.html), focusing on results using CD34+ or bone marrow derived erythroid cells. Human CD34+ cells were purchased from AllCells or obtained from the Yale Cooperative CenFull Paper
2023Li, J;Zhang, Z;Zhuang, Y;Wang, F;Cai, T;Small RNA transcriptome analysis using parallel single-cell small RNA sequencingScientific reports37160973ng). PBMCs preparation Cryopreserved CD3+ Pan T cells (PB009-1F-C-5M), CD19+ B cells (PB010-P-F-C), CD14+ monocytes (PB-011-P-F-1-C), and CD56+ natural killer cells (PB012-P-F-C) were purchased from AllCells (Shanghai, China). The CD3+ Pan T cells wFull Paper
2023Ke, H;Zhang, F;Wang, J;Xiong, L;An, X;Tu, X;Chen, C;Wang, Y;Mao, B;Guo, S;Ju, C;He, X;Sun, R;Zhang, L;O'Connor, OA;Li, QX;HX009, a novel BsAb dual targeting PD1 x CD47, demonstrates potent anti-lymphoma activity in preclinical modelsScientific reports37012357Gibco). Jurkat-CSR cells, from ImmuneOnco Biopharmaceuticals (Shanghai), were cultured in RPMI-1640 (Gibco) with 10% FBS (Gemini). Human PBMCs used in the studies were purchased from ALLCELL (https://allcells.com) where informed consent and approvedFull Paper
2023Adhikary, G;Heipertz, EL;Preradovic, M;Chen, X;Xu, W;Newland, JJ;Kaur, N;Vemuri, MC;Eckert, RL;Natural killer cells suppress human cutaneous squamous cell carcinoma cancer cell survival and tumor growthMolecular carcinogenesis36994661Cryopreserved peripheral blood mononuclear cells (PBMCs) were obtained from AllCells. NK cells were enriched via negative selection using the Human NK Cell SaveFull Paper
2023Sweeney, EE;Sekhri, P;Telaraja, D;Chen, J;Chin, SJ;Chiappinelli, KB;Sanchez, CE;Bollard, CM;Cruz, CRY;Fernandes, R;Engineered tumor-specific T cells using immunostimulatory photothermal nanoparticlesCytotherapy37278683ix-coated plates in Astrocyte Medium (Thermo Fisher Scientific). Cells were expanded as per the specifications provided by the supplier. Healthy donor peripheral blood leukopaks were purchased from AllCells (Alameda, CA, USA) with the corresponding hFull Paper
2023Zhang, L;Yu, L;Xu, Y;Qin, P;Shen, P;Liu, K;Fei, M;Wang, H;Cao, Y;Lu, L;Gao, W;Zhang, Z;Demonstrating analytical similarity of a biosimilar HLX04 to bevacizumab with a panel of state-of-the-art methods and tiering of quality attributesAnalytical and bioanalytical chemistry37162525Human umbilical vein endothelial cell (HUVEC), obtained from Allcells (No. H-001F, CA, USA), was used to determine the inhibitory effects of HLX04 and CN-/EU-Avastin® on proliferation of cells expressing VEGFR. HUVEC expresses VEGFR that binds to VEGFull Paper
2023Verner, EL;Jackson, JB;Severson, E;Valkenburg, KC;Greer, AE;Riley, DR;Sausen, M;Maddox, C;McGregor, PM;Karandikar, A;Hastings, SB;Previs, RA;Reddy, VP;Jensen, TJ;Ramkissoon, SH;Validation of the Labcorp Plasma Focus Test to Facilitate Precision Oncology Through Cell-Free DNA Genomic Profiling of Solid TumorsThe Journal of molecular diagnostics : JMD37068734Clinical samples used to evaluate the analytical performance of the Labcorp Plasma Focus test were sourced from multiple biorepositories or as part of internal sample collections (BioIVT, Chestertown, MD; Discovery Life Sciences, Huntsville, AL; PrecFull Paper
2023Ding, H;Yao, B;Ci, L;Feng, J;Ouyang, P;Chen, G;Hui, X;Zhou, D;Enhancing the Anti-tumor Potency of a Novel Siglec-15 Antibody by Engineering its Fc-mediated Effector FunctionsJournal of immunotherapy (Hagerstown, Md. : 1997)37103472Total PBMCs (AllCells) from a healthy human donor were resuspended in cell culture media (RPMI1640 + 10% FBS) at a density of 150,000 cells per well in triplicate. SaveFull Paper
2023Ekiciler, A;Chen, WLK;Bo, Y;Pugliano, A;Donzelli, M;Parrott, N;Umehara, K;Quantitative Cytochrome P450 3A4 Induction Risk Assessment Using Human Hepatocytes Complemented with Pregnane X Receptor-Activating ProfilesDrug metabolism and disposition: the biological fate of chemicals36460477on 24- or 96-well collagen I-coated plates at 0.6 or 0.06 × 10 6 cells/well, respectively, using high viability cryo-hepatocyte recovery kits (In Vitro ADMET Laboratories, LLC; SaveFull Paper
2023Bell-Glenn, S;Salas, LA;Molinaro, AM;Butler, RA;Christensen, BC;Kelsey, KT;Wiencke, JK;Koestler, DC;Calculating detection limits and uncertainty of reference-based deconvolution of whole-blood DNA methylation dataEpigenomics37337720Cells used to isolate the DNA to create the mixtures were purchased from AllCells corporation (CA, USA), StemExpress (CA, USA), and STEMCELL Technologies ( SaveFull Paper
2023Banerjee, P;Diniz, WJS;Rodning, SP;Dyce, PW;miRNA expression profiles of peripheral white blood cells from beef heifers with varying reproductive potentialFrontiers in genetics37234872The quality-checked libraries were pooled and sequenced in the NextSeq 500 using the single-end 50 bp chemistry at Discovery Life Sciences (Hudson Alpha Institute of Save;nt Bioanalyzer high-sensitivity DNA assay (Agilent, Santa Clara, CA, United SFull Paper
2023Lamothe, RC;Storlie, MD;Espinosa, DA;Rudlaff, R;Browne, P;Liu, J;Rivas, A;Devoto, A;Oki, J;Khoubyari, A;Goltsman, DSA;Lin, JL;Butterfield, CN;Brown, CT;Thomas, BC;Cost, GJ;Novel CRISPR-Associated Gene-Editing Systems Discovered in Metagenomic Samples Enable Efficient and Specific Genome EngineeringThe CRISPR journal37219969oporation, cells were harvested for flow cytometry and genomic DNA extraction as described previously. Primary HSC culture and nucleofection Mobilized peripheral blood CD34+ cells were acquired from AllCells and cultured in StemCell StemSpan SFEM IFull Paper
2023Alexander, GE;Lin, W;Ortega, FE;Ramaiah, M;Jung, B;Ji, L;Revenkova, E;Shah, P;Croisetiere, C;Berman, JR;Eubank, L;Naik, G;Brooks, J;Mich, A;Shojaee, S;Ronaghi, N;Chawla, H;Hou, X;Liu, Q;Yakym, CAV;Moradi, PW;Halks-Miller, M;Aravanis, AM;Parpart-Li, S;Hunkapiller, N;Analytical validation of a multi-cancer early detection test with cancer signal origin using a cell-free DNA-based targeted methylation assayPloS one37058491Six non-cancer samples were obtained from Discovery Life Sciences (Huntsville, AL; catalog #s 220130 and 220140) and 6 cancer samples were obtained from Save;ncer) across dilution series created by spiking cfDNA from cancer samples into cfDNA derivFull Paper
2023Li, X;Le, Y;Seo, JE;Guo, X;Li, Y;Chen, S;Mittelstaedt, RA;Moore, N;Guerrero, S;Sims, A;King, ST;Atrakchi, AH;McGovern, TJ;Davis-Bruno, KL;Keire, DA;Elespuru, RK;Heflich, RH;Mei, N;Revisiting the mutagenicity and genotoxicity of N-nitroso propranolol in bacterial and human in vitro assaysRegulatory toxicology and pharmacology : RTP37210026National Center for Toxicological Research, U.S. Food and Drug Administration, Jefferson, AR, 72079, USA. Electronic address: xilin.li@fda.hhs.gov.++National Center for Toxicological Research, U.S. Food and Drug Administration, Jefferson, AR, 72079,Full Paper
2023Coleman, R;Metastasis prevention with bone-targeted agents: a complex interaction between the microenvironment and tumour biologyJournal of bone and mineral metabolism37162605amplification status was blinded and followed pre-specified sample handling and standard operating methodology by a central laboratory (Targos Molecular Pathology, SaveFull Paper
2023Kliver, S;Houck, ML;Perelman, PL;Totikov, A;Tomarovsky, A;Dudchenko, O;Omer, AD;Colaric, Z;Weisz, D;Aiden, EL;Chan, S;Hastie, A;Komissarov, A;Ryder, OA;Graphodatsky, A;Johnson, WE;Maldonado, JE;Pukazhenthi, BS;Marinari, PE;Wildt, DE;Koepfli, KP;Chromosome-length genome assembly and karyotype of the endangered black-footed ferret (Mustela nigripes)The Journal of heredity37249392The black-footed ferret (Mustela nigripes) narrowly avoided extinction to become an oft-cited example of the benefits of intensive management, research, and collaboration SaveFull Paper
2023Martha, L;Nakata, A;Furuya, S;Liu, W;Zhang, X;Mizoi, K;Ogihara, T;Transporter and metabolic enzyme-mediated intra-enteric circulation of SN-38, an active metabolite of irinotecan: A new conceptBiochemical and biophysical research communications37148742sages 72-83 were used. Human cryopreserved suspension enterocytes (Lot. HE3072, male, 55 years old, Caucasian) were purchased from In Vitro ADMET Laboratories (MD, USA). All other reagents and solvents were commercial products of special gradeFull Paper
2023He, S;Liu, J;Hu, L;Zhan, Y;Tong, H;Zhu, H;Guo, H;Sun, H;Liu, M;Design, synthesis, biological evaluation and molecular docking studies of quercetin-linker-H2S donor conjugates for the treatment of diabetes and wound healingChemistry & biodiversity37329234All cell culture materials were obtained from Gibco. HepG2 cells were cryopreserved in our laboratory and used after resuscitation. HUVECs cells were purchased from Shanghai Allcells Co., LtdFull Paper
2023Thompson, EN;Carlino, MJ;Scanlon, VM;Grimes, HL;Krause, DS;Assay optimization for the objective quantification of human multilineage colony-forming unitsExperimental hematology37271449Cells were derived commercially (AllCells, Alameda, CA) or were derived from healthy donors who were already donating cells for allogeneic transplantation provided SaveFull Paper
2023Goda, C;Kolovich, S;Rudich, A;Karunasiri, M;Kulkarni, R;Rajgolikar, G;Neidemire-Colley, L;Singh, S;Sircar, A;Ranganathan, P;Garzon, R;Sehgal, L;Dorrance, AM;Epidermal growth factor-like 7 is a novel therapeutic target in mantle cell lymphomaExperimental hematology37209901Full Paper
2023Yi, PC;Zhuo, L;Lin, J;Chang, C;Goddard, A;Yoon, OK;Impact of delayed PBMC processing on functional and genomic assaysJournal of immunological methods37353001An additional five whole blood samples from healthy adults were sourced from AllCells (Alameda, CA, USA), all of whom provided informed consent, under their IRB- SaveFull Paper
2023Chen, Z;Javed, N;Moore, M;Wu, J;Sun, G;Vinyard, M;Collins, A;Pinello, L;Najm, FJ;Bernstein, BE;Integrative dissection of gene regulatory elements at base resolutionCell genomics37388913us Biologicals Cat#NB100-1800 TAL1 antibody SantaCruz Biotech Cat#sc-393287 Cell lines and primary cells Jurkat cell line, Clone E6.1 ATCC Cat#TIB152, RRID:CVCL_0367 CD4+ T cells AllCells N/A ------------------------- ChemicalFull Paper
2023Kessler, ER;Callihan, E;Hu, J;Eule, C;Srivastava, G;Kemme, DJ;Iruku, P;Rana, V;Moore, J;Schuster, SR;Amirault, M;Flaig, TW;Lam, ET;A Phase I/II Clinical Trial of Pembrolizumab and Cabozantinib in Metastatic Renal Cell CarcinomaCancer research communications37377613Full Paper
2023Farabaugh, CS;Doak, S;Roy, S;Elespuru, R;In vitro micronucleus assay: Method for assessment of nanomaterials using cytochalasin BFrontiers in toxicology37180488Urbana?Champaign, Champaign, United States Khaled Habas, University of Bradford, United Kingdom *Correspondence: Rosalie Elespuru, rosalie.elespuru@dls.com † Present address: Rosalie Elespuru, Discovery Life Sciences, Columbia, MD, United StatesFull Paper
2023Baro-Sastre, B;Kim, CY;Lin, C;Kongsomboonvech, AK;Tetard, M;Salinas, ND;Tolia, NH;Egan, ES;Plasmodium falciparum exploits CD44 as a co-receptor for erythrocyte invasionbioRxiv : the preprint server for biology37090581Generation of cRBCs was performed essentially as previously described 37. Briefly, bone marrow primary human CD34+ HSPCs (Stem Cell Technologies; AllCells) were cultured in PIMDM composed of Iscove Basal Medium (Sigma) with 4 mM L-Glutamine, 330 µg/mFull Paper
2023Okano, F;Saito, T;Minamida, Y;Kobayashi, S;Ido, T;Miyauchi, Y;Wasai, U;Akazawa, D;Kume, M;Ishibashi, M;Jiang, K;Aicher, A;Heeschen, C;Yonehara, T;Identification of Membrane-expressed CAPRIN-1 as a Novel and Universal Cancer Target, and Generation of a Therapeutic Anti-CAPRIN-1 Antibody TRK-950Cancer research communications37082579ng formula based on the Cr-51 dose released from the target cells: The ADCC activity of TRK-950 via human and monkey PBMCs was conducted at Translational Drug Development (TD2). We used human PBMCs (AllCells, catalog no. PB003F) and Cynomolgus MonkeFull Paper
2023Montalban-Bravo, G;Ma, F;Thongon, N;Yang, H;Gomez, IG;Rodriguez-Sevilla, JJ;Adema, V;Wildeman, B;Lockyer, P;Kim, YJ;Tanaka, T;Darbaniyan, F;Pancholy, S;Zhang, G;Al-Atrash, G;Dwyer, K;Takahashi, K;Garcia-Manero, G;Kantarjian, H;Colla, S;Targeting MCL1-driven anti-apoptotic pathways to overcome hypomethylating agent resistance in RAS -mutated chronic myelomonocytic leukemiabioRxiv : the preprint server for biology37066354RAS pathway mutations, which are present in 30% of patients with chronic myelomonocytic leukemia (CMML) at diagnosis, confer a high risk of resistance to and SaveFull Paper
2023Dillon, LW;Higgins, J;Nasif, H;Othus, M;Beppu, L;Smith, TH;Schmidt, E;Valentine, CC;Salk, JJ;Wood, BL;Erba, HP;Radich, JP;Hourigan, CS;Quantification of measurable residual disease using duplex sequencing in adults with acute myeloid leukemiamedRxiv : the preprint server for health sciences37034683The presence of measurable residual disease (MRD) is strongly associated with treatment outcomes in acute myeloid leukemia (AML). Despite the correlation with clinical SaveFull Paper
2023Flümann, R;Hansen, J;Pelzer, BW;Nieper, P;Lohmann, T;Kisis, I;Riet, T;Kohlhas, V;Nguyen, PH;Peifer, M;Abedpour, N;Bosco, G;Thomas, RK;Kochanek, M;Knüfer, J;Jonigkeit, L;Beleggia, F;Holzem, A;Büttner, R;Lohneis, P;Meinel, J;Ortmann, M;Persigehl, T;Hallek, M;Calado, DP;Chmielewski, M;Klein, S;Göthert, JR;Chapuy, B;Zevnik, B;Wunderlich, FT;von Tresckow, B;Jachimowicz, RD;Melnick, AM;Reinhardt, HC;Knittel, G;Distinct Genetically Determined Origins of Myd88/BCL2-Driven Aggressive Lymphoma Rationalize Targeted Therapeutic Intervention StrategiesBlood cancer discovery36346827Roche, Cofounder and CSO of Targos MP Inc. (until May 2021), Gnothis Inc/Stockholm (Member of Board of Directors and Coowner). D.P. Calado reports other support from Cancer Research UK (CC2078), Wellcome Trust (CC2078), and UK Medical Research CounciFull Paper
2023Mark W., R;Joanne, W;Mary Jo, K;Melissa E., M;John V., L;Peter, F;Sleep Disturbances and Chronic Pain as Potential Indicators for Therapeutic Intervention in Subjects with Post-Traumatic Stress DisorderJournal of Depression and Anxiety Disorderscruited to an age and gender-matched case-control study (N = 78; control n = 39; PTSD n = 39). Participants were recruited in the US between January and June 2019 by PrecisionMed (California, US) and Discovery Life Sciences (California, US). A compreFull Paper
2023Buckley, D;Tew, B;Gooden, G;Salhia, B;Whole genome bisulfite sequencing of tumor DNA and matching cfDNA in relapsed pediatric cancerResearch Squarefrom Conversant Bio (Table 1). Twelve additional cfDNA healthy controls from adults were included for model building in cfDNA, detailed below (Conversant Bio). Patients SaveFull Paper
2023Ridzuan, A;Sebastian, A;Noorazman, A;Kannan, T;Syed, N;Nurul, A;Interleukin-17A enhances osteogenic differentiation by activating ERK/MAPK in stem cells derived from human exfoliated deciduous teethBiomedical Research and Therapythe participation of the MAPK signaling pathway in SHED osteogenic differentiation. MATERIALS AND METHODS CELL CULTURE AND OSTEOGENIC DIFFERENTIATION IN VITRO The SHED cell line, obtained from ALLCELLS (Alameda, CA, USA), was derived from humaFull Paper
2023Pillsbury, C;Dougan, J;Rabe, J;Fonseca, J;Zhou, C;Evans, A;Abukharma, H;Ichoku, O;Gonzalez-Flamenco, G;Park, S;Aljudi, A;DeRyckere, D;Castellino, S;Rafiq, S;Langermann, S;Liu, L;Henry, C;Porter, C;Siglec-15 promotes evasion of adaptive immunity in B-cell acute lymphoblastic leukemiaCancer Research CommunicationsAll samples were acquired after written informed consent was provided. Residual, fresh bone marrow aspirate and peripheral blood samples from pediatric B-ALL patients were analyzed for Sig15 expression by flow cytometry under protocol (IRB#96145). BoFull Paper
2023Kessler, E;Callihan, E;Hu, J;Eule, C;Srivastava, G;Kemme, D;Iruku, P;Rana, V;Moore, J;Schuster, S;Amirault, M;Flaig, T;Lam, E;Data from A Phase I/II Clinical Trial of Pembrolizumab and Cabozantinib in Metastatic Renal Cell CarcinomaAmerican Association for Cancer ResearchPD-L1 testing was performed on archival tumor tissues by Discovery Life Sciences (formerly QualTek Molecular Laboratories) using a previously validated IHC assay for SaveFull Paper
2023Sharma, P;Zhang, X;Ly, K;Kim, J;Wan, Q;Kim, J;Lou, M;Kain, L;Teyton, L;Winau, F;Hyperglycosylation of prosaposin in tumor DCs promotes immune escape in cancerbioRxivDissociated whole tumor samples were purchased from Discovery Life Sciences (USA). Melanoma, myeloid, and CD8 T cells were FACS-sorted as described above. Melanoma cells were ?-irradiated (10,000 rad), and induction of apoptosis wasFull Paper
2023Tierney, B;Foox, J;Ryon, K;Butler, D;Damle, N;Young, B;Mozsary, C;Babler, K;Yin, X;Carattini, Y;Andrews, D;Solle, N;Kumar, N;Shukla, B;Vidovic, D;Currall, B;Williams, S;Schürer, S;Stevenson, M;Amirali, A;Beaver, C;Kobetz, E;Boone, M;Reding, B;Laine, J;Comerford, S;Lamar, W;Tallon, J;Hirschberg, J;Proszynski, J;Sharkey, M;Church, G;Grills, G;Solo-Gabriele, H;Mason, C;Geospatially-resolved public-health surveillance via wastewater sequencingmedRxiv550 HudsonAlpha Discovery (Huntsville, AL) performed all sequencing library preparation on the 551 generated nucleic acids. The nucleic acid samples underwent SaveFull Paper
2023Zhang, X;Meng, F;Lyu, W;He, J;Wei, R;Du, Z;Zhang, C;Guan, Y;Huang, X;Lyu, G;Tian, X;Zhang, L;Tao, W;Histone lactylation antagonizes senescence and skeletal muscle aging via facilitating gene expression reprogrammingbioRxivIMR90 cells were purchased from the American Type Culture Collection (ATCC), HUVECs were purchased from AllCells, and MEF cells were isolated from 12.5-14- day-old embryos of C57BL/6 miceFull Paper
2023Sorensen, JT;Classification of a novel subgroup of shared hepatitis B virus core and e antigen epitopes and their antibody reactivity in clinical immunoassay formatsThesisProtocols for BSL-2 ELISA are summarized in section 5.3.1. HBV positive samples were all purchased from Discovery Life Sciences Biological Sample RepositoryFull Paper
2023Najia, MA;Transposable elements and the regulatory logic of hematopoietic differentiationThesisumbilical cord blood cells (AllCells) were thawed from liquid nitrogen storage via CD34+ umbilical cord blood cells (AllCells) were thawed from liquid nitrogen storage and SaveFull Paper
2023Schejtman Borisonik, A;Lentiviral gene therapy for p47-deficient Chronic Granulomatous diseaseThesisCD34+ cells used in the experiments were frozen vials of previously isolated HD CD34+ cells from a G-CSF mobilised apheresis (ALLCells) using the CliniMACS prodigyFull Paper
2023Kortchak, S;Development of Programmed Cell Death Ligand Derived Peptides for the Treatment of Autoimmune DiseasesThesisCell Culture. Jurkat NFAT-PD-1 reporter cells (BPS Biosciences, San Diego, CA) were maintained in Growth Medium 2A (BPS Biosciences, San Diego, CA) medium. Peripheral blood mononuclear cells (PBMCs) were purchased from AllCells and maintained in RPMIFull Paper
2023Maughon Jr, TS;Metabolic Profiling of Mesenchymal Stromal Cells for Critical Quality Attribute IdentificationThesisat three densities (10,000, 5,000 and 2,000 cells/well) in a 96 well plate and cultured for 24 hours. PBMCs (AllCells, Alameda CA) were thawed in Roswell Park Memorial Institute (RPMI) media (RPMI, 20% FBS, 2mM L-glutamine, 50 U/mL penicillin, 50 ?g/Full Paper
2023Han, L;Dong, L;Leung, K;Zhao, Z;Li, Y;Gao, L;Chen, Z;Xue, J;Qing, Y;Li, W;Pokharel, SP;Gao, M;Chen, M;Shen, C;Tan, B;Small, A;Wang, K;Zhang, Z;Qin, X;Yang, L;Wunderlich, M;Zhang, B;Mulloy, JC;Marcucci, G;Chen, CW;Wei, M;Su, R;Chen, J;Deng, X;METTL16 drives leukemogenesis and leukemia stem cell self-renewal by reprogramming BCAA metabolismCell stem cell36608679ColonyGEL-Mouse Base Medium Reachbio Cat# 1201 ColonyGEL -Human Base Medium Reachbio Cat# 1101Full Paper
2023Le Floc'h, A;Nagashima, K;Birchard, D;Scott, G;Ben, LH;Ajithdoss, D;Gayvert, K;Romero Hernandez, A;Herbin, O;Tay, A;Farrales, P;Korgaonkar, CK;Pan, H;Shah, S;Kamat, V;Chatterjee, I;Popke, J;Oyejide, A;Lim, WK;Kim, JH;Huang, T;Franklin, M;Olson, W;Norton, T;Perlee, L;Yancopoulos, GD;Murphy, AJ;Sleeman, MA;Orengo, JM;Blocking common γ chain cytokine signaling ameliorates T cell-mediated pathogenesis in disease modelsScience translational medicine36630481To induce GVHD, we injected immunodeficient NSG (Jackson Laboratory, 005557) female mice (8 weeks old) retro-orbitally with 10 7 human PBMCs (ReachBio, 0500-401). Mice were SaveFull Paper
2023Wang, H;Georgakopoulou, A;Zhang, W;Kim, J;Gil, S;Ehrhardt, A;Lieber, A;HDAd6/35++ - A new helper-dependent adenovirus vector platform for in vivo transduction of hematopoietic stem cellsMolecular therapy. Methods & clinical development37081854Lineage-negative (Lin-) cells were isolated by depletion of lineage-committed cells in BM MNCs using the mouse lineage cell depletion kit (Miltenyi Biotec) according to the manufacturer’s instructions. Colony-forming unit assays were performed usingFull Paper
2023Belcher, JD;Nataraja, S;Abdulla, F;Zhang, P;Chen, C;Nguyen, J;Ruan, C;Singh, M;Demes, S;Olson, L;Stickens, D;Stanwix, J;Clarke, E;Huang, Y;Biddle, M;Vercellotti, GM;The BACH1 inhibitor ASP8731 inhibits inflammation and vaso-occlusion and induces fetal hemoglobin in sickle cell diseaseFrontiers in medicine37144034Department of Medicine, Division of Hematology, Oncology and Transplantation, University of Minnesota, Minneapolis, MN, United States.++Mitobridge Inc., Cambridge, MA, United States.++Department of Medicine, Division of Hematology, Oncology and TransFull Paper
2023Wu, T;Pelus, LM;Plett, PA;Sampson, CH;Chua, HL;Fisher, A;Feng, H;Liu, L;Li, H;Ortiz, M;Chittajallu, S;Luo, Q;Bhatwadekar, AD;Meyer, TB;Zhang, X;Zhou, D;Fischer, KD;McKinzie, DL;Miller, SJ;Orschell, CM;Further Characterization of Multi-Organ DEARE and Protection by 16,16 Dimethyl Prostaglandin E2 in a Mouse Model of the Hematopoietic Acute Radiation SyndromeRadiation research37014943Total nucleated BM cells from non-irradiated mice were plated at 2 × 104 per dish in ColonyGEL 1202 Mouse Complete Medium (Reach Bio, Seattle, WA)Full Paper
2023Borot, F;Humbert, O;Newby, GA;Fields, E;Kohli, S;Radtke, S;Laszlo, GS;Mayuranathan, T;Ali, AM;Weiss, MJ;Yen, JS;Walter, RB;Liu, DR;Mukherjee, S;Kiem, HP;Multiplex Base Editing to Protect from CD33-Directed Therapy: Implications for Immune and Gene TherapybioRxiv : the preprint server for biology36865281Cord blood CD34+ 526 cells were 527 additionally cultured with UM171 0.35 nM (Xcessbio). In colony-forming cell assays, 1000-1200 528 sorted cells were seeded into 3.5 ml ColonyGEL 1402 (ReachBio)Full Paper
2023Vujovic, A;de Rooij, L;Chahi, AK;Chen, HT;Yee, BA;Loganathan, SK;Liu, L;Chan, DCH;Tajik, A;Tsao, E;Moreira, S;Joshi, P;Xu, J;Wong, N;Balde, Z;Jahangiri, S;Zandi, S;Aigner, S;Dick, JE;Minden, MD;Schramek, D;Yeo, GW;Hope, KJ;In Vivo Screening Unveils Pervasive RNA-Binding Protein Dependencies in Leukemic Stem Cells and Identifies ELAVL1 as a Therapeutic TargetBlood cancer discovery36763002Thawed primary AML samples were counted and plated in a methylcellulose-based hematopoietic colony formation medium (Colony Gel, ReachBio cat. no. 1102), supplemented with 1.1 μmol/L DHTS (MilliporeSigma; cat. no. D0947-10MG) or equivalent DMSO (FishFull Paper
2023Zhang, Z;Zhou, K;Han, L;Small, A;Xue, J;Huang, H;Weng, H;Su, R;Tan, B;Shen, C;Li, W;Zhao, Z;Qing, Y;Qin, X;Wang, K;Leung, K;Boldin, M;Chen, C;Ann, D;Qian, Z;Deng, X;Chen, J;Chen, Z;RNA m6A reader YTHDF2 facilitates precursor miR-126 maturation to promote acute myeloid leukemia progressionGenes & DiseasesColonyGel 1201-mouse base medium (1201, Reachbio) were used for seeding cells at 20, 000 per 35 mm dish. Murine cytokines and reagents were supplemented as follows: 10 ng/ SaveFull Paper
2023Davies, J;Prieto, EM;Guelcher, S;Characterization of Macrophage Behavior in the Human Immunoresponse and Bone Remodelingcdn.vanderbilt.eduWe cultured primary human monocytes (Reachbio, Seattle, WA) in Corning T25 flasks with 10 mL of modified Dulbecco’s modified Eagle medium (DMEM) media and split them every 9 days. We changed media on Day 1, 5, and 7, according to Table 1. PenicillinFull Paper
2023Vujovic, A;Investigating RNA-Binding Protein Dependencies in Hematopoietic and Acute Myeloid Leukemic Stem CellsThesisThawed primary AML samples were counted and plated in a methylcellulose-based hematopoietic colony formation medium (Colony Gel, ReachBio Cat# 1102), supplemented with 1.1μM DHTS (MilliporeSigma Cat# D0947-10MG) or equivalent DMSO (Fisher ScientificFull Paper
2022Somarathna, M;Hwang, PT;Millican, RC;Alexander, GC;Isayeva-Waldrop, T;Sherwood, JA;Brott, BC;Falzon, I;Northrup, H;Shiu, YT;Stubben, CJ;Totenhagen, J;Jun, HW;Lee, T;Nitric oxide releasing nanomatrix gel treatment inhibits venous intimal hyperplasia and improves vascular remodeling in a rodent arteriovenous fistulaBiomaterials34836683RNA isolation and sequencing were performed by Discovery Life Sciences (Huntsville, AL). Total RNA was isolated using standard Discovery Life Sciences protocols. All samples underwent RNA quality control assessment using a Fragment Analyzer (AgilenFull Paper
2022Choi, DY;Park, JN;Paek, SH;Choi, SC;Paek, SH;Detecting early-stage malignant melanoma using a calcium switch-enriched exosome subpopulation containing tumor markers as a sampleBiosensors & bioelectronics34847362Clinical samples of human sera from healthy donors and malignant melanoma patients were obtained from Discovery Life Sciences (DLS; Los Osos, CA, USA). Other materials are listed and described about the sources in details in Supplementary InformatiFull Paper
2022Bormann Chung, C;Lee, J;Barritault, M;Bringuier, PP;Xu, Z;Huang, WY;Beharry, A;Castillo, J;Christiansen, J;Lin, JC;Sheffield, BS;Evaluating Targeted Next-Generation Sequencing Assays and Reference Materials for NTRK Fusion DetectionThe Journal of molecular diagnostics : JMD34656759The 30 FFPE NTRK fusion-negative tumor samples (confirmed as NTRK fusion negative by an NGS laboratory-developed test) tested in the specificity analyses for AFL, TSO500, and OFA were purchased from Indivumed GmbH (Hamburg, Germany) and Discovery LifFull Paper
2022Freeman, J;Conklin, J;Standardization of two SARS-CoV-2 serology assays to the WHO 20/136 human standard reference materialJournal of virological methods34915088WHO 20/136 is standard reference material for SARS-CoV-2 serology assays. Standardization of serology assays that target the same antigen and class of immunoglobulin will enable comparison of results between studies that use various lab-developed aFull Paper
2022Ganan-Gomez, I;Yang, H;Ma, F;Montalban-Bravo, G;Thongon, N;Marchica, V;Richard-Carpentier, G;Chien, K;Manyam, G;Wang, F;Alfonso, A;Chen, S;Class, C;Kanagal-Shamanna, R;Ingram, JP;Ogoti, Y;Rose, A;Loghavi, S;Lockyer, P;Cambo, B;Muftuoglu, M;Schneider, S;Adema, V;McLellan, M;Garza, J;Marchesini, M;Giuliani, N;Pellegrini, M;Wang, J;Walker, J;Li, Z;Takahashi, K;Leverson, JD;Bueso-Ramos, C;Andreeff, M;Clise-Dwyer, K;Garcia-Manero, G;Colla, S;Stem cell architecture drives myelodysplastic syndrome progression and predicts response to venetoclax-based therapyNature medicine35241842simultaneously received the cytidine deaminase inhibitor E7727 (cedazuridine) to increase HMA bioavailability. BM samples from 21 HDs (median age, 53 years; range, 49-66 years) were obtained from AllCells or from MD Anderson’s Department of Stem CelFull Paper
2022Lebedin, M;Foglierini, M;Khorkova, S;Vázquez García, C;Ratswohl, C;Davydov, AN;Turchaninova, MA;Daubenberger, C;Chudakov, DM;Lanzavecchia, A;de la Rosa, K;Different classes of genomic inserts contribute to human antibody diversityProceedings of the National Academy of Sciences of the United States of America3603735342), and ethical review boards at Ifakara Health Institute and the University of Lausanne, and all volunteers provided informed consent before blood donation. Bone marrow specimens were obtained from AllCells. Extraction of Human PBMCs. Blood sampleFull Paper
2022Simmons, SK;Lithwick-Yanai, G;Adiconis, X;Oberstrass, F;Iremadze, N;Geiger-Schuller, K;Thakore, PI;Frangieh, CJ;Barad, O;Almogy, G;Rozenblatt-Rosen, O;Regev, A;Lipson, D;Levin, JZ;Mostly natural sequencing-by-synthesis for scRNA-seq using Ultima sequencingNature biotechnology36109685We purchased nine cryopreserved human PMBC samples (AllCells). We thawed PBMC vials in a 37 °C water bath for ~2 min. A quick counting revealed high viability (90%) in all samples. We added 1 ml RPMI1640 (Thermo Fisher Scientific, 11875093) with 10%Full Paper
2022Shy, BR;Vykunta, VS;Ha, A;Talbot, A;Roth, TL;Nguyen, DN;Pfeifer, WG;Chen, YY;Blaeschke, F;Shifrut, E;Vedova, S;Mamedov, MR;Chung, JJ;Li, H;Yu, R;Wu, D;Wolf, J;Martin, TG;Castro, CE;Ye, L;Esensten, JH;Eyquem, J;Marson, A;High-yield genome engineering in primary cells using a hybrid ssDNA repair template and small-molecule cocktailsNature biotechnology36008610Primary adult blood cells were obtained from healthy human donors as a leukapheresis pack purchased from StemCell Technologies, Inc. or Allcells Inc, as a Trima residual from Vitalant, or from fresh whole blood under a protocol approved by the UCSF CFull Paper
2022Zhang, B;Srivastava, A;Mimitou, E;Stuart, T;Raimondi, I;Hao, Y;Smibert, P;Satija, R;Characterizing cellular heterogeneity in chromatin state with scCUT&Tag-proNature biotechnology35332340available on the protocols.io platform, here: https://www.protocols.io/private/57E45A034D5311ECA43B0A58A9FEAC02. PBMC acquisition and processing Cryopreserved healthy donor PBMCs were purchased from AllCells. After thawing into DMEM with 10% FBS, thFull Paper
2022Fiskin, E;Lareau, CA;Ludwig, LS;Eraslan, G;Liu, F;Ring, AM;Xavier, RJ;Regev, A;Single-cell profiling of proteins and chromatin accessibility using PHAGE-ATACNature biotechnology34675424Thermo Fisher Scientific), resuspended in DMEM containing 10% FBS, centrifuged, washed with PBS and resuspended in FC buffer (above). For PBMC and CD8 T-cell experiments, cryopreserved PBMCs or CD8 T cells (AllCells) were thawed, washed in PBS and reFull Paper
2022Omer-Javed, A;Pedrazzani, G;Albano, L;Ghaus, S;Latroche, C;Manzi, M;Ferrari, S;Fiumara, M;Jacob, A;Vavassori, V;Nonis, A;Canarutto, D;Naldini, L;Mobilization-based chemotherapy-free engraftment of gene-edited human hematopoietic stem cellsCell35617958V4XP-3032 TaqMan Gene Expression Assay ThermoFisher Scientifi Cat# 4331182 ------------------------- Experimental models: Cell lines ------------------------- Human: G-CSF mPB CD34+ HSPCs AllCells N/A Human: G-CSF/Mozobil mPB CD34+ HSFull Paper
2022Battaglia, S;Dong, K;Wu, J;Chen, Z;Najm, FJ;Zhang, Y;Moore, MM;Hecht, V;Shoresh, N;Bernstein, BE;Long-range phasing of dynamic, tissue-specific and allele-specific regulatory elementsNature genetics36195755Epigenomic maps identify gene regulatory elements by their chromatin state. However, prevailing short-read sequencing methods cannot effectively distinguish alleles, evaluate the SaveFull Paper
2022Bottomly, D;Long, N;Schultz, AR;Kurtz, SE;Tognon, CE;Johnson, K;Abel, M;Agarwal, A;Avaylon, S;Benton, E;Blucher, A;Borate, U;Braun, TP;Brown, J;Bryant, J;Burke, R;Carlos, A;Chang, BH;Cho, HJ;Christy, S;Coblentz, C;Cohen, AM;d'Almeida, A;Cook, R;Danilov, A;Dao, KT;Degnin, M;Dibb, J;Eide, CA;English, I;Hagler, S;Harrelson, H;Henson, R;Ho, H;Joshi, SK;Junio, B;Kaempf, A;Kosaka, Y;Laderas, T;Lawhead, M;Lee, H;Leonard, JT;Lin, C;Lind, EF;Liu, SQ;Lo, P;Loriaux, MM;Luty, S;Maxson, JE;Macey, T;Martinez, J;Minnier, J;Monteblanco, A;Mori, M;Morrow, Q;Nelson, D;Ramsdill, J;Rofelty, A;Rogers, A;Romine, KA;Ryabinin, P;Saultz, JN;Sampson, DA;Savage, SL;Schuff, R;Searles, R;Smith, RL;Spurgeon, SE;Sweeney, T;Swords, RT;Thapa, A;Thiel-Klare, K;Traer, E;Wagner, J;Wilmot, B;Wolf, J;Wu, G;Yates, A;Zhang, H;Cogle, CR;Collins, RH;Deininger, MW;Hourigan, CS;Jordan, CT;Lin, TL;Martinez, ME;Pallapati, RR;Pollyea, DA;Pomicter, AD;Watts, JM;Weir, SJ;Druker, BJ;McWeeney, SK;Tyner, JW;Integrative analysis of drug response and clinical outcome in acute myeloid leukemiaCancer cell35868306Acute myeloid leukemia (AML) is a cancer of myeloid-lineage cells with limited therapeutic options. We previously combined ex vivo drug sensitivity with genomic, transcriptomic, and SaveFull Paper
2022Ma, H;Guo, Y;Tang, H;Tseng, CK;Wang, L;Zong, H;Wang, Z;He, Y;Chang, Y;Wang, S;Huang, H;Ke, Y;Yuan, Y;Wu, M;Zhang, Y;Drelich, A;Kempaiah, KR;Peng, BH;Wang, A;Yang, K;Yin, H;Liu, J;Yue, Y;Xu, W;Zhu, S;Ji, T;Zhang, X;Wang, Z;Li, G;Liu, G;Song, J;Mu, L;Xiang, Z;Song, Z;Chen, H;Bian, Y;Zhang, B;Chen, H;Zhang, J;Liao, Y;Zhang, L;Yang, L;Chen, Y;Gilly, J;Xiao, X;Han, L;Jiang, H;Xie, Y;Zhou, Q;Zhu, J;Broad ultra-potent neutralization of SARS-CoV-2 variants by monoclonal antibodies specific to the tip of RBDCell discovery35169121In ADCP experiment, CD14 + monocytes (Allcells) were cultured and differentiated for 7 days to obtain macrophage cells. Macrophages were labeled with violet dye (ThermoFisher), SaveFull Paper
2022Ferrari, S;Jacob, A;Cesana, D;Laugel, M;Beretta, S;Varesi, A;Unali, G;Conti, A;Canarutto, D;Albano, L;Calabria, A;Vavassori, V;Cipriani, C;Castiello, MC;Esposito, S;Brombin, C;Cugnata, F;Adjali, O;Ayuso, E;Merelli, I;Villa, A;Di Micco, R;Kajaste-Rudnitski, A;Montini, E;Penaud-Budloo, M;Naldini, L;Choice of template delivery mitigates the genotoxic risk and adverse impact of editing in human hematopoietic stem cellsCell stem cell36206730tain Kit Thermo Fisher Cat# L34957 7-aminoactinomycin D Sigma Aldrich SML1633; CAS: 7240-37-1 ------------------------- Biological samples ------------------------- Mobilized Leukopak AllCells N/A ------------------------- ChemicaFull Paper
2022Chan, S;Belmar, N;Ho, S;Rogers, B;Stickler, M;Graham, M;Lee, E;Tran, N;Zhang, D;Gupta, P;Sho, M;MacDonough, T;Woolley, A;Kim, H;Zhang, H;Liu, W;Zheng, P;Dezso, Z;Halliwill, K;Ceccarelli, M;Rhodes, S;Thakur, A;Forsyth, CM;Xiong, M;Tan, SS;Iyer, R;Lake, M;Digiammarino, E;Zhou, L;Bigelow, L;Longenecker, K;Judge, RA;Liu, C;Trumble, M;Remis, JP;Fox, M;Cairns, B;Akamatsu, Y;Hollenbaugh, D;Harding, F;Alvarez, HM;An anti-PD-1-GITR-L bispecific agonist induces GITR clustering-mediated T cell activation for cancer immunotherapyNature cancer35256819Human allogeneic PBMCs (AllCells) were used to purify negatively selected populations of T cells (catalog no. 19051, Stemcell) and CD11b monocytes (catalog no. 19058, Stemcell). SaveFull Paper
2022Dey, M;Kim, M;Dogan, M;Nagamine, M;Kozhaya, L;Celik, N;Unutmaz, D;Ozbolat, I;Chemotherapeutics and CAR‐T Cell‐Based Immunotherapeutics Screening on a 3D Bioprinted Vascularized Breast Tumor ModelAdvanced Functional MaterialsLeukopaks from healthy adults were purchased from ALLCells (Alameda, CA) in deidentified form and processed to isolate Peripheral Blood Mononuclear Cells (PBMCs) using Ficoll-paque plus (GE Healthcare). CD8+ T cells were purified from PBMCs using DynFull Paper
2022Elagib, KE;Brock, A;Clementelli, CM;Mosoyan, G;Delehanty, LL;Sahu, RK;Pacheco-Benichou, A;Fruit, C;Besson, T;Morris, SW;Eto, K;Jobaliya, C;French, DL;Gadue, P;Singh, S;Shi, X;Qin, F;Cornelison, R;Li, H;Iancu-Rubin, C;Goldfarb, AN;Relieving DYRK1A repression of MKL1 confers an adult-like phenotype to human infantile megakaryocytesThe Journal of clinical investigation35925681alculator/hypergeometric.aspx). A P value less than 0.05 was considered significant. Study approval. CD34+ cells purchased from the Fred Hutchinson Cancer Research Center (Seattle, Washington, USA), AllCells (Alameda, California, USA), and StemCellFull Paper
2022Brady, JM;Phelps, M;MacDonald, SW;Lam, EC;Nitido, A;Parsons, D;Boutros, CL;Deal, CE;Garcia-Beltran, WF;Tanno, S;Natarajan, H;Ackerman, ME;Vrbanac, VD;Balazs, AB;Antibody-mediated prevention of vaginal HIV transmission is dictated by IgG subclass in humanized miceScience translational medicine35895834To generate huPBMC-engrafted NSG mice, frozen huPBMCs (AllCells) were thawed and expanded in RPMI 1640 medium (Sigma-Aldrich) supplemented with 10% fetal bovine serum ( SaveFull Paper
2022Jennings, D;Huntwork-Rodriguez, S;Henry, AG;Sasaki, JC;Meisner, R;Diaz, D;Solanoy, H;Wang, X;Negrou, E;Bondar, VV;Ghosh, R;Maloney, MT;Propson, NE;Zhu, Y;Maciuca, RD;Harris, L;Kay, A;LeWitt, P;King, TA;Kern, D;Ellenbogen, A;Goodman, I;Siderowf, A;Aldred, J;Omidvar, O;Masoud, ST;Davis, SS;Arguello, A;Estrada, AA;de Vicente, J;Sweeney, ZK;Astarita, G;Borin, MT;Wong, BK;Wong, H;Nguyen, H;Scearce-Levie, K;Ho, C;Troyer, MD;Preclinical and clinical evaluation of the LRRK2 inhibitor DNL201 for Parkinson's diseaseScience translational medicine356754332017 {study IDs: SAN-BB-01 [approved by Quorum Review independent review board (IRB)], PLMDEN201609v1 (approved by New England IRB), and US-IRB-13-2016.1 (approved by E&I Review Services)}. PBMCs from two donors for pS935 LRRK2 and pT73 Rab10 dose-reFull Paper
2022Barreyro, L;Sampson, AM;Ishikawa, C;Hueneman, KM;Choi, K;Pujato, MA;Chutipongtanate, S;Wyder, M;Haffey, WD;O'Brien, E;Wunderlich, M;Ramesh, V;Kolb, EM;Meydan, C;Neelamraju, Y;Bolanos, LC;Christie, S;Smith, MA;Niederkorn, M;Muto, T;Kesari, S;Garrett-Bakelman, FE;Bartholdy, B;Will, B;Weirauch, MT;Mulloy, JC;Gul, Z;Medlin, S;Kovall, RA;Melnick, AM;Perentesis, JP;Greis, KD;Nurmemmedov, E;Seibel, WL;Starczynowski, DT;Blocking UBE2N abrogates oncogenic immune signaling in acute myeloid leukemiaScience translational medicine35263148BM samples directly from patients and sequenced. Healthy BM specimens were obtained from ALLCells Inc. Human CD34+ umbilical cord blood and adult BM-derived mononuclear cells were obtained from the Translational Research Development Support LaboratorFull Paper
2022Sandberg, ML;Wang, X;Martin, AD;Nampe, DP;Gabrelow, GB;Li, CZ;McElvain, ME;Lee, WH;Shafaattalab, S;Martire, S;Fisher, FA;Ando, Y;Liu, E;Ju, D;Wong, LM;Xu, H;Kamb, A;A carcinoembryonic antigen-specific cell therapy selectively targets tumor cells with HLA loss of heterozygosity in vitro and in vivoScience translational medicine35235342Informed consent for primary T cells and donor collection protocols were approved by an Institutional Review Board at AllCells or HemaCare. Peripheral blood mononuclear cells (PBMCs) were purified from Leukopaks purchased from AllCells or HemaCare, aFull Paper
2022Uehara, K;Harumoto, T;Makino, A;Koda, Y;Iwano, J;Suzuki, Y;Tanigawa, M;Iwai, H;Asano, K;Kurihara, K;Hamaguchi, A;Kodaira, H;Atsumi, T;Yamada, Y;Tomizuka, K;Targeted delivery to macrophages and dendritic cells by chemically modified mannose ligand-conjugated siRNANucleic acids research35524566are). Preparation of human monocyte-derived macrophages and DCs Two types of human monocyte-derived macrophages (h-Mo-Mφs) were generated as described in Supplementary Figure S1A. CD14+ monocytes (AllCells, Alameda, CA, USA) were cultured (37°C, 5%Full Paper
2022Pennycuick, A;Selway, H;Lam, J;Khan, K;331P Predicting outcomes following colorectal cancer resection: Using real-world data to empower adjuvant treatment decision makingAnnals of Oncology: Financial Interests, Personal, Invited Speaker: Novartis; Financial Interests, Personal, Advisory Board: MSD Oncology, Bayer; Financial Interests, Personal, Other, Consultant: Targos Molecular Pathology GmbH. A. Vivancos: Financial Interests, PersoFull Paper
2022Glaser, M;von Levetzow, C;Michels, S;Nogova, L;Katzenmeier, M;Wömpner, C;Schmitz, J;Bitter, E;Terjung, I;Passmann, E;Schaufler, D;Eisert, A;Fischer, R;Riedel, R;Weber, J;Hahne, S;Merkelbach-Bruse, S;Büttner, R;Wolf, J;Scheffler, M;1729P The biological effect of small-scale ROS1 aberrations: An in silico analysisAnnals of OncologyMS. R. Riedel: Financial Interests, Personal, Funding: Boehringer Ingelheim, Loxo Oncology, Novartis, Lilly. J. Weber: Financial Interests, Personal, Advisory Board: Lilly. R. Büttner: Financial Interests, Personal, Ownership Interest: Targos MoleculFull Paper
2022Poole, A;Karuppiah, V;Hartt, A;Haidar, JN;Moureau, S;Dobrzycki, T;Hayes, C;Rowley, C;Dias, J;Harper, S;Barnbrook, K;Hock, M;Coles, C;Yang, W;Aleksic, M;Lin, AB;Robinson, R;Dukes, JD;Liddy, N;Van der Kamp, M;Plowman, GD;Vuidepot, A;Cole, DK;Whale, AD;Chillakuri, C;Therapeutic high affinity T cell receptor targeting a KRASG12D cancer neoantigenNature communications36088370ersberg, Germany). PBMCs were either purchased cryo-frozen from commercial suppliers (Cellular Technology Limited (CTL), OH & Tissue Solutions, Glasgow, UK) or prepared from healthy donor leukopaks (ALLCELLS, CA) by Ficoll density gradient centrifugFull Paper
2022Sano, Y;Azuma, Y;Tsunenari, T;Kayukawa, Y;Shinozuka, J;Fujii, E;Amano, J;Nishito, Y;Maruyama, T;Kinoshita, Y;Sakamoto, Y;Yoshida, A;Miyazaki, Y;Sato, Y;Teramoto-Seida, C;Ishiguro, T;Tanaka, T;Kitazawa, T;Endo, M;Combination of T cell-redirecting bispecific antibody ERY974 and chemotherapy reciprocally enhances efficacy against non-inflamed tumoursNature communications36071036(Tokyo, Japan). After an acclimatisation of 3 weeks, mice were irradiated (2.5 Gy; MBR-1520R-3; Hitachi Power Solutions Co. Ltd., Ibaraki, Japan) 1 day before transplantation of human CD34+ cells (AllCells, Alameda, CA, USA) via intravenous injectionFull Paper
2022Badrani, JH;Strohm, AN;Lacasa, L;Civello, B;Cavagnero, K;Haung, YA;Amadeo, M;Naji, LH;Lund, SJ;Leng, A;Kim, H;Baum, RE;Khorram, N;Mondal, M;Seumois, G;Pilotte, J;Vanderklish, PW;McGee, HM;Doherty, TA;RNA-binding protein RBM3 intrinsically suppresses lung innate lymphoid cell activation and inflammation partially through CysLT1RNature communications35908044&D Systems, Minneapolis, MN) in T cell media. Post-stimulation supernatant was collected and stored at −80 C for ELISA analysis. Human PBMCs were isolated from commercially purchased leukopacks (Allcells, Alameda, CA, USA). Human peripheral blood ILFull Paper
2022Li, F;Zhang, H;Wang, W;Yang, P;Huang, Y;Zhang, J;Yan, Y;Wang, Y;Ding, X;Liang, J;Qi, X;Li, M;Han, P;Zhang, X;Wang, X;Cao, J;Fu, YX;Yang, X;T cell receptor β-chain-targeting chimeric antigen receptor T cells against T cell malignanciesNature communications35882880ded by Dr. Justin Kline (University of Chicago). B16-OVA cells were kindly provided by Dr. Hans Schreiber (University of Chicago). Human peripheral blood mononuclear cells (PBMCs) were purchased from Allcells Biotechnology, Limited (Shanghai, China)Full Paper
2022Jo, S;Das, S;Williams, A;Chretien, AS;Pagliardini, T;Le Roy, A;Fernandez, JP;Le Clerre, D;Jahangiri, B;Chion-Sotinel, I;Rozlan, S;Dessez, E;Gouble, A;Dusséaux, M;Galetto, R;Duclert, A;Marcenaro, E;Devillier, R;Olive, D;Duchateau, P;Poirot, L;Valton, J;Endowing universal CAR T-cell with immune-evasive properties using TALEN-gene editingNature communications35773273cell products and to allow their large-scale utilization against multiple malignancies for the benefit of a broader range of patients. Methods Materials Cryopreserved human PBMCs were acquired from ALLCELLS (cat# PB006F). PBMCs were cultured in CTSFull Paper
2022Cai, T;Gouble, A;Black, KL;Skwarska, A;Naqvi, AS;Taylor, D;Zhao, M;Yuan, Q;Sugita, M;Zhang, Q;Galetto, R;Filipe, S;Cavazos, A;Han, L;Kuruvilla, V;Ma, H;Weng, C;Liu, CG;Liu, X;Konoplev, S;Gu, J;Tang, G;Su, X;Al-Atrash, G;Ciurea, S;Neelapu, SS;Lane, AA;Kantarjian, H;Guzman, ML;Pemmaraju, N;Smith, J;Thomas-Tikhonenko, A;Konopleva, M;Targeting CD123 in blastic plasmacytoid dendritic cell neoplasm using allogeneic anti-CD123 CAR T cellsNature communications35484100The production of R&D grade batches of UCART123 was done using commercially available NHPBMC cells ordered from ALLCELLS or HEMACARE. These are normal human SaveFull Paper
2022Salas, LA;Zhang, Z;Koestler, DC;Butler, RA;Hansen, HM;Molinaro, AM;Wiencke, JK;Kelsey, KT;Christensen, BC;Enhanced cell deconvolution of peripheral blood using DNA methylation for high-resolution immune profilingNature communications35140201lymphocytes memory (CD4mem), T regulatory cells (Treg), T-cytotoxic lymphocytes naïve (CD8nv), T-cytotoxic lymphocytes memory (CD8mem), and natural killer lymphocytes (NK) cells] were purchased from AllCells corporation (Alameda, CA, USA), StemExpreFull Paper
2022Wiesweg, M;Hense, J;Darwiche, K;Michels, S;Hautzel, H;Kobe, C;Metzenmacher, M;Herold, T;Zaun, G;Laue, K;Drzezga, A;Schildhaus, H;Wolf, J;Herrmann, K;Schuler, M;1171P A phase II theranostic study with osimertinib in patients with EGFR-mutated non-small cell lung cancer (NSCLC) progressing on EGFR tyrosine kinase inhibitors (TKI) and undetectable EGFR T790M (THEROS)Annals of Oncologyovartis Oncology; Financial Interests, Personal, Full or part-time Employment: Targos Molecular Pathology, Inc. J. Wolf: Financial Interests, Personal, Advisory Board: Amgen, AstraZeneca, Bayer, Blueprint, BMS, Boehringer Ingelheim, Chugai, Daiichi SFull Paper
2022Chansaenroj, A;Adine, C;Charoenlappanit, S;Roytrakul, S;Sariya, L;Osathanon, T;Rungarunlert, S;Urkasemsin, G;Chaisuparat, R;Yodmuang, S;Souza, GR;Ferreira, JN;Magnetic bioassembly platforms towards the generation of extracellular vesicles from human salivary gland functional organoids for epithelial repairBioactive materials35387159d EV; and (3) to identify novel signaling cues in EV that may optimize organoid development towards epithelial SG repair. 2 Materials and methods 2.1 Adult stem cell culture hDPSC were obtained from AllCells (Alameda, CA, USA) and cultured in DulbecFull Paper
2022Kavanagh, ME;Horning, BD;Khattri, R;Roy, N;Lu, JP;Whitby, LR;Ye, E;Brannon, JC;Parker, A;Chick, JM;Eissler, CL;Wong, AJ;Rodriguez, JL;Rodiles, S;Masuda, K;Teijaro, JR;Simon, GM;Patricelli, MP;Cravatt, BF;Selective inhibitors of JAK1 targeting an isoform-restricted allosteric cysteineNature chemical biology36097295In vitro TE50 values for JAK1_C817 and TYK2_C838 were obtained by treating 500 µg cell lysate generated from primary human PBMCs (AllCells), Jurkat T cells (ATCC, #TIB-152), or MDA-MB-468 breast cancer cells (ATCC, #HTB-132), with DMSO or compound foFull Paper
2022Lam, J;Lee, B;Yu, J;Kwee, BJ;Kim, Y;Kim, J;Choi, Y;Yoon, JS;Kim, Y;Baek, K;Jeon, NL;Sung, KE;A microphysiological system-based potency bioassay for the functional quality assessment of mesenchymal stromal cells targeting vasculogenesisBiomaterials36201944Human bone marrow-derived MSCs were obtained from eight different donors purchased from RoosterBio (RB9, RB12, RB14, RB16; Frederick, MD) at passage 1 (P1), Lonza (8F560, 167,696; Walkersville, MD) at passage 2 (P2), and AllCells (PCBM1632, PCBM1641;Full Paper
2022Han, C;Khodadadi-Jamayran, A;Lorch, AH;Jin, Q;Serafin, V;Zhu, P;Politanska, Y;Sun, L;Gutierrez-Diaz, BT;Pryzhkova, MV;Abdala-Valencia, H;Bartom, ET;Buldini, B;Basso, G;Velu, SE;Sarma, K;Mattamana, BB;Cho, BK;Obeng, RC;Goo, YA;Jordan, PW;Tsirigos, A;Zhou, Y;Ntziachristos, P;SF3B1 homeostasis is critical for survival and therapeutic response in T cell leukemiaScience advances35061527ing PCR to detect the TCRb-NOTCH1 translocation (TCRBJ2S4CUTLL1F: 5′-GGACCCGGCTCTCAGTGCT-3′, NOTCH1CUTTL1R: 5′-TCCCGCCCTCCAAAATAAGG-3′). Human CD3+, CD8+, and CD4+ T cells were purchased from AllCells.com (Alameda, CA) or from Astarte Biologics (BothFull Paper
2022Pan, Z;Chen, J;Xiao, X;Xie, Y;Jiang, H;Zhang, B;Lu, H;Yuan, Y;Han, L;Zhou, Y;Zong, H;Wang, L;Sun, R;Zhu, J;Characterization of a novel bispecific antibody targeting tissue factor-positive tumors with T cell engagementActa pharmaceutica Sinica. B35847491for the T cell activation test were bought from AllCells (Shanghai, China). PBMC used in other experiments were isolated from leukocyte concentrate (AllCells) using Ficoll-Paque PLUS ( Save;nded conditions and used within 2 months after resuscitatioFull Paper
2022Hu, J;Zhong, Y;Shang, X;A versatile and scalable single-cell data integration algorithm based on domain-adversarial and variational approximationBriefings in bioinformatics34585247Integration of two modal of multimodal data on human PBMCs of a healthy female donor aged 25 that were obtained by 10x Genomics from AllCells. UMAP visualization on integrated SaveFull Paper
2022Peng, S;Hu, P;Xiao, YT;Lu, W;Guo, D;Hu, S;Xie, J;Wang, M;Yu, W;Yang, J;Chen, H;Zhang, X;Zhu, Y;Wang, Y;Yang, Y;Zhu, G;Chen, S;Wang, J;Zhang, B;Chen, W;Wu, H;Sun, Z;Ding, T;Zhang, H;Yi, Z;Liu, M;Ren, S;Single-Cell Analysis Reveals EP4 as a Target for Restoring T-Cell Infiltration and Sensitizing Prostate Cancer to ImmunotherapyClinical cancer research : an official journal of the American Association for Cancer Research34740924Purpose: Immunotherapies targeting immune checkpoint molecules have shown promising treatment for a subset of cancers; however, many "cold" tumors, such as prostate cancer, SaveFull Paper
2022Siegel, RJ;Singh, AK;Panipinto, PM;Shaikh, FS;Vinh, J;Han, SU;Kenney, HM;Schwarz, EM;Crowson, CS;Khuder, SA;Khuder, BS;Fox, DA;Ahmed, S;Extracellular sulfatase-2 is overexpressed in rheumatoid arthritis and mediates the TNF-?-induced inflammatory activation of synovial fibroblastsCellular & molecular immunology36068294Human serum samples were purchased from commercial vendors (Discovery Life Sciences, Newtown, PA; Innovative Research, Novi, MI; or Sanguine Biosciences, Los Angeles, CA) or generously shared by Dr. Cynthia Crowson (Mayo Clinic, Rochester, MN)Full Paper
2022Gyurdieva, A;Zajic, S;Chang, YF;Houseman, EA;Zhong, S;Kim, J;Nathenson, M;Faitg, T;Woessner, M;Turner, DC;Hasan, AN;Glod, J;Kaplan, RN;D'Angelo, SP;Araujo, DM;Chow, WA;Druta, M;Demetri, GD;Van Tine, BA;Grupp, SA;Fine, GD;Eleftheriadou, I;Biomarker correlates with response to NY-ESO-1 TCR T cells in patients with synovial sarcomaNature communications36075914s were digitally obtained using CaseViewer (3D Histech, Budapest, Hungary). Protein expression by IHC NY-ESO-1 staining was performed using the E978 clone (Sigma, Catalog #: N2038, at 1??g/mL) at QualTek Laboratory (Goleta, CA; now part of DiscoveryFull Paper
2022Ni, Z;Sun, P;Zheng, J;Wu, M;Yang, C;Cheng, M;Yin, M;Cui, C;Wang, G;Yuan, L;Gao, Q;Li, Y;JNK Signaling Promotes Bladder Cancer Immune Escape by Regulating METTL3-Mediated m6A Modification of PD-L1 mRNACancer research35502544CD8+ T cells (catalog no. PB009-3F-C) were obtained from AllCells (Shanghai) and cultured in ImmunoCult-XF T Cell Expansion Medium (STEMCELL Technologies, catalog no. 10981). Seventy-two hours after activation with ImmunoCult Human CD3/CD28/CD2 T CelFull Paper
2022Ge, X;Yost, SE;Lee, JS;Frankel, PH;Ruel, C;Cui, Y;Murga, M;Tang, A;Martinez, N;Chung, S;Yeon, C;Stewart, D;Li, D;Rajurkar, S;Somlo, G;Mortimer, J;Waisman, J;Yuan, Y;Phase II Study Combining Pembrolizumab with Aromatase Inhibitor in Patients with Metastatic Hormone Receptor Positive Breast CancerCancers36077811mal TILs were measured by hematoxylin and eosin (H&E) staining of formalin-fixed paraffin-embedded (FFPE) tumor biopsies according to the International TIL Work Group guideline [16]. PD-L1 analysis: QualTek Molecular Laboratory (Goleta, CA, USA) perFull Paper
2022Shirk, B;Shirk, P;Furlong, R;Scully, E;Wu, K;Siegfried, B;Gene Editing of the ABC Transporter/White Locus Using Crispr/Cas9-Mediated Mutagenesis in the Indian Meal MothSSRN Electronic Journaly and sequencing, and Kris Hartzer for laboratory assistance. Library 497 preparation and sequencing were performed at HudsonAlpha Genomic Services Lab 498 (Huntsville, AL). We also thank Karen Garren for her work to isolate the P. interpunctella 499Full Paper
2022Kanter, J;Thompson, AA;Pierciey, FJ;Hsieh, M;Uchida, N;Leboulch, P;Schmidt, M;Bonner, M;Guo, R;Miller, A;Ribeil, JA;Davidson, D;Asmal, M;Walters, MC;Tisdale, JF;Lovo-cel gene therapy for sickle cell disease: Treatment process evolution and outcomes in the initial groups of the HGB-206 studyAmerican journal of hematology36161320MCW served as medical director for AllCells and as a consultant for AllCells, Ensoma, Vertex, and BioLabs. The remaining authors declare no competing financial interests. SaveFull Paper
2022Wei, Y;Kanagal-Shamanna, R;Zheng, H;Bao, N;Lockyer, PP;Class, CA;Darbaniyan, F;Lu, Y;Lin, K;Yang, H;Montalban-Bravo, G;Ganan-Gomez, I;Soltysiak, KA;Do, KA;Colla, S;Garcia-Manero, G;Cooperation between KDM6B overexpression and TET2 deficiency in the pathogenesis of chronic myelomonocytic leukemiaLeukemia35697791Materials and methods Human samples BM specimens were obtained from the MD Anderson Cancer Center tissue bank following institutional guidelines. BM samples from healthy individuals were obtained from AllCells (Emeryville, CA)Full Paper
2022Lu, M;Xia, L;Elmansy, N;Clementelli, C;Tremblay, D;Hoffman, R;Combined Drug Targeting of p53-dependent and -independent Pathways Depletes Myelofibrosis Hematopoietic Stem/Progenitor CellsLeukemia34642468met the World Health Organization criteria for the diagnosis of MF [41, 42]. Patient characteristics are provided in Supplemental Table 1. Normal donor (ND) human bone marrow (BM) was purchased from AllCells (Emeryville, CA). The experiments in whichFull Paper
2022Bae, J;Accardi, F;Hideshima, T;Tai, YT;Prabhala, R;Shambley, A;Wen, K;Rowell, S;Richardson, PG;Munshi, NC;Anderson, KC;Targeting LAG3/GAL-3 to overcome immunosuppression and enhance anti-tumor immune responses in multiple myelomaLeukemia34290359roval by the Institutional Review Board at Dana-Farber Cancer Institute (Boston, MA). In addition, healthy individuals BM [N = 5] or leukapheresis [N = 12] products were purchased from either AllCells (Alameda, CA) or the Blood Donor Center at BostonFull Paper
2022Huang, G;Cheng, Z;Hildebrand, A;Wang, C;Cimini, M;Roy, R;Lucchese, AM;Benedict, C;Mallaredy, V;Magadum, A;Joladarashi, D;Thej, C;Gonzalez, C;Trungcao, M;Garikipati, VNS;Elrod, JW;Koch, WJ;Kishore, R;Diabetes impairs cardioprotective function of endothelial progenitor cell-derived extracellular vesicles via H3K9Ac inhibitionTheranostics35673580days, db/+ EPCs were cultured at 37°C, 5% CO2 atmosphere. Male mice were used to avoid the reproductive hormone effect in female mice. Human CD34+ Hematopoietic stem cells (HSC) were purchased from AllCells, LLC and were cultured in a human hematopoiFull Paper
2022Shen, Y;Eng, JS;Fajardo, F;Liang, L;Li, C;Collins, P;Tedesco, D;Nolan-Stevaux, O;Cancer cell-intrinsic resistance to BiTE therapy is mediated by loss of CD58 costimulation and modulation of the extrinsic apoptotic pathwayJournal for immunotherapy of cancer35296559Target cells were cocultured with freshly thawed human CD3 + T cells (ALLCELLS) and increasing concentrations of TCEs. Assay conditions were effector-to-target ratio (E:T)=2:1 and SaveFull Paper
2022Froning, KJ;Sereno, A;Huang, F;Demarest, SJ;Generalizable design parameters for soluble T cell receptor-based T cell engagersJournal for immunotherapy of cancer35260435ously11 with minor modifications throughout the protocol. Saos-2 and HCT-116 cells were cultured as described earlier. Primary naïve T cells were from StemExpress (cat#PB03020C, Donor#D001003581) or AllCells (cat# PB009-1F, Lt# 3009286). For the assaFull Paper
2022Wu, ZH;Li, N;Mei, XF;Chen, J;Wang, XZ;Guo, TT;Chen, G;Nie, L;Chen, Y;Jiang, MZ;Wang, JT;Wang, HB;Preclinical characterization of the novel anti-SIRPα antibody BR105 that targets the myeloid immune checkpointJournal for immunotherapy of cancer35256517Allogeneic PBMCs (AllCells) from different donors were added at a dendritic cell:PBMCs ratio of 1:20. Indicated mAbs were added at a concentration of 10 µg/mL immediately, and the SaveFull Paper
2022Lee, KM;Lin, CC;Servetto, A;Bae, J;Kandagatla, V;Ye, D;Kim, G;Sudhan, DR;Mendiratta, S;González Ericsson, PI;Balko, JM;Lee, J;Barnes, S;Malladi, VS;Tabrizi, S;Reddy, SM;Yum, S;Chang, CW;Hutchinson, KE;Yost, SE;Yuan, Y;Chen, ZJ;Fu, YX;Hanker, AB;Arteaga, CL;Epigenetic Repression of STING by MYC Promotes Immune Evasion and Resistance to Immune Checkpoint Inhibitors in Triple-Negative Breast CancerCancer immunology research35561311After a week, 1 A 107 human PBMCs (hPBMC; ALLCELLS) were injected intravenously. Two weeks later, SUM159PT tumors were harvested for analysis of tumor-infiltrating immune SaveFull Paper
2022Li, W;Yang, S;Xu, P;Zhang, D;Tong, Y;Chen, L;Jia, B;Li, A;Lian, C;Ru, D;Zhang, B;Liu, M;Chen, C;Fu, W;Yuan, S;Gu, C;Wang, L;Li, W;Liang, Y;Yang, Z;Ren, X;Wang, S;Zhang, X;Song, Y;Xie, Y;Lu, H;Xu, J;Wang, H;Yu, W;SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer networkEBioMedicine35124429Human umbilical vein endothelial cells (HUVEC) were cultured in the commercial culture medium (AllCells, Cat# H-004). VERO C1008 (E6) (Cat# GNO17) and its culture medium MEM Save;ed with 10% FBS (Gibco, Cat# 10270-106) and 1% Penicillin-StreptomyciFull Paper
2022Zhang, C;Chen, Z;Liu, J;Wu, M;Yang, J;Zhu, Y;Lu, W;Ruan, C;3D-printed pre-tapped-hole scaffolds facilitate one-step surgery of predictable alveolar bone augmentation and simultaneous dental implantationComposites Part B: EngineeringThe human bone marrow mesenchymal stem cells (hBMSCs, obtained from Allcells, Silicon Valley, CA) were cultured in α-MEM (Gibco, USA) supplemented with 1% penicillin-streptomycin (Gibco, USA) and 10% fetal bovine serum (FBS) (Gibco, USA) in an atmospFull Paper
2022Petaroudi, M;Rodrigo-Navarro, A;Dobre, O;Dalby, MJ;Salmeron-Sanchez, M;Living Biomaterials to Engineer Hematopoietic Stem Cell NichesAdvanced healthcare materials35933595Fresh, cryopreserved bone marrow CD34+ cells isolated from the posterior iliac crest of healthy and consenting donors were purchased from AllCells. All cultures containing CD34+ SaveFull Paper
2022Suyama, T;Takemoto, Y;Miyauchi, H;Kato, Y;Matsuzaki, Y;Kato, R;Morphology-based noninvasive early prediction of serial-passage potency enhances the selection of clone-derived high-potency cell bank from mesenchymal stem cellsInflammation and regeneration36182958Bone marrow mononuclear cells were prepared from bone marrow aspirate (AllCells, Alameda, USA) collected from healthy donors using density gradient centrifugation with Ficoll (GE Save CachedFull Paper
2022Wang, J;Jiang, J;Yang, X;Zhou, G;Wang, L;Xiao, B;Tethering Piezo channels to the actin cytoskeleton for mechanogating via the cadherin-β-catenin mechanotransduction complexCell reports35139384Experimental models: Cell lines HEK293T Xiao et al., 2011 N/A MDCK Xu Tan Lab in Tsinghua University N/A HUVEC Purchased from Allcells N/AFull Paper
2022Sun, Y;Wang, T;Lv, Y;Li, J;Jiang, X;Jiang, J;Zhang, D;Bian, W;Zhang, C;MALAT1 promotes platelet activity and thrombus formation through PI3k/Akt/GSK-3β signalling pathwayStroke and vascular neurology36241224Allcells Biotechnology (Shanghai, China) was the supplier of the Cord Blood-Stem/Progenitor (CD34+) cells that were used in this study. Serum-free expansion medium (StemCell Technologies, Canada) was used in the cultivation of CD34+ cells. To facilitFull Paper
2022Manshouri, T;Veletic, I;Li, P;Yin, CC;Post, SM;Verstovsek, S;Estrov, Z;GLI1 activates pro-fibrotic pathways in myelofibrosis fibrocytesCell death & disease35595725ld Health Organization revised criteria [1]. Control BM biopsies were obtained from morphologically normal BM donors and control BM aspirates were obtained from commercially available healthy donors (AllCells, Alameda, CA, USA). The patients’ and conFull Paper
2022Zhang, J;Liu, F;Yang, Y;Yu, N;Weng, X;Yang, Y;Gong, Z;Huang, S;Gan, L;Sun, S;Zhang, X;Gong, Y;Liu, Y;Guo, W;Integrated DNA and RNA sequencing reveals early drivers involved in metastasis of gastric cancerCell death & disease35449126ze the results using the positive control contained in the different membranes. T-cell amplification and tumor-reactive T cell killing assay Peripheral blood mononuclear cells (PBMCs) purchased from AllCells (China) were activated with anti-CD3 antiFull Paper
2022Liu, P;Zhang, Q;Mi, J;Wang, S;Xu, Q;Zhuang, D;Chen, W;Liu, C;Zhang, L;Guo, J;Wu, X;Exosomes derived from stem cells of human deciduous exfoliated teeth inhibit angiogenesis in vivo and in vitro via the transfer of miR-100-5p and miR-1246Stem cell research & therapy35241153Human umbilical vein endothelial cells (HUVECs) were purchased from AllCells (Cat. H-001F, AllCells) and were cultured in DMEM (Cat. SH30021.01, Hyclone) with 4.5 g/L D-Glucose SaveFull Paper
2022McLemore, AF;Hou, HA;Meyer, BS;Lam, NB;Ward, GA;Aldrich, AL;Rodrigues, MA;Vedder, A;Zhang, L;Padron, E;Vincelette, ND;Sallman, DA;Abdel-Wahab, O;List, AF;McGraw, KL;Somatic gene mutations expose cytoplasmic DNA to co-opt the cGAS/STING/NLRP3 axis in myelodysplastic syndromesJCI insight35788117using Ficoll-Paque (GE Healthcare) from patients with MDS and healthy donors who provided informed consent at the Moffitt Cancer Center or NTUH or were purchased from AllCells. Save CachedFull Paper
2022Xie, J;Gui, X;Deng, M;Chen, H;Chen, Y;Liu, X;Ku, Z;Tan, L;Huang, R;He, Y;Zhang, B;Lewis, C;Chen, K;Xu, L;Xu, J;Huang, T;Liao, XC;Zhang, N;An, Z;Zhang, CC;Blocking LAIR1 signaling in immune cells inhibits tumor developmentFrontiers in immunology36211388Human allogeneic pan T cells (PB009-1F, Allcells) were stained with Carboxy fluorescein succinimidyl ester (CFSE) (C34554, Thermo Fisher Scientific), and mixed with 3 x10 5 mature SaveFull Paper
2022Hu, JF;Wang, ZW;Liao, CY;Chen, ZW;Kang, FP;Lin, CF;Lin, TS;Huang, L;Tian, YF;Chen, S;Induced expression of CCL19 promotes the anti-tumor ability of CAR-T cells by increasing their infiltration abilityFrontiers in immunology35990619(CRL-1682, ATCC) cells were obtained from ATCC and cultured in RPMI-1640 medium (cat. no. 11875093; Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. Human T cells were obtained from Allcells (cat. no. PB009-CD3-F). Both of the cellsFull Paper
2022Bjornson-Hooper, ZB;Fragiadakis, GK;Spitzer, MH;Chen, H;Madhireddy, D;Hu, K;Lundsten, K;McIlwain, DR;Nolan, GP;A Comprehensive Atlas of Immunological Differences Between Humans, Mice, and Non-Human PrimatesFrontiers in immunology35359965apeutics between humans and model organisms will greatly improve the evaluation of therapeutic candidates. Materials and Methods Blood Venous human blood was obtained from the Stanford Blood Center, AllCells Inc. (Alameda, CA) (exempt, non-human subFull Paper
2022Peng, H;Nerreter, T;Mestermann, K;Wachter, J;Chang, J;Hudecek, M;Rader, C;ROR1-targeting switchable CAR-T cells for cancer therapyOncogene35859167Pan-T cells were isolated from fresh PBMC of healthy donors (Allcells) by negative selection (Pan T Cell Isolation Kit; Miltenyi Biotec), activated using Dynabeads Human T-Activator SaveFull Paper
2022Zhang, M;Zhu, Y;Zhu, J;Xie, Y;Wu, R;Zhong, J;Qiu, Z;Jiang, L;circ_0086296 induced atherosclerotic lesions via the IFIT1/STAT1 feedback loop by sponging miR-576-3pCellular & molecular biology letters36138395HUVECs were obtained from AllCells (Shanghai, China) as previously reported [7, 33]. HUVECs were seeded in EC complete growth medium at 37 C. Then, 100 μg/mL ox-LDL was Save CachedFull Paper
2022Abdul-Aziz, A;Weigel, C;Kovacs, A;Wu, Y;Byrd, J;Hertlein, E;Oakes, C;P381: DNA METHYLATION PROFILING OF MESENCHYMAL STROMAL CELLS ISOLATED FROM FEMURAL HEAD BONE MARROW VERSUS BONE MARROW ASPIRATES: RELEVANCE FOR AML STUDY BASED CONTROLSHemaSphereAspirate-derived BMSCs (n= 7) were expanded from bone marrow mononuclear cells obtained from a commercial source (AllCells). For genome-wide DNA methylation analyses, the SaveFull Paper
2022Owens, TD;Brameld, KA;Verner, EJ;Ton, T;Li, X;Zhu, J;Masjedizadeh, MR;Bradshaw, JM;Hill, RJ;Tam, D;Bisconte, A;Kim, EO;Francesco, M;Xing, Y;Shu, J;Karr, D;LaStant, J;Finkle, D;Loewenstein, N;Haberstock-Debic, H;Taylor, MJ;Nunn, P;Langrish, CL;Goldstein, DM;Discovery of Reversible Covalent Bruton's Tyrosine Kinase Inhibitors PRN473 and PRN1008 (Rilzabrutinib)Journal of medicinal chemistry35302767The ability of selected compounds to block BCR-driven activation of B cells was assessed by expression of the CD69 surface marker, as previously described. (37) Briefly, HWB (AllCells, Alameda, CA, USA) pretreated for 1 h with serial dilutions of tesFull Paper
2022Zheng, L;Wang, H;Zuo, P;Liu, Y;Xu, H;Ye, BC;Rapid On-Chip Isolation of Cancer-Associated Exosomes and Combined Analysis of Exosomes and Exosomal ProteinsAnalytical chemistry35575685The biotin-labeled rabbit antihuman CD63 antibody (anti-CD63) was purchased from AllCells Biotech Co., Ltd. (Shanghai, China). The horseradish peroxidase (HRP)-conjugated secondary antibody, rabbit anti-human CD9 polyclonal antibody, and bicinchoniniFull Paper
2022Avanzino, BC;Prabhakar, K;Dalvi, P;Hartstein, S;Kehm, H;Balasubramani, A;Boudreau, AA;Buelow, B;Chang, K;Davison, LM;Iyer, S;Kalwit, V;Lewis Wilson, K;Malik-Chaudhry, HK;Pierson, W;Pineda, G;Rangaswamy, US;Saiganesh, S;Schellenberger, U;Ugamraj, HS;Yabut, RD;Buelow, R;Chapman, J;Trinklein, ND;Harris, KE;A T-cell engaging bispecific antibody with a tumor-selective bivalent folate receptor alpha binding arm for the treatment of ovarian cancerOncoimmunology36016696In a similar follow-on study, NCG mice were injected with activated human PBMCs (AllCells). Prior to injection, PBMCs were activated for 3 d with 1 µg/mL plate-coated anti-CD3 ( SaveFull Paper
2022Xue, W;Zhang, Q;Chen, Y;Zhu, Y;Hydrogen Sulfide Improves Angiogenesis by Regulating the Transcription of pri-miR-126 in Diabetic Endothelial CellsCells36078059The HUVECs from passages 4 to 7 were used in the experiment and were cultured in endothelial completed medium (ALLCELLS, Shanghai, China) at 37 C in 5% CO 2 . The HUVECs Save CachedFull Paper
2022Sharma, M;Bellio, MA;Benny, M;Kulandavelu, S;Chen, P;Janjindamai, C;Han, C;Chang, L;Sterling, S;Williams, K;Damianos, A;Batlahally, S;Kelly, K;Aguilar-Caballero, D;Zambrano, R;Chen, S;Huang, J;Wu, S;Hare, JM;Schmidt, A;Khan, A;Young, K;Mesenchymal Stem Cell-derived Extracellular Vesicles Prevent Experimental Bronchopulmonary Dysplasia Complicated By Pulmonary HypertensionStem cells translational medicine35758326es, and isotype control was performed on P2 WJ-MSC to confirm the MSC identity. BM-MSC Production BM-MSCs were isolated from fresh adult bone marrow aspirates, and obtained from a commercial source (AllCells, Alameda, CA). Briefly, bone marrow was pFull Paper
2022Ohori-Morita, Y;Niibe, K;Limraksasin, P;Nattasit, P;Miao, X;Yamada, M;Mabuchi, Y;Matsuzaki, Y;Egusa, H;Novel Mesenchymal Stem Cell Spheroids with Enhanced Stem Cell Characteristics and Bone Regeneration AbilityStem cells translational medicine35267026heir therapeutic potential in bone regeneration. Materials and Methods BM-MSC Adherent Culture Human BM-MSCs of an 18-year-old male (donor 1; Lonza, Basel, Switzerland), a 22-year-old male (donor 2; AllCells, Alameda, CA, USA), and a 24-year-old malFull Paper
2022Stratmann, S;Yones, SA;Garbulowski, M;Sun, J;Skaftason, A;Mayrhofer, M;Norgren, N;Herlin, MK;Sundström, C;Eriksson, A;Höglund, M;Palle, J;Abrahamsson, J;Jahnukainen, K;Munthe-Kaas, MC;Zeller, B;Tamm, KP;Cavelier, L;Komorowski, J;Holmfeldt, L;Transcriptomic analysis reveals proinflammatory signatures associated with acute myeloid leukemia progressionBlood advances34619772children (Table 1). Detailed biological characteristics and supporting clinical information are reported in supplemental Tables 2 and 3. CD34-expressing bone marrow (BM) cells from 5 healthy donors (AllCells Inc., Alameda, CA) were used as normal conFull Paper
2022Jeon, E;Choi, D;Choi, S;Won, J;Jo, Y;Kim, H;Jung, Y;Shin, S;Min, H;Choi, H;Lee, M;Park, Y;Chung, J;Jin, H;Enhancing adoptive T‐cell therapy with fucoidan‐based IL ‐2 delivery microcapsulesBioengineering & Translational MedicineCryopreserved human peripheral blood mononuclear cells (PBMC) were purchased from AllCells (Emeryvill, CA). Total CD3+T cells were isolated by negative selection with a magnetic isolation kit and CD4+T, CD8+T, and regulatory T (Treg) cells were thenFull Paper
2022Lun, Y;Zhou, Y;Li, Q;Chen, P;Huang, Y;Ye, G;Preparation and characterization of a magnetic microsphere synthesized from sucrose allyl ether for transcatheter arterial embolizationMaterials Today ChemistryHuman umbilical vein endothelial cells (HUVECs, AllCells, US) were subcultured in a low glucose Dulbecco's modified eagle medium containing 10% fetal bovine serum and 1% penicillin/streptomycin (100 U·mL−1) in an atmosphere of 310.15 K and 5% CO2Full Paper
2022Lu, W;Zhou, C;Ma, Y;Li, J;Jiang, J;Chen, Y;Dong, L;He, F;Improved osseointegration of strontium-modified titanium implants by regulating angiogenesis and macrophage polarizationBiomaterials science35384947HUVECs together with complete and basal medium were purchased from Allcells Bio (Shanghai, China). The murine macrophage cell lines (Raw264.7) were obtained from the SaveFull Paper
2022Zhou, Y;Li, XH;Xue, WL;Jin, S;Li, MY;Zhang, CC;Yu, B;Zhu, L;Liang, K;Chen, Y;Tao, BB;Zhu, YZ;Wang, MJ;Zhu, YC;YB-1 Recruits Drosha to Promote Splicing of pri-miR-192 to Mediate the Proangiogenic Effects of H2SAntioxidants & redox signaling35044231HUVECs were purchased from Allcells (Shanghai, China) and cultured in endothelial basal medium (EBM; Allcells, Shanghai, China) supplemented with hydrocortisone, bovine brain SaveFull Paper
2022Li, J;Hong, T;Wei, Y;Guo, L;Lee, M;Yang, H;Class, C;Yang, Y;Wang, X;He, H;Siwko, S;You, MJ;Zhou, Y;Garcia-Manero, G;Huang, Y;Aberrant DNA hydroxymethylation reshapes transcription factor binding in myeloid neoplasmsClinical epigenetics35765052BM samples from healthy individuals were obtained from AllCells (Emeryville, CA). BM mononuclear cells were isolated using a Ficoll-Paque density gradient media (GE, Sweden). Save CachedFull Paper
2022Fang, J;Li, R;Zhang, Y;Oduro, PK;Li, S;Leng, L;Wang, Z;Rao, Y;Niu, L;Wu, HH;Wang, Q;Aristolone in Nardostachys jatamansi DC. induces mesenteric vasodilation and ameliorates hypertension via activation of the KATP channel and PDK1-Akt-eNOS pathwayPhytomedicine : international journal of phytotherapy and phytopharmacology35738117Human umbilical vein endothelial cells (HUVECs) were obtained from AllCells Biotech Co. Ltd. (Shanghai, China) and cultured in Endothelial Cell Medium (ECM; AllCells Biotech Co. Ltd., Shanghai, China) with 10% fetal bovine serum, 1% endothelial growtFull Paper
2022Liang, W;Chen, J;Zheng, H;Lin, A;Li, J;Wu, W;Jie, Q;MiR-199a-5p-containing macrophage-derived extracellular vesicles inhibit SMARCA4 and alleviate atherosclerosis by reducing endothelial cell pyroptosisCell biology and toxicology35930100Human monocyte-derived macrophages (hMDMs, PB-MDM-001F, AllCells) were purchased from Milestone Biotechnologies (Shanghai, China). The hMDMs were cultured at 37 °C in RPMI1640 medium (supplemented with 10% FBS and 1% penicillin/streptomycin) with 5%Full Paper
2022Wang, J;Li, C;He, K;Kuang, Z;Lu, J;Yao, Y;He, F;Li, N;Li, L;Fu, F;Wu, Z;Zhou, S;Kang, D;Qiu, X;Wu, M;Liu, Y;Cao, X;Xu, M;Chen, B;Wu, W;Guo, F;Characterization of anti-CD79b/CD3 bispecific antibody, a potential therapy for B cell malignanciesCancer immunology, immunotherapy : CII35963895Materials and methods Reagents IBI38D9 and human IgG1 were produced by Innovent Biologics Co., Ltd. (Suzhou, China). Human IgG was purchased from Equitech-Bio. Peripheral blood mononuclear cells (PBMCs) were purchased from the AllCellsFull Paper
2022Ni, H;Cao, L;Wu, Z;Wang, L;Zhou, S;Guo, X;Gao, Y;Jing, H;Wu, M;Liu, Y;Ding, J;Zhang, P;Zhou, Y;Chen, B;Xiong, Y;Sun, J;Prinz, B;Baruah, H;Geoghegan, J;Yu, M;Wu, W;Liu, J;Combined strategies for effective cancer immunotherapy with a novel anti-CD47 monoclonal antibodyCancer immunology, immunotherapy : CII34165607CD14+ monocytes were isolated from peripheral blood mononuclear cells (PBMCs, Allcells) and then differentiated into macrophages following incubation for 7 days with granulocyte- SaveFull Paper
2022Wu, ZH;Li, N;Gao, ZZ;Chen, G;Nie, L;Zhou, YQ;Jiang, MZ;Chen, Y;Chen, J;Mei, XF;Hu, F;Wang, HB;Development of the Novel Bifunctional Fusion Protein BR102 That Simultaneously Targets PD-L1 and TGF-β for Anticancer ImmunotherapyCancers36230887IgG1 isotype control was expressed by Biointron Biological (Taizhou, China). 2.2. Cell Lines and Cell Culture Dendritic cells (DCs) and peripheral blood mononuclear cells (PBMCs) were purchased from AllCells (Shanghai, China). TF-1 cells were from tFull Paper
2022Wang, X;Chen, G;Nie, L;Wu, Z;Wang, X;Pan, C;Chen, X;Zhao, X;Zhu, J;He, Q;Wang, H;IL-2K35C-moFA, a Long-Acting Engineered Cytokine with Decreased Interleukin 2 Receptor α Binding, Improved the Cellular Selectivity Profile and Antitumor Efficacy in a Mouse Tumor ModelCancers36230665Next, 100 μL CellTiter-Glo (G7572, Promega Corporation, Madison, WI, USA) was added; luminescence was recorded suing a Spectramax M5. 2.8. p-STAT5 Assay in Treg and CD8+ T Cell Tregs (PB009-4F-2, Allcells, Shanghai, China) at a density of 1 × 106 cFull Paper
2022Sekhri, P;Ledezma, DK;Shukla, A;Sweeney, EE;Fernandes, R;The Thermal Dose of Photothermal Therapy Generates Differential Immunogenicity in Human Neuroblastoma CellsCancers35326601Healthy donor peripheral blood leukopaks were purchased from AllCells (Alameda, CA, USA) along with the HLA report. Peripheral blood mononuclear cells (PBMCs) were isolated by SaveFull Paper
2022Ning, K;Roy, A;Cheng, F;Xu, P;Kleiboeker, S;Escalante, CR;Wang, J;Qiu, J;High-Throughput Screening Identifies Inhibitors for Parvovirus B19 Infection of Human Erythroid ProgenitorsJournal of virology34669461Primary human CD34+ hematopoietic stem cells (HSCs), which were isolated from the bone marrow of a healthy human donor, were purchased from AllCells LLC (Alameda, CA). B19V-containing plasma samples were obtained from ViraCor Eurofins Laboratories (LFull Paper
2022Liu, Y;Tsang, K;Mays, M;Hansen, G;Chiecko, J;Crames, M;Wei, Y;Zhou, W;Fredrick, C;Hu, J;Liu, D;Gebhard, D;Huang, ZF;Datar, A;Kronkaitis, A;Gueneva-Boucheva, K;Seeliger, D;Han, F;Sen, S;Kasturirangan, S;Scheer, JM;Nixon, AE;Panavas, T;Marlow, MS;Kumar, S;An adapted consensus protein design strategy for identifying globally optimal biotherapeuticsmAbs35613320isolated from human peripheral blood mononuclear cells (PBMCs) using a negative selection kit (EasySep). PBMCs were isolated from Leukopak collected from healthy volunteers, which were obtained from ALLcells. Redirected T-cell cytotoxicity was assayeFull Paper
2022Zhao, J;Jiang, L;Yang, H;Deng, L;Meng, X;Ding, J;Yang, S;Zhao, L;Xu, W;Wang, X;Zhu, Z;Huang, H;A strategy for the efficient construction of anti-PD1-based bispecific antibodies with desired IgG-like propertiesmAbs35239451#F9512) at 4°C for 1 h. Cells were washed three times and then analyzed on the CytoFLEX Cytometer System (Beckman Coulter). Allogeneic mixed lymphocyte reaction Monocytes were enriched from PBMCs (AllCells, Cat# PB002-C-300) by adherence on tissue cFull Paper
2022McGuire, BE;Mela, JE;Thompson, VC;Cucksey, LR;Stevens, CE;McWhinnie, RL;Winkler, DFH;Pelech, S;Nano, FE;Escherichia coli recombinant expression of SARS-CoV-2 protein fragmentsMicrobial cell factories35123472mall number of serum or plasma samples from positive tested donors and all pre-COVID-19 samples were acquired by purchase (Precision for Medicine, Norton, MA, USA; Innovative Research, Novi, MI, USA; AllCells, Alameda, CA, USA) or by donation (CureImFull Paper
2022Li, G;Reid, KM;Spitler, K;Beatty, N;Boucher, J;Davila, ML;CD3 engagement as a new strategy for allogeneic "off-the-shelf" T cell therapyMolecular therapy oncolytics35317526lls was harvested, and 0.45 μm was filtered and cryopreserved for future use. For T cell transduction, healthy donor leukopaks were purchased from Stemcell Technologies (Vancouver, BC, Canada) and ALLCELLS (Alameda, CA). PBMCs were isolated using staFull Paper
2022Biscaia, S;Branquinho, MV;Alvites, RD;Fonseca, R;Sousa, AC;Pedrosa, SS;Caseiro, AR;Guedes, F;Patrício, T;Viana, T;Mateus, A;Maurício, AC;Alves, N;3D Printed Poly(????-caprolactone)/Hydroxyapatite Scaffolds for Bone Tissue Engineering: A Comparative Study on a Composite Preparation by Melt Blending or Solvent Casting Techniques and the Influence of Bioceramic Content on Scaffold PropertiesInternational journal of molecular sciences35216432ON 4505 equipment in a dry state at a rate of 1 mm/min. Five specimens were tested for each composition. 4.3. Cytocompatibility Analysis 4.3.1. Cell Culture and Maintenance hDPSCs were acquired from AllCells, LLC (Cat. DP0037F, Lot N° DPSC090411-01)Full Paper
2022Cunningham, AW;Jones, M;Frank, N;Sethi, D;Miller, MM;Stem-like memory T cells are generated during hollow fiber perfusion-based expansion and enriched after cryopreservation in an automated modular cell therapy manufacturing processCytotherapy36031522Leukopaks from three healthy donors were acquired by processing whole blood on the Spectra Optia Apheresis System and obtained through AllCells (Alameda, CA, USA) (Fig. 1A). The apheresis product was shipped to the lab overnight, and CD3+ T cells werFull Paper
2022Jimenez, AC;Heist, CA;Navaei, M;Yeago, C;Roy, K;Longitudinal two-dimensional gas chromatography mass spectrometry as a non-destructive at-line monitoring tool during cell manufacturing identifies volatile features correlative to cell product qualityCytotherapy35882596CellBIND 96-well plate (Corning) for 48-h before co-culture at 50 000 cells per well. PBMCs (AllCells, Alameda, CA, USA) were thawed with a CTL anti-aggregate solution (Cellular Technology Ltd, Shaker Heights, OH, USA) and plated in a six-well plateFull Paper
2022Maughon, TS;Shen, X;Huang, D;Michael, AOA;Shockey, WA;Andrews, SH;McRae, JM;Platt, MO;Fernández, FM;Edison, AS;Stice, SL;Marklein, RA;Metabolomics and cytokine profiling of mesenchymal stromal cells identify markers predictive of T-cell suppressionCytotherapy34696960ethylenediaminetetraacetic acid; Gibco) and then seeded at three densities (10 000, 5000 and 2000 cells/well) in a 96-well plate and cultured for 24 h. PBMCs (AllCells, Alameda, CA, USA) were thawed in Roswell Park Memorial Institute medium, 20% fetaFull Paper
2022Xu, C;Yang, J;Kosters, A;Babcock, BR;Qiu, P;Ghosn, EEB;Comprehensive multi-omics single-cell data integration reveals greater heterogeneity in the human immune systemiScience36185375ical samples ------------------------- Human Adult Peripheral Blood Emory University’s Children’s Clinical and Translational Discovery Core N/A Human Adult Bone Marrow Emory University; AllCells N/A ------------------------- Critical coFull Paper
2022Magis, W;DeWitt, MA;Wyman, SK;Vu, JT;Heo, SJ;Shao, SJ;Hennig, F;Romero, ZG;Campo-Fernandez, B;Said, S;McNeill, MS;Rettig, GR;Sun, Y;Wang, Y;Behlke, MA;Kohn, DB;Boffelli, D;Walters, MC;Corn, JE;Martin, DIK;High-level correction of the sickle mutation is amplified in vivo during erythroid differentiationiScience35633935Cryopreserved CD34+ cells were thawed according to AllCells instructions and cultured for 2 days in StemSpan SFEM with CC110 supplement (StemCell Technologies). For each Save;. Methods CD34+cells CD34+ HSPCs homozygous for the sickle mutation wereFull Paper
2022Liu, P;Qin, L;Liu, C;Mi, J;Zhang, Q;Wang, S;Zhuang, D;Xu, Q;Chen, W;Guo, J;Wu, X;Exosomes Derived From Hypoxia-Conditioned Stem Cells of Human Deciduous Exfoliated Teeth Enhance Angiogenesis via the Transfer of let-7f-5p and miR-210-3pFrontiers in cell and developmental biology35557954Human umbilical vein endothelial cells (HUVECs) were purchased from AllCells (Cat. H-001F, AllCells) and were cultured in DMEM (Cat. SH30021.01, Hyclone) supplemented with 10 SaveFull Paper
2022Li, L;Zhou, B;Xu, H;Shi, H;Gao, L;Ge, B;Zinc-Loaded Black Phosphorus Multifunctional Nanodelivery System Combined With Photothermal Therapy Have the Potential to Treat Prostate Cancer Patients Infected With COVID-19Frontiers in endocrinology35464050n, USA). Human HMGB1 ELISA Kit was obtained from Arigo Biolaboratories (Taiwan, China). ATP content detection kit was obtained from Solarbio (Beijing, China). Dendritic cells (DCs) were obtained from AllCells (San Francisco, USA). FITC anti-human CD1Full Paper
2022McGovern, K;Castro, AC;Cavanaugh, J;Coma, S;Walsh, M;Tchaicha, J;Syed, S;Natarajan, P;Manfredi, M;Zhang, XM;Ecsedy, J;Discovery and Characterization of a Novel Aryl Hydrocarbon Receptor Inhibitor, IK-175, and Its Inhibitory Activity on Tumor Immune SuppressionMolecular cancer therapeutics35666806Naive human T cells (CD4+/CD62L+) from two independent donors were isolated from cryopreserved CD4+ T cells (AllCells) by magnetic selection with human CD62 L microbeads (Miltenyi). On Day 1, naive CD62L+ human T cells were activated with human CD3/CFull Paper
2022Lin, W;Qian, J;Wang, H;Ren, L;Yang, Y;Chen, C;Chen, X;Huang, Y;Liu, J;Xu, N;Teng, L;Cisplatin plus anti-PD-1 antibody enhanced treatment efficacy in advanced esophageal squamous cell carcinomaAmerican journal of cancer research35261780Therapies for patients with advanced esophageal squamous cell carcinoma (ESCC) are limited and accompanied by dismal prognosis. Here we use ESCC cell line K30 and TE-1 to SaveFull Paper
2022Duan, J;Lei, D;Ling, C;Wang, Y;Cao, Z;Zhang, M;Zhang, H;You, Z;Yao, Q;Three-dimensional-printed polycaprolactone scaffolds with interconnected hollow-pipe structures for enhanced bone regenerationRegenerative biomaterials35719204CR MasterMix (ABM, CA) on a Light Cycler 480 II (Roche, CHE). To evaluate the expression of angiogenesis genes (HIF1-α and VEGF), human umbilical vein endothelial cells (HUVECs) were purchased from AllCells. First, 6 × 105 HUVECs were seeded verticaFull Paper
2022Li, Z;Kou, L;Fu, X;Xie, Z;Xu, M;Guo, L;Lin, T;Gong, S;Zhang, S;Liu, M;Design, synthesis, and biological evaluation of triazole-pyrimidine-methylbenzonitrile derivatives as dual A2A/A2B adenosine receptor antagonistsJournal of enzyme inhibition and medicinal chemistry35616298Cryopreserved PBMCs (Allcells) were thawed and recovered in RPMI1640 medium overnight before being used. And compounds to be tested were diluted with DMSO to 100 folds of SaveFull Paper
2022Hu, S;Muniraj, G;Mishra, A;Hong, K;Lum, JL;Hong, CHL;Rosa, V;Sriram, G;Characterization of silver diamine fluoride cytotoxicity using microfluidic tooth-on-a-chip and gingival equivalentsDental materials : official publication of the Academy of Dental Materials35778310Objective This study aims to characterize the cytotoxicity potential of silver diamine fluoride (SDF) on dental pulp stem cells (DPSC) and gingival equivalents. Methods DPSC cultured on SaveFull Paper
2022Dogan, M;Karhan, E;Kozhaya, L;Placek, L;Chen, X;Yigit, M;Unutmaz, D;Engineering Human MAIT Cells with Chimeric Antigen Receptors for Cancer ImmunotherapyJournal of immunology (Baltimore, Md. : 1950)36165183Healthy adult blood was obtained from AllCells (Quincy, MA). PBMCs were isolated using Ficoll-Paque plus (GE Healthcare). CD4 + T, CD8 + T, and CD19 + B cells and CD14 + SaveFull Paper
2022Ben Nasr, M;Robbins, D;Parone, P;Usuelli, V;Tacke, R;Seelam, AJ;Driver, E;Le, T;Sabouri-Ghomi, M;Guerrettaz, L;Shoemaker, D;Fiorina, P;Pharmacologically Enhanced Regulatory Hematopoietic Stem Cells Revert Experimental Autoimmune Diabetes and Mitigate Other Autoimmune DisordersJournal of immunology (Baltimore, Md. : 1950)35321879A total of 5000 cryopreserved and preisolated human mobilized peripheral blood HSCs (CD34 + cells) (AllCells) were plated into each well of a 384-well plate (Corning) in StemSpan- SaveFull Paper
2022Melani, RD;Des Soye, BJ;Kafader, JO;Forte, E;Hollas, M;Blagojevic, V;Negrão, F;McGee, JP;Drown, B;Lloyd-Jones, C;Seckler, HS;Camarillo, JM;Compton, PD;LeDuc, RD;Early, B;Fellers, RT;Cho, BK;Mattamana, BB;Goo, YA;Thomas, PM;Ash, MK;Bhimalli, PP;Al-Harthi, L;Sha, BE;Schneider, JR;Kelleher, NL;Next-Generation Serology by Mass Spectrometry: Readout of the SARS-CoV-2 Antibody RepertoireJournal of proteome research34878788odium heparin (BD 367874, Fisher Scientific) by centrifugation at 1,500 × g for 10 min. Plasma from a convalescent patient featuring a high titer of anti-SARS-CoV-2-RBD antibodies was purchased from AllCells (commercial sample 1 - CS1) and used as aFull Paper
2022Kawato, Y;Fukahori, H;Nakamura, K;Kanno, A;Kubo, K;Hiramitsu, M;Matsuda, T;Hanada, Y;Furukawa, T;Nakajima, Y;Kinugasa, F;Morokata, T;Potential benefit of the cathepsin S inhibitor, ASP1617, as a treatment for systemic lupus erythematosusEuropean journal of pharmacology35157914Five different lots of peripheral blood-derived frozen B cell were purchased from AllCells (Alameda, CA, USA). Cell suspensions (final, 2 × 10 6 SaveFull Paper
2022Pieles, O;Höring, M;Adel, S;Reichert, TE;Liebisch, G;Morsczeck, C;Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle CellsStem cells international35903407Human dental follicle cells were purchased from AllCells (Alameda, CA, USA) and cultured in Dulbecco's Modified Eagle's Medium (DMEM) containing 10% fetal bovine serum (FBS) SaveFull Paper
2022Schlichtner, S;Yasinska, IM;Ruggiero, S;Berger, SM;Aliu, N;Prunk, M;Kos, J;Meyer, NH;Gibbs, BF;Fasler-Kan, E;Sumbayev, VV;Expression of the Immune Checkpoint Protein VISTA Is Differentially Regulated by the TGF-β1 - Smad3 Signaling Pathway in Rapidly Proliferating Human Cells and T LymphocytesFrontiers in medicine35223897Medium was also supplemented with penicillin (50 IU/ml), and streptomycin sulfate (50 μg/ml). Primary human AML mononuclear blasts (AML-PB001F, newly diagnosed/untreated) were also purchased from AllCells (Alameda, CA, USA) and handled according toFull Paper
2022Yoshimaru, K;Yamaza, T;Kajioka, S;Sonoda, S;Yanagi, Y;Matsuura, T;Yoshizumi, J;Oda, Y;Iwata, N;Takai, C;Nakayama, S;Taguchi, T;Dental pulp stem cells as a therapy for congenital entero-neuropathyScientific reports35484137ies were passaged to expand the number of dDPSCs. Cells at P3 were used for the experiments. BMMSCs isolated from human whole bone marrow aspirates obtained from healthy adult volunteers (n = 3; AllCells, Alameda, CA, USA) and human skin fibroblastsFull Paper
2022Herrera, VLM;Walkey, AJ;Nguyen, MQ;Gromisch, CM;Mosaddhegi, JZ;Gromisch, MS;Jundi, B;Lukassen, S;Carstensen, S;Denis, R;Belkina, AC;Baron, RM;Pinilla-Vera, M;Mueller, M;Kimberly, WT;Goldstein, JN;Lehmann, I;Shih, AR;Eils, R;Levy, BD;Ruiz-Opazo, N;A targetable 'rogue' neutrophil-subset, [CD11b+DEspR+] immunotype, is associated with severity and mortality in acute respiratory distress syndrome (ARDS) and COVID-19-ARDSScientific reports35379853ARDS (n = 4) for inertial microfluidic separation (BDL, RMB, MPV) according to respective institutional guidelines. Blood collection Fresh normal peripheral blood neutrophils were procured from AllCells, LLC (CA), which were shipped overnight in IscFull Paper
2022Kim, DE;Shin, YH;Cho, JE;Myung, S;Kim, HG;Kim, KC;Park, CM;Yoon, CH;Identification of 3-Oxindole Derivatives as Small Molecule HIV-1 Inhibitors Targeting Tat-Mediated Viral TranscriptionMolecules (Basel, Switzerland)35956872d fetal bovine serum (all obtained from Gibco-BRL, Gaithersburg, MD, USA). The bl-DTR cells were additionally supplemented with 1 μg/mL puromycin and 200 μg/mL zeocin. The PBMCs were purchased from AllCells (Alameda, CA, USA) and cultured, as describFull Paper
2022Saaid, A;Ensanya, A;Suzina, S;Nurul, A;Samsudin, A;Azlina, A;Odontogenic induction of human amniotic membrane scaffold for dental pulp regenerationMaterials Chemistry and PhysicsFor this study, deciduous teeth stem cells (DTSCs), obtained from ALLCELLS, USA, were used at passage 4-8. The cells were allowed to grow in a-modified Eagle's medium (α-MEM) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin/streptomycFull Paper
2022Jaimes, MC;Leipold, M;Kraker, G;Amir, EA;Maecker, H;Lannigan, J;Full spectrum flow cytometry and mass cytometry: A 32-marker panel comparisonCytometry. Part A : the journal of the International Society for Analytical Cytology35593221Frozen PBMCs from 5 donors were obtained from AllCells Alameda (Alameda, CA). Cells were provided aliquoted in 25 million cells per vial in freezing media and cryopreserved in liquid nitrogen until ready to use. Ethical review and regulatory complianFull Paper
2022Moore, KP;Schwaid, AG;Tudor, M;Park, S;Beshore, DC;Converso, A;Shipe, WD;Anand, R;Lan, P;Moningka, R;Rothman, DM;Sun, W;Chi, A;Cornella-Taracido, I;Adam, GC;Bahnck-Teets, C;Carroll, SS;Fay, JF;Goh, SL;Lusen, J;Quan, S;Rodriguez, S;Xu, M;Andrews, CL;Song, C;Filzen, T;Li, J;Hollenstein, K;Klein, DJ;Lammens, A;Lim, UM;Fang, Z;McHale, C;Li, Y;Lu, M;Diamond, TL;Howell, BJ;Zuck, P;Balibar, CJ;A Phenotypic Screen Identifies Potent DPP9 Inhibitors Capable of Killing HIV-1 Infected CellsACS chemical biology36044633Cells were purchased from AllCells in cryopreserved vials. Cells were centrifuged at 500×g for 10 min at 4 C. The supernatant was removed, and cells were washed with 20 mL PBS. SaveFull Paper
2022Zhang, H;Lv, X;Kong, Q;Tan, Y;IL-6/IFN-γ double knockdown CAR-T cells reduce the release of multiple cytokines from PBMCs in vitroHuman vaccines & immunotherapeutics35049413rward TGGGAGCATGTGAATGCCATCC Reverse GTCGGCTCCTGGAGGTCAAACA β-actin Forward CGCCCCAGGCACCAGGGC Reverse GCTGGGGTGTTGAAGGT 2.3. IL-6/IFN-γ double KD CAR-T cell culture The PBMCs (Allcells, Cat: PB005F) were resuspended in CTSTM AIMFull Paper
2022Zhou, Z;Qin, M;Khodahemmati, S;Li, W;Niu, B;Li, J;Liu, Y;Gao, J;Gene expression in human umbilical vein endothelial cells exposed to fine particulate matter: RNA sequencing analysisInternational journal of environmental health research34102927We maintained HUVECs (Allcells, China) routinely in HUVEC complete culture medium (Allcells, China), supplemented with 10% fetal bovine serum (FBS), 2% growth factors, 100 U/mL SaveFull Paper
2022Wang, X;Wong, LM;McElvain, ME;Martire, S;Lee, WH;Li, CZ;Fisher, FA;Maheshwari, RL;Wu, ML;Imun, MC;Murad, R;Toledo Warshaviak, D;Yin, J;Kamb, A;Xu, H;A rational approach to assess off-target reactivity of a dual-signal integrator for T cell therapyToxicology and applied pharmacology35085592Informed-consent for use of primary T cells and donor collection protocols was approved by an Institutional Review Board (IRB) at Allcells or HemaCare. Allcells and HemaCare SaveFull Paper
2022Andrews, SH;Klinker, MW;Bauer, SR;Marklein, RA;Morphological landscapes from high content imaging reveal cytokine priming strategies that enhance mesenchymal stromal cell immunosuppressionBiotechnology and bioengineering34716713Human bone marrow-derived MSCs were obtained from four different donors purchased from Lonza, AllCells, and RoosterBio (see Table S1 for donor information). MSC culture conditions for the Lonza and AllCells (8F3560, 110877, PCBM1662) were chosen baseFull Paper
2022Mandal, S;Sunagawa, SW;Prathipati, PK;Belshan, M;Shibata, A;Destache, CJ;Targeted Immuno-Antiretroviral to Promote Dual Protection against HIV: A Proof-of-Concept StudyNanomaterials (Basel, Switzerland)35683795were maintained in a complete DMEM medium (HiDMEM medium supplemented with 10% FBS and 1× AA) as standard protocol [14,15]. The human peripheral blood mononuclear cells (hPBMCs) were purchased from AllCells (Alameda, CA, USA) and maintained in compFull Paper
2022Huang, P;Zhang, C;Delawary, M;Korchak, JA;Suda, K;Zubair, AC;Development and evaluation of IL-6 overexpressing mesenchymal stem cells (MSCs)Journal of tissue engineering and regenerative medicine34890489Human bone marrow derived mesenchymal stem cells (BMSCs) were isolated from commercial de-identified bone marrow (AllCells, Alameda, CA) from a healthy 28-year-old male SaveFull Paper
2022Harper, T;Sharma, A;Kaliyaperumal, S;Fajardo, F;Hsu, K;Liu, L;Davies, R;Wei, YL;Zhan, J;Estrada, J;Kvesic, M;Nahrwold, L;Deisting, W;Panzer, M;Cooke, K;Lebrec, H;Nolan-Stevaux, O;Characterization of an Anti-CD70 Half-Life Extended Bispecific T-Cell Engager (HLE-BiTE) and Associated On-Target Toxicity in Cynomolgus MonkeysToxicological sciences : an official journal of the Society of Toxicology35583313Human T cells (AllCells) or cynomolgus monkey or human peripheral blood mononuclear cells (PBMCs) (SNBL) were cocultured with target cells at an effector cell (E) to target cell (T) SaveFull Paper
2022Wang, P;Zhang, J;Zhang, H;Zhang, F;The role of MACF1 on acute myeloid leukemia cell proliferation is involved in Runx2-targeted PI3K/Akt signalingMolecular and cellular biochemistry35857251Bone marrow CD34 + hematopoietic stem and progenitor cells (HSPCs) were purchased from AllCells (Alameda, CA, USA) and cultured in X-Vivo 15 media (Lonza, Basel, Switzerland) SaveFull Paper
2022Shams, F;Bayat, H;Mohammadian, O;Mahboudi, S;Vahidnezhad, H;Soosanabadi, M;Rahimpour, A;Advance trends in targeting homology-directed repair for accurate gene editing: An inclusive review of small molecules and modified CRISPR-Cas9 systemsBioImpacts : BI35975201A) Treatment group 1A (unedited HSCs from AllCells). The first mouse was found dead in Treatment group 2B, which contained edited bought HSCs (AllCells), had the highest bone SaveFull Paper
2022Liu, Y;Ma, X;Yang, H;Li, X;Ma, Y;Ason, B;Liu, S;Hu, LA;APLNR Regulates IFN-γ signaling via β-arrestin 1 mediated JAK-STAT1 pathway in melanoma cellsThe Biochemical journal35084016Naive CD8+ T cells used for co-culture assay were obtained from Allcells and cultured in RPMI 1640 medium supplemented with 10% FBS, 1× HEPES, 1× PS, 2 mM Glutamine, 1 mM SaveFull Paper
2022Venn-Watson, SK;Butterworth, CN;Broader and safer clinically-relevant activities of pentadecanoic acid compared to omega-3: Evaluation of an emerging essential fatty acid across twelve primary human cell-based disease systemsPloS one35617322lowed ethical guidelines and documented informed consent: Cell Applications, Inc., CellzDirect, Celsis-IVT, Leukolab, Life Technologies, Lonza, ScienCell, Hemacare Corporation, Stemcell Technologies, AllCells, Physician’s Plasma Alliance, Lifeline CeFull Paper
2022Okada, Y;Kawashima, N;Noda, S;Murano, H;Han, P;Hashimoto, K;Kaneko, T;Okiji, T;VEGFA promotes odonto/osteoblastic differentiation in dental pulp stem cells via ERK/p38 signalingJournal of Dental SciencesSHEDs (P5, DP001F; AllCells, Alameda, CA, USA) were cultured in alpha-modified Eagle's minimum essential medium (α-MEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Waltham, MA, USA) and an antibiotic and antifungal solutiFull Paper
2022Chen, W;Qie, C;Hu, X;Wang, L;Jiang, J;Liu, W;Liu, J;A small molecule inhibitor of VSIG-8 prevents its binding to VISTAInvestigational new drugs35404016PBMCs were purchased from Allcells Biotechnology (Shanghai) Co., LTD, and we got a statement confirming that informed consent was obtained from all subjects, the attachment is on response. Jurkat cells were cultured in RPMI-1640 medium (Biological InFull Paper
2022Han, Y;Bai, X;Wang, X;Exosomal myeloperoxidase as a biomarker of deep venous thrombosisAnnals of translational medicine35242854al microscope (Olympus). HUVECs culture We purchased HUVECs from American Type Culture Collection and cultured them in endothelial cell complete medium containing endothelial cell growth supplement (AllCells, Alameda, CA, USA) at 37 °C in a humidifiFull Paper
2022Sato, M;Fujii, K;Takagi, H;Shibuya, I;Oka, D;Yamaya, N;Hagita, H;Matsumoto, M;Inagaki, K;Antibacterial and Immunosuppressive Effects of OPS-2071, a Candidate Therapy for Inflammatory Bowel DiseaseDigestive diseases and sciences34463880Mouse splenocytes were prepared from eight-week-old female BALB/c mice, and human peripheral blood mononuclear cells (PBMC) were purchased from AllCells (Alameda, CA). To SaveFull Paper
2022Skaddan, MB;Wooten, DW;Wilcox, KC;Voorbach, MJ;Reuter, DR;Jia, ZJ;Foster-Duke, KD;Hickson, JA;Vaidyanathan, S;Reed, AD;Tovcimak, AE;Guo, Q;Comley, RA;Lee, L;Finnema, SJ;Mudd, SR;[18F]BTK-1: A Novel Positron Emission Tomography Tracer for Imaging Bruton's Tyrosine KinaseMolecular imaging and biology35482146Purpose Bruton's tyrosine kinase (BTK) is a key component of B cell receptor (BCR) signaling, and as such a critical regulator of cell proliferation and survival. Aberrant BCR signaling is SaveFull Paper
2022Wu, C;Wang, X;Shang, H;Wei, H;Construction of a Humanized PBMC-PDX Model to Study the Efficacy of a Bacterial Marker in Lung Cancer ImmunotherapyDisease markers36072895, Ltd., and the RPMI-1640 Complete Medium (10%FBS; Gibco) was used for culture. When the cells reached 80% confluence, they were passed on. 2.3. PBMCs Immune Reconstitution PBMCs were purchased from AllCells and processed according to the company'sFull Paper
2022Ryan, DE;Diamant-Levi, T;Steinfeld, I;Taussig, D;Visal-Shah, S;Thakker, S;Lunstad, BD;Kaiser, RJ;McCaffrey, R;Ortiz, M;Townsend, J;Welch, WRW;Singh, M;Curry, B;Dellinger, DJ;Bruhn, L;Phosphonoacetate Modifications Enhance the Stability and Editing Yields of Guide RNAs for Cas9 EditorsBiochemistry35436085Human primary T cells (LP, CR, CD3+, NS) were obtained from AllCells (Alameda, CA) and were cultured in RPMI 1640 plus GlutaMax media supplemented with 10% fetal bovine serum, 5 ng/mL human IL-7, and 5 ng/mL human IL-15 (Gibco). Primary T cells wereFull Paper
2022Darbaniyan, F;Zheng, H;Kanagal-Shamanna, R;Lockyer, P;Montalban-Bravo, G;Estecio, M;Lu, Y;Soltysiak, KA;Chien, KS;Yang, H;Sasaki, K;Class, C;Ganan-Gomez, I;Do, KA;Garcia-Manero, G;Wei, Y;Transcriptomic Signatures of Hypomethylating Agent Failure in Myelodysplastic Syndromes and Chronic Myelomonocytic LeukemiaExperimental hematology36150563CD34 + cells isolated from healthy individuals (AllCells, Alameda CA) and from patients with MDS or CMML were plated into human methylcellulose colony formation medium Methocult- SaveFull Paper
2022Valdez, BC;Yuan, B;Murray, D;Nieto, Y;Popat, U;Andersson, BS;Enhanced cytotoxicity of bisantrene when combined with venetoclax, panobinostat, decitabine and olaparib in acute myeloid leukemia cellsLeukemia & lymphoma35188042Bisantrene (Bis), a topoisomerase-II inhibitor, is less cardiotoxic than the current anthracyclines. Its synergistic cytotoxicity with newly developed antineoplastic drugs has not been SaveFull Paper
2022Fan, F;Liu, F;Shen, P;Tao, L;Zhang, H;Wu, H;Salvianolic acid B, a new type I IRE1 kinase inhibitor, abrogates AngII-induced angiogenesis by interacting with IRE1 in its active conformationClinical and experimental pharmacology & physiology36153795Primary human umbilical vein endothelial cells (HUVECs) were purchased from AllCells (Shanghai, China) and cultured in EBM media (AllCells ) according to the manufacturer's SaveFull Paper
2022Tong, Q;Liu, H;Qi, Q;Dai, C;Yang, T;Qian, F;Development of a fully human anti-GITR antibody with potent antitumor activity using H2L2 miceFEBS open bio35674216h well, and luminescence values were measured using a Varioskan LUX (Thermo, Carlsbad, CA, USA). T‐cell activation assays Total T cells from frozen human peripheral blood mononuclear cells (PBMCs, AllCells, Alameda, CA, USA) were first isolated usinFull Paper
2022Yang, M;Tkach, D;Boyne, A;Kazancioglu, S;Duclert, A;Poirot, L;Duchateau, P;Juillerat, A;Optimized two-step electroporation process to achieve efficient nonviral-mediated gene insertion into primary T cellsFEBS open bio34510816ineering in human primary cells and provide a foundation for further advances using nonviral gene editing methods. Materials and methods T‐cell culture Cryopreserved human PBMCs were acquired from ALLCELLS. PBMCs were cultured in X‐vivo‐15 media (LoFull Paper
2022Pieles, O;Reichert, TE;Morsczeck, C;Protein kinase A is activated during bone morphogenetic protein 2-induced osteogenic differentiation of dental follicle stem cells via endogenous parathyroid hormone-related proteinArchives of oral biology35338829Human dental follicle stem cells (Catalog number FT002F, Lot number ACF001) were commercially obtained from AllCells (Emeryville, USA) and cultured in Dulbecco's Modified Eagle's Medium (DMEM) high glucose (Sigma Aldrich, St. Louis, USA) with 10% fetFull Paper
2022Qian, J;Yu, J;Zhu, X;Liang, S;MiR-335 promotes corneal neovascularization by Targeting EGFRBMC ophthalmology35701740surgery and on day 3, 7, 11 and 14. The Animal Research Committee of the Affiliated Hospital of Nantong University approved all animal studies. Cell culture and different treatments HUVECs were from AllCells (Shanghai, China). They were put in an RPFull Paper
2022Wang, W;Tang, W;Shan, E;Zhang, L;Chen, S;Yu, C;Gao, Y;MiR-130a-5p contributed to the progression of endothelial cell injury by regulating FASEuropean journal of histochemistry : EJH35638591cells (HUVEC) in vitro. Materials and Methods Cell culture HUVEC cells have played a major role as a model system for the study of the regulation of endothelial cell function. HUVEC cells (Shanghai AllCells Biotech Co., Ltd. Shanghai, China) were cuFull Paper
2022Koh, H;Zhen, X;Kim, J;Ha, HY;Lee, JH;Generation and characterization of human umbilical cord blood-derived induced pluripotent stem cells (KRIBBi005-A)Stem cell research35085946Ethical approval Approval obtained by Public Institutional Bioethics Committee designated by the MOHW (P01-201909-31-002). Cord blood mononuclear cells were purchased (AllCells LLC)Full Paper
2022Hashim, SNM;Azlina, A;Ultrastructural morphological changes of VEGF treated-stem cells from human exfoliated deciduous teeth cultured on human amniotic membraneActa MicroscopicaSHED (AllCells, USA) were cultured in a complete medium made of the Minimum Essential Medium (MEM) Alpha Medium (α-MEM) (Gibco, USA), supplemented with 15% of fetal bovine serum (FBS) (Gibco, USA) and 50 U/ml of penicillin-stFull Paper
2022Bai, Y;Zhang, X;Zheng, J;Liu, Z;Yang, Z;Zhang, X;Overcoming high level adenosine-mediated immunosuppression by DZD2269, a potent and selective A2aR antagonistJournal of experimental & clinical cancer research : CR36229853bR, CHO-A1R and CHO-A3R) were purchased from GenScript. Cell lines RM-1, B16F10 and Pan02 were obtained from the American Type Culture Collection (ATCC). Cryopreserved human PBMCs were purchased from AllCells. All CHO cells were cultured in Ham’s F12Full Paper
2022Kartha, VK;Duarte, FM;Hu, Y;Ma, S;Chew, JG;Lareau, CA;Earl, A;Burkett, ZD;Kohlway, AS;Lebofsky, R;Buenrostro, JD;Functional inference of gene regulation using single-cell multi-omicsCell genomics36204155AILS Human peripheral blood mononuclear cells Cryopreserved human peripheral blood mononuclear cells (PBMCs) and isolated peripheral blood CD4+, CD8+, CD14+, CD19+ and CD56+ cells were purchased from AllCells (see Table S1 for catalog numbers and donFull Paper
2022Riaz, S;Azlina, A;Mahmood, Z;Htun, AT;Long-term treatment of dentine with triple antibiotic paste promotes stem cell viability and attachmentJournal of Taibah University Medical Sciences35983454, the dentine chips were removed from the well plates and air-dried on a filter paper. The samples were then stored in a sterile container at 4 °C until further use. Cell culture Commercial DPSCs (AllCells, USA) were used from passage 7 to 9 at 70%-Full Paper
2022Salam, N;Gibson, IR;Lithium ion doped carbonated hydroxyapatite compositions: Synthesis, physicochemical characterisation and effect on osteogenic response in vitroBiomaterials advances35939955the American Type Culture Collection (via LGC standards, UK), PromoCell (Germany), and AllCells (USA), respectively. Cells were maintained in routine culture conditions using: high glucose DMEM with 10 % FBS and 4 mM l-glutamine for C2C12 cells, GibcFull Paper
2022Nakauchi, Y;Azizi, A;Thomas, D;Corces, MR;Reinisch, A;Sharma, R;Cruz Hernandez, D;Köhnke, T;Karigane, D;Fan, A;Martinez-Krams, D;Stafford, M;Kaur, S;Dutta, R;Phan, P;Ediriwickrema, A;McCarthy, E;Ning, Y;Phillips, T;Ellison, CK;Guler, GD;Bergamaschi, A;Ku, CJ;Levy, S;Majeti, R;The Cell Type-Specific 5hmC Landscape and Dynamics of Healthy Human Hematopoiesis and TET2-Mutant PreleukemiaBlood cancer discovery35532363Normal donor human BM cells were obtained fresh from AllCells, and peripheral blood cells Human BM samples (CD34+ cell enriched) were purchased from AllCells. Mononuclear SaveFull Paper
2022Baskar, R;Chen, AF;Favaro, P;Reynolds, W;Mueller, F;Borges, L;Jiang, S;Park, HS;Kool, ET;Greenleaf, WJ;Bendall, SC;Integrating transcription-factor abundance with chromatin accessibility in human erythroid lineage commitmentCell reports methods35463156# ab181544 Cleaved caspase 3-PE BD Biosciences Cat# 550821, RRID:AB_393906 ------------------------- Biological samples ------------------------- Adult bone marrow All Cells Inc https://allcells.com/research-grade-tissue-products/bone-mFull Paper
2022Kwak, J;Choi, W;Bae, Y;Kim, M;Choi, S;Oh, W;Jin, H;HLA-A2 Promotes the Therapeutic Effect of Umbilical Cord Blood-Derived Mesenchymal Stem Cells in Hyperoxic Lung InjuryBioengineering (Basel, Switzerland)35447737St. Louis, MO, USA) for 1 h at 37 °C. The UCB-MSCs (1 × 103 cells/well) were seeded and maintained at 37 °C in a humidified incubator for 4 h and then co-cultured with PBMCs (1 × 105 cells/well; Allcells, Boston, MA, USA) from different donors. PhytoFull Paper
2022Vivanco Gonzalez, N;Oliveria, JP;Tebaykin, D;Ivison, GT;Mukai, K;Tsai, MM;Borges, L;Nadeau, KC;Galli, SJ;Tsai, AG;Bendall, SC;An optimized protocol for phenotyping human granulocytes by mass cytometrySTAR protocols35434655y donors (with unknown allergy status) were obtained from the Stanford Blood Center (Palo Alto, CA, USA). Healthy bone marrow and peripheral blood samples paired from the same donor were ordered from AllCells (Alameda, CA, USA). Samples from patientsFull Paper
2022Bell-Glenn, S;Thompson, JA;Salas, LA;Koestler, DC;A Novel Framework for the Identification of Reference DNA Methylation Libraries for Reference-Based Deconvolution of Cellular MixturesFrontiers in bioinformatics35419567Cell Mixture Reconstruction Experiment Purified cells taken from normal human subjects were purchased from AllCells LLC (Emeryville, CA). Namely, granulocytes, monocytes, CD4T, SaveFull Paper
2022Shui, S;Wang, S;Liu, J;Systematic Investigation of the Effects of Multiple SV40 Nuclear Localization Signal Fusion on the Genome Editing Activity of Purified SpCas9Bioengineering (Basel, Switzerland)35200436s medium (DMEM) supplemented with 10% (v/v) FBS, 100 U/mL penicillin and 100 U/mL streptomycin. The medium of EGFP reporter contained an additional 50 U/mL hygromycin. Human dermal fibroblasts (hDF, AllCells) were acquired from Cell Applications (LotFull Paper
2022Li, L;Xu, H;Gao, L;Doxorubicin-Loaded Black Phosphorus Multifunctional Nanodelivery System Combined with Photothermal Therapy Promotes Immunogenic Death of Prostate Cancer PC-3 CellsSSRN Electronic JournalBeijing, China). Dendritic cells (DCs) were 197obtained from AllCells (San Francisco, USA). FITC anti198human CD11c Antibody, Alexa Fluor® 647 anti-human 199CD80 Antibody, PE anti-human CD86 Antibody, and 200PerCP/Cyanine5.5 anti-human HLA-DR AntibodFull Paper
2022Calderon, A;Kim, Y;Favaro, P;Baskar, R;Valainis, J;Reynolds, W;Borges, L;Glass, D;Tsai, A;Bendall, S;Multi-Omic Single Cell Identification of Lin- CD34- Natural Killer Cell Progenitors in Human HematopoiesisSSRN Electronic JournalDeidentified human blood (n=5) and BM (n=7) were obtained from healthy adult donors (Stanford Blood Center, Allcells). All samples were obtained under informed consent and in SaveFull Paper
2022Lee, J;Jonus, H;Sadanand, A;Branella, G;Maximov, V;Suttapitugsakul, S;Schniederjan, M;Shim, J;Parwani, K;Fedanov, A;Pilgrim, A;Silva, J;Doering, C;Wu, R;Spencer, H;Goldsmith, K;Identification and Targeting of Protein Tyrosine Kinase 7 (PTK7) as an Immunotherapy Candidate for Neuroblastoma Cellular TherapySSRN Electronic JournalGD2-targeted immunotherapy improves survival for pediatric patients with neuroblastoma (NB). However, toxicities associated with on-target, off-tumor activity occur. Furthermore, GD2 SaveFull Paper
2022O'Brien, G;Cecotka, A;Manola, K;Pagoni, M;Polańska, J;Badie, C;Epigenetic Signature of Ionising Radiation In Therapy-Related AML PatientsSSRN Electronic JournalBone marrow aspirate samples were also obtained from 5 healthy normal donors (4 males, 1 female, age 21-33) from AllCells® (Alamada, USA). The project was in accordance with the declaration of Helsinki. Informed consent was provided from patients andFull Paper
2022Qian, T;Qi, B;Fei, Y;Li, J;Luo, L;Song, Y;Sheng, S;Lv, B;Huang, X;Wang, X;Deletion of PLD2 Alleviates LPS Induced Acute Lung Injury by Inhibiting STAT3 Phosphorylation and Regulating Endothelial Tight JunctionsResearch SquareHUVECs were purchased from the Shanghai cell bank and cultured in a 5% CO2 incubator at 37oC in a complete culture medium (AllCells, Shanghai, China). Cells were cultured to 85- SaveFull Paper
2022Li, W;Li, J;Hu, X;Xu, L;Liu, X;Qian, Z;Jin, L;Zhang, Y;Wei, J;Liu, X;Tumor suppression by Chinese cordyceps extract via anti-angiogenesisResearch SquareHuman umbilical vein endothelial cells (HUVECs) were purchased from Allcells (Shanghai, China) and cultured in special medium for HUVEC cells at 37C with 5% CO2. CCE was SaveFull Paper
2022Li, L;Chen, X;Li, Y;Lou, L;Pharmacological characterization of GR1803, a novel BCMA × CD3 bispecific antibody for multiple myeloma treatmentResearch SquareThe MM cell lines NCI-H929, MM.1S, RPMI-8226, and U266 were obtained from the American Type Culture Collection (Manassas, VA, USA). Fresh peripheral blood mononuclear cells (PBMCs) were obtained from AllCells Co. (Shanghai, China). Natural killer (NKFull Paper
2022Yan, F;Luo, B;Chen, C;Tan, B;Cui, D;Wang, M;Qian, J;Inhibiting PHD2 in bone marrow mesenchymal stem cells in an inflammatory microenvironment facilitates periodontal repair in SD ratsResearch SquarePrimary BMMSCs of SD rats were isolated and puri ed by AllCells (Alameda, CA, USA), and their phenotype was identi ed. The cells were recovered and cultured in low glucose SaveFull Paper
2022Guedes, F;Branquinho, M;Biscaia, S;Alvites, R;Sousa, A;Lopes, B;Sousa, P;Rêma, A;Amorim, I;Faria, F;Patrício, T;Bugalho, A;Alves, N;Maurício, A;Gamma Irradiation Processing on 3D PCL Devices - A Preliminary Biocompatibility AssessmentpreprintsHuman Dental Pulp stem/stromal cells (hDPSCs) obtained from AllCells, LLC (Cat. DP0037F, Lot Nº DPSC090411-01) were maintained in MEM α, GlutaMAX™ Supplement, no nucleosides (Gibco, 32561029), supplemented with 10% (v/v) fetal bovine serum (FBS) (GibFull Paper
2022Tokatlian, T;Asuelime, G;Naradikian, M;Mock, J;Daris, M;Martin, A;Toledo Warshaviak, D;Kamb, A;Hamburger, A;Chimeric Antigen Receptors Directed at Mutant KRAS Exhibit an Inverse Relationship Between Functional Potency and Neoantigen SelectivityCancer Research CommunicationsPeripheral blood mononuclear cells (PBMC) from healthy donors were obtained from AllCells. PBMC collection and donor written informed consent were approved by an Institutional SaveFull Paper
2022Boccacci, Y;Dumont, N;Doyon, Y;Laganière, J;Accessory-cell-free differentiation of hematopoietic stem and progenitor cells into mature red blood cellsbioRxivThe culture and ex vivo engineering of red blood cells (RBCs) can help characterize genetic variants, model diseases, and may eventually spur the development of applications in SaveFull Paper
2022Checkley, M;Luttge, B;Dobrowolski, C;Wald, D;McMahon, D;Haidar, G;Sobolewski, M;Enick, P;Cyktor, J;Mellors, J;Karn, J;Reduction of the HIV-1 reservoir in T cells from persons with HIV-1 on suppressive antiretroviral therapy using expanded natural killer cells ex vivobioRxivFor this study leukapheresis packs from 5 HIV-1-negative donors were purchased from AllCells. 437 For HIV+ participants, PBMCs from well-suppressed ART-treated patients from the SaveFull Paper
2022Shabaneh, T;Moffett, H;Stull, S;Derezes, T;Tait, L;Park, S;Riddell, S;Lajoie, M;Safety switch optimization enhances antibody-mediated elimination of CAR T cellsbioRxivNatural killer cells were isolated from cryopreserved, T cell depleted (CD4-/CD8-) PBMC (AllCells) by negative selection using the EasySep Human NK Cell Kit (Stemcell) according to the manufacturer’s protocol. To activate their cytolytic function, isFull Paper
2022Wisdom, K;Suijker, J;van den Broek, L;Sridharan, B;Grandhi, T;Cheng, A;Lamb, M;Titus, S;Gehman, A;Poore, D;Shah, N;Cheng, S;Kim, E;Griffin, S;Ekert, J;Lung Tumor Microphysiological System with 3D Endothelium to Evaluate Modulators of T-Cell InfiltrationbioRxivAllCells and shipped to the MIMETAS research facility, or they 653 were isolated from AllCells For this, T-cells were isolated from full 654 fresh leukopaks (AllCells). Leukopaks were SaveFull Paper
2022Dogan, M;Karhan, E;Kozhaya, L;Placek, L;Chen, X;Yigit, M;Unutmaz, D;Engineering human Mucosal Associated Invariant T (MAIT) cells with chimeric antigen receptors for cancer immunotherapy1bioRxivHealthy adult blood was obtained from AllCells Quincy, MA. PBMCs were isolated using Ficoll- 100 paque plus (GE Health care). CD4+ T, CD8+ T, CD19+ B cells, CD14+ monocytes SaveFull Paper
2022Swift, M;Horns, F;Quake, S;Fate Bias and Transcriptional Memory of human B cellsbioRxivfrom a healthy male aged 50-55 were obtained from AllCells. Mononuclear cells were isolated using Ficoll gradient and Red Blood Cell Lysis. Plasma cells from the bone marrow were isolated using StemCell EasySepEasySep™ Human CD138 Positive SelectionFull Paper
2022White, B;de Reyniès, A;Newman, A;Waterfall, J;Lamb, A;Petitprez, F;Valdeolivas, A;Lin, Y;Li, H;Xiao, X;Wang, S;Zheng, F;Yang, W;Yu, R;Guerrero-Gimenez, M;Catania, C;Lang, B;Domanskyi, S;Bertus, T;Piermarocchi, C;Monaco, G;Caruso, F;Ceccarelli, M;Yu, T;Guo, X;Coller, J;Maecker, H;Duault, C;Shokoohi, V;Patel, S;Liliental, J;Simon, S;Saez-Rodriguez, J;Heiser, L;Guinney, J;Gentles, A;Tumor Deconvolution DREAM Challenge consortium, ;Community assessment of methods to deconvolve cellular composition from bulk gene expressionbioRxivImmune and stromal cells provided by StemExpress and AllCells were isolated according to ) and the rest assigned immune cells from AllCells wherever availability allowed (Tables S5 Save CachedFull Paper
2022Simmons, S;Lithwick-Yanai, G;Adiconis, X;Oberstrass, F;Iremadze, N;Geiger-Schuller, K;Thakore, P;Frangieh, C;Barad, O;Almogy, G;Rozenblatt-Rosen, O;Regev, A;Lipson, D;Levin, J;Single cell RNA-seq by mostly-natural sequencing by synthesisbioRxivWe purchased 9 cryopreserved human PMBC samples (AllCells). We thawed PBMC vials in a 37C water bath for ∼2 minutes. A quick counting revealed high viability (>90%) in all SaveFull Paper
2022Seenappa, L;Jakubowski, A;Steinbuck, M;Palmer, E;Haqq, C;Carter, C;Fontenot, J;Villinger, F;McNeil, L;DeMuth, P;Programming the lymph node immune response with Amphiphile-CpG induces potent cellular and humoral immunity following COVID-19 subunit vaccination in mice and non-human primatesbioRxivwho had recovered from SARS-CoV-2 infection (COVID-19) were obtained from US Biolab (Rockville, MD) and ALLCELLS (Alameda, CA). All samples were received and stored frozen at −80°C until analysisFull Paper
2022Lutter, L;ter Linde, J;Brand, E;van Konijnenburg, D;Roosenboom, B;Talabur-Horje, C;Oldenburg, B;van Wijk, F;Compartment-driven imprinting of intestinal CD4 (regulatory) T cells in inflammatory bowel disease and homeostasisbioRxivCluster 1 (18.6% of allcells) was characterized by KLF2, SELL, CCR7, TCF7 and LEF1, and thus resembled recently migrated/recirculating T cells (figure 4A). This cluster contained both intraepithelial and lamina propria T cells (figure 4E). Similarly,Full Paper
2022Jaffe, D;Shahi, P;Adams, B;Chrisman, A;Finnegan, P;Raman, N;Royall, A;Tsai, F;Vollbrecht, T;Reyes, D;McDonnell, W;Functional antibodies exhibit light chain coherencebioRxivWe titrated and developed the B cell fractionation panel using 20 million fresh PBMCs (AllCells, catalog # 3050363) from a healthy human donor whose cells were not used to generate SaveFull Paper
2022Persad, S;Choo, Z;Dien, C;Masilionis, I;Chaligné, R;Nawy, T;Brown, C;Pe’er, I;Setty, M;Pe’er, D;SEACells: Inference of transcriptional and epigenomic cellular states from single-cell genomics databioRxivCryopreserved bone marrow stem/progenitor CD34+ cells from a healthy donor were purchased from AllCells, LLC. (catalog no. ABM022F) and stored in vapor phase nitrogen. Vial was removed from the storage and immediately thawed at 37 °C in a water bathFull Paper
2022Stuart, T;Hao, S;Zhang, B;Mekerishvili, L;Landau, D;Maniatis, S;Satija, R;Raimondi, I;Nanobody-tethered transposition allows for multifactorial chromatin profiling at single-cell resolutionbioRxivCryopreserved healthy donor PBMCs were isolated from mobilized peripheral blood, BMMCs were purchased from AllCells. After thawing into DMEM with 10% FBS, the cells were spun SaveFull Paper
2022MacMullan, M;Dunn, Z;Qu, Y;Wang, P;Graham, N;Phospho-proteomic analysis of CAR-T cell signaling following activation by antigen-presenting cancer cellsbioRxivcDNAs from BM CD34+, PB CD34+, BM MNCs, PB MNCs and BM MSCs purchased from AllCells (Emeryville, CA, USA) was obtained from a population of positive cells (purity exceeding 95%) collected from five individual donors. The level of cognate cDNA was meaFull Paper
2022Dogan, M;Kozhaya, L;Placek, L;Karabacak, F;Yigit, M;Unutmaz, D;Targeting SARS-CoV-2 infection through CAR-T like bispecific T cell engagers incorporating ACE2bioRxivHealthy adult blood was obtained from AllCells. PBMCs were isolated using Ficoll-paque plus (GE Health care). CD8 T cells were purified using Dynal CD8 Positive Isolation Kit (from SaveFull Paper
2022Yashar, W;Curtiss, B;Coleman, D;Van-Campen, J;Kong, G;Macaraeg, J;Estabrook, J;Demir, E;Long, N;Bottomly, D;McWeeney, S;Tyner, J;Druker, B;Maxson, J;Braun, T;Disruption of the MYC Super-Enhancer Complex by Dual Targeting of FLT3 and LSD1 in Acute Myeloid LeukemiabioRxivWhole bone marrow was obtained (AllCells) and CD34+ cells were selected using CD34 MicroBead Kit (Miltenyi Biotec) according to manufacturer’s instructions. For the colony assay, 500 CD34+ cells were used per replicate and plated in MethoCult™ H4435Full Paper
2022Aksöz, M;Gafencu, G;Stoilova, B;Buono, M;Meng, Y;Jakobsen, N;Metzner, M;Clark, S;Beveridge, R;Thongjuea, S;Vyas, P;Nerlov, C;Identification and Age-dependent Increase of Platelet Biased Human Hematopoietic Stem CellsbioRxivFresh BM from healthy young volunteers (21 to 34 years old males) were purchased from AllCells (Berkeley, CA) or Lonza (Lonza Bioscience, Basel, Switzerland). Bone marrow from older donors was obtained from orthoplastic surgery afterFull Paper
2022Xiang Ping, M;Zhi, H;Aziz, N;Hadri, N;Ghazalli, N;Yusop, N;Optimization of agarose-alginate hydrogel bead components for encapsulation and transportation of stem cellsJournal of Taibah University Medical SciencesStem cells from human exfoliated deciduous teeth (SHED) purchased from AllCells USA were revived from the cryovial and maintained in culture before encapsulation. SHED from SaveFull Paper
2022Marcisak, EF;Leveraging single-cell genomics to uncover clinical and preclinical responses to cancer immunotherapyThesisGFP due to transduction with pBMN-IRES-EGFP containing the FcγRIIIA construct. All NK cell lines were cultured as previously described[231]. Fresh healthy donor NK cells were purchased from AllCells (PB012-P). These NK cells were positively selectedFull Paper
2022Nesterenko, PA;Characterizing the T cell immune response through the receptor-ligand interactionThesisCell culture: Cryo preserved peripheral blood mononuclear cells (PBMCs) were commercially purchased (Allcells and Hemacare). PBMCs were thawed in a water bath set to 37C, transferred to 50 mL conical tube, 1 mL of warm R10 media was added drop wise aFull Paper
2022Chu, J;Ligament tissue engineering: assessing differentiation potential of dental follicle cells in a self-assembly three-dimensional organoid model.Thesisaccording to AllCells company regulations, further donor information such gender and exact age was not provided to the purchaser). The PDL-hTERT immortal cell line has already SaveFull Paper
2022Plasek, LM;Self-Silencing: An HIV Induced Mechanism for T Cell Quiescence and HIV LatencyThesisPeripheral blood mononuclear cells from HIV negative donors were purchased from AllCells. Naive CD4+ T cells were isolated using the EasySepTM Human Naive CD4+ T Cell SaveFull Paper
2022BOSYKH, D;Mechanisms and Biological Consequences of Mutual Reprogramming by Melanoma Cells and Normal Dermal FibroblastsThesisCell lines and medium Primary human neonatal dermal fibroblasts (NDFs; AllCells, LLC) were combined from three individual donors. NDFs were routinely tested for mycoplasma and confirmed to be negative using the MycoAlert mycoplasma detection kit (LonFull Paper
2022Oostindie, SC;Rinaldi, DA;Zom, GG;Wester, MJ;Paulet, D;Al-Tamimi, K;van der Meijden, E;Scheick, JR;Wilpshaar, T;de Jong, B;Hoff-van den Broek, M;Grattan, RM;Oosterhoff, JJ;Vignau, J;Verploegen, S;Boross, P;Beurskens, FJ;Lidke, DS;Schuurman, J;de Jong, RN;Logic-gated antibody pairs that selectively act on cells co-expressing two antigensNature biotechnology35879362PBMCs derived from patients with CLL were commercially obtained from Discovery Life Sciences. Characteristics of patients with CLL are summarized in Supplementary SaveFull Paper
2022Schuler, M;Cuppens, K;Ploenes, T;Vanbockrijck, M;Wiesweg, M;Darwiche, K;Schramm, A;Maes, B;Hegedus, B;Schildhaus, H;Hautzel, H;Theegarten, D;Baas, P;Hartemink, K;Du Pont, B;Aigner, C;LBA37 A randomized, multicentric phase II study of preoperative nivolumab plus relatlimab or nivolumab in patients with resectable non-small cell lung cancer (NEOpredict-Lung)Annals of Oncologycology, AstraZeneca, Eisai, Takeda, ZytoVision, Zytomed Systems, Molecular Health; Financial Interests, Institutional, Research Grant: Novartis Oncology; Financial Interests, Personal, Full or part-time Employment: Targos Molecular Pathology Inc.. H.Full Paper
2022Baraibar Argota, I;Garcia Rodriguez, A;Salvà Ballabrera, F;Ros Montana, F;Saoudi Gonzalez, N;Comas, R;Castillo, G;Sanchis, M;Hernando Cubero, J;García-Alvarez, A;Capdevila Castillon, J;Martí, M;Landolfi, S;Espin, E;Nuciforo, P;Vivancos, A;Tabernero, J;Elez Fernandez, M;332P Impact of the COVID-19 pandemic in the early-onset colorectal cancer (EOCRC)Annals of Oncologyersonal, Invited Speaker: Novartis; Financial Interests, Personal, Advisory Board: MSD Oncology, Bayer; Financial Interests, Personal, Other, Consultant: Targos Molecular Pathology GmbH. A. Vivancos: Financial Interests, Personal, Advisory Board: RocFull Paper
2022Lau, D;Khare, S;Stein, MM;Jain, P;Gao, Y;BenTaieb, A;Rand, TA;Salahudeen, AA;Khan, AA;Integration of tumor extrinsic and intrinsic features associates with immunotherapy response in non-small cell lung cancerNature communications35831288Samples for single-cell multi-omic sequencing were previously frozen dissociated tumor cells (DTCs) (Discovery Life Sciences, Huntsville, AL). DTCs were thawed and Save;xpression analyses were performed on log10-transformed counts. Single-cell mulFull Paper
2022Leung, DH;Devaraj, S;Goodrich, NP;Chen, X;Rajapakshe, D;Ye, W;Andreev, V;Minard, CG;Guffey, D;Molleston, JP;Bass, LM;Karpen, SJ;Kamath, BM;Wang, KS;Sundaram, SS;Rosenthal, P;McKiernan, P;Loomes, KM;Jensen, MK;Horslen, S;Bezerra, JA;Magee, JC;Merion, RM;Sokol, RJ;Shneider, BL;For ChiLDReN, ;Serum Biomarkers Correlated with Liver Stiffness Assessed in a Multi-center Study of Pediatric Cholestatic Liver DiseaseHepatology (Baltimore, Md.)36069569similar distributions of age- and sex-matched children with normal liver biochemistries and without known liver disease served as case controls (Discovery Life Sciences, SaveFull Paper
2022Yap, TA;Gainor, JF;Callahan, MK;Falchook, GS;Pachynski, RK;LoRusso, P;Kummar, S;Gibney, GT;Burris, HA;Tykodi, SS;Rahma, OE;Seiwert, TY;Papadopoulos, KP;Blum Murphy, M;Park, H;Hanson, A;Hashambhoy-Ramsay, Y;McGrath, L;Hooper, E;Xiao, X;Cohen, H;Fan, M;Felitsky, D;Hart, C;McComb, R;Brown, K;Sepahi, A;Jimenez, J;Zhang, W;Baeck, J;Laken, H;Murray, R;Trehu, E;Harvey, CJ;First-in-Human Phase I/II ICONIC Trial of the ICOS Agonist Vopratelimab Alone and with Nivolumab: ICOS-High CD4 T-Cell Populations and Predictors of ResponseClinical cancer research : an official journal of the American Association for Cancer Research35511938Full Paper
2022Shalev, TJ;Gamal El-Dien, O;Yuen, MMS;Shengqiang, S;Jackman, SD;Warren, RL;Coombe, L;van der Merwe, L;Stewart, A;Boston, LB;Plott, C;Jenkins, J;He, G;Yan, J;Yan, M;Guo, J;Breinholt, JW;Neves, LG;Grimwood, J;Rieseberg, LH;Schmutz, J;Birol, I;Kirst, M;Yanchuk, AD;Ritland, C;Russell, JH;Bohlmann, J;The western redcedar genome reveals low genetic diversity in a self-compatible coniferGenome research36109148University of British Columbia; tal.shalev@msl.ubc.ca.++University of British Columbia.++University of British Columbia.++Department of Energy Joint Genome Institute.++Canada's Michael Smith Genome Sciences Centre.++Canada's Michael Smith Genome ScieFull Paper
2022Cramer, DAT;Franc, V;Caval, T;Heck, AJR;Charting the Proteoform Landscape of Serum Proteins in Individual Donors by High-Resolution Native Mass SpectrometryAnalytical chemistry36074704ditions. Experimental Procedures Individual serum samples from six healthy donors were provided by Sanquin Research (Amsterdam, The Netherlands). Serum samples of diseased donors were purchased from Discovery Life Sciences (Columbus, OH, USA). FurthFull Paper
2022Pawley, DC;Dikici, E;Deo, SK;Raccamarich, P;Fischl, MA;Alcaide, M;Daunert, S;Rapid Point-of-Care Test Kit for Bacterial Vaginosis: Detection of Vaginolysin and Clue Cells Using Paper Strips and a SmartphoneAnalytical chemistry35943181Purchased patient samples from Discovery Life Sciences confirmed positive for BV were also tested. All patient samples tested showed elevated levels of VLY, indicating a SaveFull Paper
2022Nuti, S;Zhang, Y;Zerrouki, N;Roach, C;Bänfer, G;Kumar, GL;Manna, E;Diezko, R;Kersch, K;Rüschoff, J;Jasani, B;High interobserver and intraobserver reproducibility among pathologists assessing PD-L1 CPS across multiple indicationsHistopathology35993150Diezko is an employee of Targos Molecular Pathology GmbH, which performed pharmaceutical industry-sponsored professional training for pathologists and clinical trial Save;Biomarkers and Diagnostics, Oncology, Global Medical and Scientific Affairs,Full Paper
2022Loibl, S;Huang, CS;Mano, MS;Mamounas, EP;Geyer, CE;Untch, M;Thery, JC;Schwaner, I;Limentani, S;Loman, N;Lübbe, K;Chang, JC;Hatschek, T;Tesarowski, D;Song, C;Lysbet de Haas, S;Boulet, T;Lambertini, C;Wolmark, N;Adjuvant trastuzumab emtansine in HER2-positive breast cancer patients with HER2-negative residual invasive disease in KATHERINENPJ breast cancer36117201es obtained from the pretreatment primary tumor biopsy material (or residual tumor tissue from definitive surgery post-NAST). HER2 status of all samples was centrally assessed in the same laboratory (Targos Molecular Pathology, GmbH [Kassel, Germany]Full Paper
2022Seok, Y;Yin, Q;Li, R;Mauk, M;Bai, H;Bau, H;Manually-operated, slider cassette for multiplexed molecular detection at the point of careSensors and Actuators B: ChemicalHCV genotype 1 plasma sample (CV900106678051314DD, 69,000,000 IU/mL) for clinical research was purchased from Discovery life science Inc. (Huntsville, AL, USA)Full Paper
2022Singampalli, KL;Li, J;Lillehoj, PB;Rapid magneto-enzyme-linked immunosorbent assay for ultrasensitive protein detectionAnalytica chimica acta36038242falciparum infection obtained in Uganda under IRB/EC approval for general research use were purchased from Discovery Life Sciences. All human samples were de- Save; Blood samples from donors with P. falciparum infection obtained in Uganda under IRB/Full Paper
2022Koehler, VF;Adam, P;Fuss, CT;Jiang, L;Berg, E;Frank-Raue, K;Raue, F;Hoster, E;Knösel, T;Schildhaus, HU;Negele, T;Siebolts, U;Lorenz, K;Allelein, S;Schott, M;Spitzweg, C;Kroiss, M;German Study Group for Rare Malignant Tumors of the Thyroid and Parathyroid Glands, ;Treatment of RET-Positive Advanced Medullary Thyroid Cancer with Multi-Tyrosine Kinase Inhibitors-A Retrospective Multi-Center Registry AnalysisCancers35884466US is an employee of Targos Molecular Pathology, Inc., and received honoraria from or served as an advisory board member at Roche, Novartis Oncology, MSD, BMS, Save CachedFull Paper
2022Molina, SA;Davies, SJ;Sethi, D;Oh, S;Durand, N;Scott, M;Davies, LC;Wormuth, K;Clarke, D;Particulates are everywhere, but are they harmful in cell and gene therapies?Cytotherapy36175323International Society for Cell & Gene Therapy Process Development, Manufacturing, and Analytics Committee, Vancouver, Canada. Electronic address: sam.molina@gmail.com.++International Society for Cell & Gene Therapy Process Development, Manufacturing,Full Paper
2022Ren, Z;Chen, S;Qin, X;Li, F;Guo, L;Study of the roles of cytochrome P450 (CYPs) in the metabolism and cytotoxicity of perhexilineArchives of toxicology36083301Perhexiline is a prophylactic antianginal agent developed in the 1970s. Although, therapeutically, it remained a success, the concerns of its severe adverse effects Save;- Primary human hepatocytes (pooled from 10 donors) were obtained from DiscFull Paper
2022Cheng, LY;Dai, P;Wu, LR;Patel, AA;Zhang, DY;Direct capture and sequencing reveal ultra-short single-stranded DNA in biofluidsiScience36147958N = 6 plasma samples from diseased individuals (3 from Type 1 Diabetes (T1D) patients and 3 from Alzheimer’s disease (AD) patients) were acquired from BioIVT’s biorepository and shipped frozen. Animal total blood samples were purchased from DiscoveryFull Paper
2022Kemper, K;Gielen, E;Boross, P;Houtkamp, M;Plantinga, T;de Poot, S;Burm, S;Janmaat, M;Koopman, L;van den Brink, E;Rademaker, R;Verzijl, D;Engelberts, P;Satijn, D;Sasser, A;Breij, E;Mechanistic and pharmacodynamic studies of DuoBody-CD3x5T4 in preclinical tumor modelsLife Science AllianceDissociated tumor cells (DTCs) were procured from commercial vendors (Prisma Health/KIYATEC Biorepository or Discovery Life Sciences) who maintain strict ethical compliance, including fullyFull Paper
2022Rüschoff, J;Friedrich, M;Nagelmeier, I;Kirchner, M;Andresen, LM;Salomon, K;Portier, B;Sredni, ST;Schildhaus, HU;Jasani, B;Grzelinski, M;Viale, G;Comparison of HercepTest™ mAb pharmDx (Dako Omnis, GE001) with Ventana PATHWAY anti-HER-2/neu (4B5) in breast cancer: correlation with HER2 amplification and HER2 low statusVirchows Archiv : an international journal of pathology35970977in HER2 evaluation, having served over the past 20 years as readers in most of the trastuzumab, pertuzumab, and T-DM1 approval BC studies by Targos GmbH (Kassel, Save;Targos - A Discovery Life Sciences Company, Germaniastraße 7, 34119, Kassel, GermFull Paper
2022Suwa, R;Kume, Y;Kawase, M;Chishiki, M;Ono, T;Norito, S;Sato, K;Okamoto, M;Kumaki, S;Nagai, Y;Hosoya, M;Takeda, M;Nishimura, H;Hashimoto, K;Shirato, K;Practical Validation of United States Centers for Disease Control and Prevention Assays for the Detection of Human Respiratory Syncytial Virus in Pediatric Inpatients in JapanPathogens (Basel, Switzerland)35889999To confirm amplification specificity, we used pharyngeal, nasopharyngeal, and nasal swabs from Discovery Life Sciences (Los Osos, CA, USA) that were obtained for the Save CachedFull Paper
2022Rodrigues, D;van Kampen, R;van Bodegraven, AA;Kleinjans, JCS;Jennen, DGJ;de Kok, TM;Gene expression responses reflecting 5-FU-induced toxicity: Comparison between patient colon tissue and 3D human colon organoidsToxicology letters36183961All patients provided written informed consent. Human colon tissue samples were obtained by Boehringer Ingelheim Pharmaceuticals Inc. (Ridgefield, Connecticut, USA) from Discovery Life Sciences (Huntsville, Alabama, USA; formerly, Conversant BiologicFull Paper
2022Cao, L;Ledeboer, A;Pan, Y;Lu, Y;Meyer, K;Clinical enrollment assay to detect preexisting neutralizing antibodies to AAV6 with demonstrated transgene expression in gene therapy trialsGene therapy35778500Individual human serum samples were purchased from BioIVT (Westbury, NY, USA), Discovery Life Sciences (Los Osos, CA, USA), and Golden West Biologicals (Temecula, CA, USA)Full Paper
2022Zhang, L;Wang, Y;Homan, KT;Gaudette, SM;McCluskey, AJ;Chan, Y;Murphy, J;Abdalla, M;Nelson, CM;Sun, VZ;Erickson, JE;Knight, HL;Clabbers, A;Sterman, AJS;Mitra, S;Imaging the Alternatively Spliced D Domain of Tenascin C in a Preclinical Model of Inflammatory Bowel DiseaseMolecular imaging and biology35906512Clinical IBD colon was evaluated using a biotinylated anti-TNC D antibody. Frozen human tissue was obtained from CHTN (National Cancer Institute, Bethesda, MD), Folio Biosciences (Columbus, OH), and UMASS Memorial Gastroenterology (Worcester, MA)Full Paper
2022Holmberg, JA;Henry, SM;Burnouf, T;Devine, D;Marschner, S;Boothby, TC;Burger, SR;Chou, ST;Custer, B;Blumberg, N;Siegel, DL;Spitalnik, SL;National Blood Foundation 2021 Research and Development summit: Discovery, innovation, and challenges in advancing blood and biotherapiesTransfusion36169155consulting firm, and one of our clients is Discovery Life Sciences, an, apheresis services provider. My advice to DLS is the same as what I say in this manuscript. HemaCare SaveFull Paper
2022Edmonds, NL;Flores, SE;Mahmutovic, A;Young, SJ;Mauldin, IS;Slingluff, CL;CD103 and periplakin are potential biomarkers for response of metastatic melanoma to pembrolizumabMelanoma research36169985QualTek provided a modified proportion score indicating the percent of PD-L1 Qualtek also reported an overall estimate of the presence/absence of tumor-infiltrating SaveFull Paper
2022Kandi, S;Savaryn, JP;Ji, QC;Jenkins, GJ;Use of In-Sample Calibration Curve approach for quantification of peptides with high resolution Mass SpectrometryRapid communications in mass spectrometry : RCM35940586Human Peripheral Blood Mononuclear Cells (hPBMCs) were purchased from Discovery Life Sciences (Newtown, PA, USA)Full Paper
2022Boillat, MA;Hauser, PC;CO2-measuring dongleHardwareX3587373411 2.11 Mouser.com semiconductor U4 Sensirion SCD41-D-R1 1 45.66 45.66 Mouser.com CO2-sensor J1 GCT USB3505-30-A-KIT 1 2.35 2.35 Mouser.com Micro B USB 2.0 socket Qualtek 3025033-1 1 2.97 2.97 Mouser.comFull Paper
2022Schöniger, S;Rüschoff, J;Mismatch Repair Deficiency and Microsatellite InstabilityEncyclopediaTargos—A Discovery Life Sciences Company, Germaniastrasse 7, 34119 Kassel, GermanyFull Paper
2022Li, W;Li, Y;Xu, J;Chen, C;Gu, Y;Lu, Z;Li, D;Li, J;Sorg, A;Roberts, C;Mahajan, S;Gallant, M;Taggart, D;Multimodal Epigenetic Sequencing Analysis (MESA) of Cell-free DNA for Non-invasive Cancer DetectionResearch SquareCohort 1 subjects were recruited at clinical sites within the United States through the ELITE Study (NCT05181826) or were obtained through the following contract research organizations: BioIVT (Westbury, NY), BioOptions (Brea, CA), Discovery Life SciFull Paper
2022Koerner, L;Yang, T;Schmiel, M;Peifer, M;Buettner, R;Pasparakis, M;NEMO- and RelA-dependent NF-?B Signaling Promotes Small Cell Lung CancerbioRxivSmall cell lung cancer (SCLC) is an aggressive type of lung cancer driven by combined loss of the tumor suppressors RB1 and TP53. SCLC is highly metastatic and Save CachedFull Paper
2022Hebda-Bauer, E;Hagenauer, M;Blandino, P;Meng, F;Chitre, A;Ozel, A;Arakawa, K;Flagel, S;Watson, S;Palmer, A;Li, J;Akil, H;Transcriptional Profiling of the Hippocampus in an F2 Cross of a Genetic Rat Model of Internalizing vs. Externalizing Behavior and Addiction LiabilitybioRxivHudsonAlpha Discovery provided a variety of metrics for evaluating sample RNA quality, including RNA concentration (RNAconc), RNA integrity number (RIN), the Save CachedFull Paper
2022Chitre, A;Hebda-Bauer, E;Blandino, P;Bimschleger, H;Nguyen, K;Maras, P;Li, F;Ozel, A;Polysskaya, O;Cheng, R;Flagel, S;Watson, S;Li, J;Akil, H;Palmer, A;Genome-Wide Association Study in a Rat Model of Temperament Identifies Multiple Loci for Exploratory Locomotion and Anxiety-Like TraitsbioRxivFor these 20 rats, liver tissue was sent to HudsonAlpha Discovery (Discovery Life Sciences) for HMW genomic DNA extraction and long-range and deep sequencing. SaveFull Paper
2022Dejanovic, B;Wu, T;Tsai, M;Graykowski, D;Gandham, V;Rose, C;Bakalarski, C;Ngu, H;Wang, Y;Pandey, S;Rezzonico, M;Friedman, B;Edmonds, R;De Mazière, A;Rakosi-Schmidt, R;Singh, T;Klumperman, J;Foreman, O;Chang, M;Xie, L;Sheng, M;Hanson, J;Complement C1q-dependent excitatory and inhibitory synapse elimination by astrocytes and microglia in Alzheimer’s disease mouse modelsNature AgingCSF from patients with AD and healthy controls was obtained from Folio Biosciences and Precision Medicine with ethics committee approval and written informed consentFull Paper
2022Cady, J;Greytak, E;Whole-genome sequencing of degraded DNA for investigative genetic genealogyForensic Science International: Genetics Supplement SeriesSamples were submitted to either HudsonAlpha Discovery or Arbor Biosciences for library preparation and sequencing. For each sample, a small amount of the prepared SaveFull Paper
2022Newman, L;Useckaite, Z;Rowland, A;Addressing MISEV guidance using targeted LC?MS/MS: A method for the detection and quantification of extracellular vesicle?enriched and contaminant protein markers from bloodJournal of Extracellular BiologySerum and plasma samples from patients with non-alcoholic fatty liver disease (NAFLD) were purchased from Discovery Life Sciences (Hunstville, AL, USA). SaveFull Paper
2022D'ANTONIO, L;Esposizione a paracetamolo e acido sulfosalicilico: effetti biologici nel bivalve Mytilus spp.ThesisFrancisca Piedade, Sofia Bio, Bruno Nunes. 2020 Effects of common pharmaceutical drugsFull Paper
2022Wagner, RS;Environmental Factors Affecting Rhizophydiales Sp. Infecting Planktothrix Spp.Thesiswere then sent to HudsonAlpha Discovery Life Sciences (Hudson, AL USA) for sequencing. Sequencing and QC was done at HudsonAlpha Discovery Life Sciences using Save;- then sent to HudsonAlpha Discovery Life Sciences (Hudson, AL USA) for sequencinFull Paper
2022Ferreira Garcia Rodrigues, D;Gut feelingsmaastricht universityHuman healthy colon organoids were derived from a tissue biopsy collected from a healthy male donor (67 years old) and kindly provided by Boehringer Ingelheim Pharmaceuticals Inc. (Ridgefield, USA), who purchased tissue biopsies from Discovery Life SFull Paper
2022Fang, G;The use of perfusion MRI using ferumoxytol and small molecular weight gadolinium (Gd) agents to assess response to pembrolizumab in brain metastases and systemic lesions in NSCLC: A comparison of imaging modalities to address brain metastases, pseudoprogression and systemic lesion tumor flare (neuro-check pilot)ThesisTissue samples will be sent to QualTek Molecular Laboratories for PD-L1 biomarker Brain Tissue samples will also be sent to QualTek Molecular Laboratories for PD-1 SaveFull Paper
2022Isakoff, SJ;DF/HCC Protocol#: 17-328 TITLE: A Phase 1b Study of Safety and Immune Response to PVX-410 Vaccine Alone and in Combination with Pembrolizumabwebctportal.partners.orgPrimary tumor slides will be evaluated for expression of PD-L1 using the Merck Preferred Vendor QualTek according to their standard procedures. AFull Paper
2022Frankovi?, J;Koncerti hrvatskih autora za violon?elo i orkestarThesisMakedonskog teatra te je osniva? komornog ansambla za suvremenu glazbu „Sveta Sofia“. Bio je jedan od najplodnijih jugoslavenskih skladatelja srednje generacije te se okušao u svim stvarala?kim sferamaFull Paper
2022Yang, SYC;The Molecular Determinants of Response to Immune Checkpoint Therapy in Solid TumorsThesison 4-5?m sections mounted on positively charged ProbeOn slides (QualTek, Goleta, CA). QualTek provided a modified proportion score (MPS) indicating the proportion of SaveFull Paper
2022Shen, Y;Guo, K;Ma, A;Huang, Z;Du, J;Chen, J;Lin, Q;Wei, C;Wang, Z;Zhang, F;Zhang, J;Lin, W;Feng, N;Ma, W;Mitochondrial toxicity evaluation of traditional Chinese medicine injections with a dual in vitro approachFrontiers in pharmacology36408232and Health Sciences, Wuyi University, Jiangmen, China 3 Antibody Engineering Laboratory, School of Life Science & Technology, China Pharmaceutical University, Nanjing, China Edited by: Albert P. Li, In Vitro ADMET Laboratories, United States ReviewFull Paper
2022Tiu, C;Lopez, J;Lisavanbulin. Microtubule destabilizer (tubulin polymerization inhibitor), Tumor checkpoint controller, Treatment of advanced glioblastoma multiformeDrugs of the FutureAssessment of 108 clinical trial samples from NCT02490800, using a CE-marked immunohistochemistry Clinical Trial Assay (CTA; Targos Molecular Pathology GmbH, SaveFull Paper
2022Drapkin, R;Jung, E;Bradshaw, C;Demars, L;Mosher, R;EP014/#408?Evaluation of NAPI2B expression in a well annotated longitudinal tissue series of ovarian serous carcinomasE-PostersIHC analyses were performed by QualTek Molecular Laboratories (Discovery Life Sciences). Editorial support for this poster was provided by BluPrint Oncology. SaveFull Paper
2022Korner, LK;Cell death and inflammation in skin homeostasis and small cell lung cancerThesisR.B. is an employee of Targos Molecular Pathology. The other authors declare no competing interestsFull Paper
2022Weng, H;Huang, F;Yu, Z;Chen, Z;Prince, E;Kang, Y;Zhou, K;Li, W;Hu, J;Fu, C;Aziz, T;Li, H;Li, J;Yang, Y;Han, L;Zhang, S;Ma, Y;Sun, M;Wu, H;Zhang, Z;Wunderlich, M;Robinson, S;Braas, D;Hoeve, JT;Zhang, B;Marcucci, G;Mulloy, JC;Zhou, K;Tao, HF;Deng, X;Horne, D;Wei, M;Huang, H;Chen, J;The m6A reader IGF2BP2 regulates glutamine metabolism and represents a therapeutic target in acute myeloid leukemiaCancer cell36306790Bone marrow (BM) cells were collected from 5- to 7-week-old wild-type, Mettl14fl/flCreERT, or Igf2bp2fl/fl mice, and BM progenitor (HSPC, i.e., Lin- or c-kit+) cells were enriched with the Mouse Lineage Cell Depletion Kit or the CD117 microbeads (MilFull Paper
2022Wei, J;Montalvo-Ortiz, W;Yu, L;Krasco, A;Olson, K;Rizvi, S;Fiaschi, N;Coetzee, S;Wang, F;Ullman, E;Ahmed, HS;Herlihy, E;Lee, K;Havel, L;Potocky, T;Ebstein, S;Frleta, D;Khatri, A;Godin, S;Hamon, S;Brouwer-Visser, J;Gorenc, T;MacDonald, D;Hermann, A;Chaudhry, A;Sirulnik, A;Olson, W;Lin, J;Thurston, G;Lowy, I;Murphy, AJ;Smith, E;Jankovic, V;Sleeman, MA;Skokos, D;CD22-targeted CD28 bispecific antibody enhances antitumor efficacy of odronextamab in refractory diffuse large B cell lymphoma modelsScience translational medicine36350988For the NALM6-luc tumor experiments, 12-week-old female immunodeficient NSG mice (Jackson Laboratory, 005557) were engrafted with 4 × 10 6 human PBMCs (ReachBio), and SaveFull Paper
2022Devoucoux, M;Fort, V;Khelifi, G;Xu, J;Alerasool, N;Galloy, M;Wong, N;Bourriquen, G;Fradet-Turcotte, A;Taipale, M;Hope, K;Hussein, SMI;Côté, J;Oncogenic ZMYND11-MBTD1 fusion protein anchors the NuA4/TIP60 histone acetyltransferase complex to the coding region of active genesCell reports35705031Recombinant Mouse TPO PeproTech Cat# AF-315-14 Recombinant Mouse IL-3 R&D Systems Cat# 403-ML-050 Recombinant Mouse IL-6 R&D Systems Cat# 406-ML-025 ColonyGEL, Mouse Complete Medium ReachBio Cat# 1202 SFEM II Media STEMCELL Technologies Cat# 09655Full Paper
2022Peterson, CW;Venkataraman, R;Reddy, SS;Pande, D;Enstrom, MR;Radtke, S;Humbert, O;Kiem, HP;Intracellular RNase activity dampens zinc finger nuclease-mediated gene editing in hematopoietic stem and progenitor cellsMolecular therapy. Methods & clinical development34977270nces, San José, CA) into D-PBS, followed by total genomic DNA extraction and NGS. Colony-forming assays ZFN- or CRISPR/Cas9-treated NHP cells (1.2 × 103) were plated in 3.6 mL of ColonyGEL 1402 (ReachBio, Seattle, WA). For colony-forming assays utilFull Paper
2022Liu, L;Li, H;Patterson, AM;Plett, PA;Sampson, CH;Mohammad, KS;Capitano, ML;Singh, P;Yao, C;Orschell, CM;Pelus, LM;Upregulation of SIRT1 Contributes to dmPGE2-dependent Radioprotection of Hematopoietic Stem CellsStem cell reviews and reports35318613Colony forming cells were analyzed as described [20]. Total nucleated BM cells from non-irradiated mice were plated at 2 × 104 per dish in Mouse Complete Colony Gel media (Reach Bio, Seattle, WA). BM cells from irradiated C57BL/6 mice were plated atFull Paper
2022Canals Hernaez, D;Hughes, MR;Li, Y;Mainero Rocca, I;Dean, P;Brassard, J;Bell, EM;Samudio, I;Mes-Masson, AM;Narimatsu, Y;Clausen, H;Blixt, O;Roskelley, CD;McNagny, KM;Targeting a Tumor-Specific Epitope on Podocalyxin Increases Survival in Human Tumor Preclinical ModelsFrontiers in oncology35600398Linker stability was independently assessed by ReachBio Research Labs (RRL, www.reachbio.com) using an in vitro neutrophil differentiation killing assay, where extracellular Save;Emer Clarke at ReachBio Research Labs (www.reachbio.com) for providinFull Paper
2022Lefavor, R;Clarke, E;The Effect of Various Stimulants on Cytokine Secretion Profiles in Freshly Isolated Peripheral Blood Mononuclear Cells (PBMC)The Journal of Immunology1ReachBio Research Labs++1ReachBio Research LabsFull Paper
2022Gu, Q;Palani, CD;Smith, A;Li, B;Amos-Abanyie, EK;Ogu, U;Lu, L;Pace, BS;Starlard-Davenport, A;MicroRNA29B induces fetal hemoglobin via inhibition of the HBG repressor protein MYB in vitro and in humanized sickle cell miceFrontiers in medicine36507536kville, MD, USA) was used alone or co-transfected with MIR29B. Erythroid differentiation of human CD34+ stem cells and microRNA29B co-electroporation with MYB DNA Human bone marrow CD34+ stem cells (ReachBio, Seattle, WA, USA) were cultured in a modFull Paper
2022Balk, R;Esper, A;Martin, G;Miller, R;Lopansri, B;Burke, J;Levy, M;Opal, S;Rothman, R;D'Alessio, F;Sidhaye, V;Aggarwal, N;Greenberg, J;Yoder, M;Patel, G;Gilbert, E;Parada, J;Afshar, M;Kempker, J;van der Poll, T;Schultz, M;Scicluna, B;Klein Klouwenberg, P;Liebler, J;Blodget, E;Kumar, S;Navalkar, K;Yager, T;Sampson, D;Kirk, J;Cermelli, S;Davis, R;Brandon, R;Validation of SeptiCyte RAPID to discriminate sepsis from non-infectious systemic inflammationmedRxivThe authors thank the clinical study coordinators of the NEPTUNE study: Joyce D. Brown (Rush University), Liliacna Jara (University of Southern California), Leona Wells and Maya C. Whaley (Grady Memorial Hospital). The authors also thank the laboratoFull Paper
2022Vujovic, A;de Rooij, L;Chahi, A;Chen, H;Yee, B;Loganathan, S;Liu, L;Chan, D;Tajik, A;Tsao, E;Moreira, S;Joshi, P;Xu, J;Wong, N;Zandi, S;Aigner, S;Dick, J;Minden, M;Schramek, D;Yeo, G;Hope, K;A two-step in vivo CRISPR screen unveils pervasive RNA binding protein dependencies for leukemic stem cells and identifies ELAVL1 as a therapeutic targetbioRxivThawed primary AML samples were counted and plated in a methylcellulose-based hematopoietic colony formation medium (Colony Gel, ReachBio), supplemented with DMSO or 1.1uM DHTS. Colonies were scored on days 10-14. Human CB samples wereFull Paper
2022Keyvani Chahi, A;CHARACTERIZING THE ROLE OF THE TRANSCRIPTION FACTOR PLAG1 IN HUMAN HEMATOPOIETIC STEM AND PROGENITOR CELLSThesisRapamycin 50nM Cedarlane/MedChemExpr ess HY-10219 ColonyGEL™ 1102 1X Reachbio 1102 Sterile, Blunt-End Needles, 16 Gauge with Luer Lock NA StemCell Technologies 28110Full Paper
2022Stuart, WR;Inhibition of Embryonic Ectoderm Development as a Novel Mechanism for Fetal Hemoglobin Induction in Sickle Cell DiseaseThesisGating and analysis were performed on FlowJo. Single cells were gated using FSC H vs FSC A. CD235a vs CD71 double positive cells were used for HbF analysis through recommendation from ReachBio as these are the hemoglobin expressing cells within the pFull Paper
2021Schneider, BP;Jiang, G;Ballinger, TJ;Shen, F;Chitambar, C;Nanda, R;Falkson, C;Lynce, FC;Gallagher, C;Isaacs, C;Blaya, M;Paplomata, E;Walling, R;Daily, K;Mahtani, R;Thompson, MA;Graham, R;Cooper, ME;Pavlick, DC;Albacker, LA;Gregg, J;Solzak, JP;Chen, YH;Bales, CL;Cantor, E;Hancock, BA;Kassem, N;Helft, P;O'Neil, B;Storniolo, AMV;Badve, S;Miller, KD;Radovich, M;BRE12-158: A Postneoadjuvant, Randomized Phase II Trial of Personalized Therapy Versus Treatment of Physician's Choice for Patients With Residual Triple-Negative Breast CancerJournal of clinical oncology : official journal of the American Society of Clinical Oncology34910554Speakers' Bureau: Genomic Health, Targos Molecular Pathology, AgilentFull Paper
2021Vergote, I;González-Martín, A;Ray-Coquard, I;Harter, P;Colombo, N;Pujol, P;Lorusso, D;Mirza, MR;Brasiuniene, B;Madry, R;Brenton, JD;Ausems, MGEM;Büttner, R;Lambrechts, D;European experts’ consensus group, ;European experts consensus: BRCA/homologous recombination deficiency testing in first-line ovarian cancerAnnals of oncology : official journal of the European Society for Medical Oncology34861371Testifying Advisor for MSD in GBA-assessment for Pembrolizumab, Advisor for Durvalumab. Co-Founder and CSO for Targos Molecular Pathology, Kassel/Germany until April 2021. DL: Consulting (2019-2021): AstraZeneca (2019-2021); BMS (2019);Full Paper
2021Voors-Pette, C;Aalders, W;Brill, M;Ferrari, D;Annis, A;Steidl, U;Aivado, M;Vukovic, V;1791P A phase I pharmacology study of the dual MDMX/MDM2 inhibitor, ALRN 6924, in healthy volunteersAnnals of OncologyWe thank the subjects who participated in these studies; Discovery Life Sciences in Newtown, PA; and Eric Smith for graphical assistanceFull Paper
2021Han, GR;Jang, H;Ki, H;Lee, H;Kim, MG;Reagent Filming for Universal Point-of-Care DiagnosticsSmall methods34928024A/B were purchased from Discovery Life Sciences (Los Osos, CA). TFull Paper
2021de Klerk, LK;Patel, AK;Derks, S;Pectasides, E;Augustin, J;Uduman, M;Raman, N;Akarca, FG;McCleary, NJ;Cleary, JM;Rubinson, DA;Clark, JW;Fitzpatrick, B;Brais, LK;Cavanaugh, ME;Rode, AJ;Jean, MG;Lizotte, PH;Nazzaro, MJ;Severgnini, M;Zheng, H;Fuchs, CS;Enzinger, PC;Bass, AJ;Phase II study of pembrolizumab in refractory esophageal cancer with correlates of response and survivalJournal for immunotherapy of cancer34593617PD-L1 immunohistochemistry was performed on pretreatment FFPE tissue slides using a laboratory developed assay (QualTek Molecular Laboratories, Newtown, Pennsylvania, USA) with the anti-PD-L1 22C3 antibody (Merck & Co, Palo Alto, California, USA).Full Paper
2021Vowell, K;Conner, M;Perrin, F;Bojczuk, P;Hance, K;Roth, I;Donahue, C;Smothers, J;Waight, J;662 Dissecting the CD226 immune axis in the tumor microenvironment using CyTOF-based high-dimensional immunophenotypingJournal for ImmunoTherapy of CancerEthics Approval All samples were purchased from Discovery Life Sciences (DLS). DLS represents and warrants that it has ownership of all Products available for sale and has properly obtained, where required under HHS/OHRP 45 CFR 46.102 (d) (f), IRBFull Paper
2021Binnewies, M;Pollack, JL;Rudolph, J;Dash, S;Abushawish, M;Lee, T;Jahchan, NS;Canaday, P;Lu, E;Norng, M;Mankikar, S;Liu, VM;Du, X;Chen, A;Mehta, R;Palmer, R;Juric, V;Liang, L;Baker, KP;Reyno, L;Krummel, MF;Streuli, M;Sriram, V;Targeting TREM2 on tumor-associated macrophages enhances immunotherapyCell reports34686340Human tumor samples used for both flow cytometry and single-cell RNA sequencing were acquired from Discovery Life Sciences. 49 human tumor samples were used for flow cytometric analysis of immune composition and TREM2 surface levels. 10 human tumorFull Paper
2021Ma, J;Tan, X;Kwon, Y;Delgado, ER;Zarnegar, A;DeFrances, MC;Duncan, AW;Zarnegar, R;A Novel Humanized Model of NASH and Its Treatment With META4, A Potent Agonist of METCellular and molecular gastroenterology and hepatology34756982Background & Aims Nonalcoholic fatty liver disease is a frequent cause of hepatic dysfunction and is now a global epidemic. This ailment can progress to an advanced form called nonalcoholic steatohepatitis (NASH) and end-stage liver disease. CurrenFull Paper
2021Bassez, A;Vos, H;Van Dyck, L;Floris, G;Arijs, I;Desmedt, C;Boeckx, B;Vanden Bempt, M;Nevelsteen, I;Lambein, K;Punie, K;Neven, P;Garg, AD;Wildiers, H;Qian, J;Smeets, A;Lambrechts, D;A single-cell map of intratumoral changes during anti-PD1 treatment of patients with breast cancerNature medicine33958794combined with an intensity score, which represents the average intensity of positive tumor cells (0, none; 1, weak, 2, intermediate; 3, strong). PD-L1 (Merck 22C3 antibody) immunohistochemistry was performed by Qualtek Molecular Laboratories as per aFull Paper
2021Yuki, S;Nakamura, Y;Taniguchi, H;Denda, T;Nishina, T;Hamamoto, Y;Hara, H;Esaki, T;Kawakami, H;Takashima, A;Satoh, T;Sunakawa, Y;Masuishi, T;Shinozaki, E;Moriwaki, T;Miki, I;Shitara, K;Yoshino, T;Expression of PD-L1 and PD-L2 in colorectal cancer (CRC): A post-hoc integrated analysis of SCRUM-Japan GI-SCREEN CRC.Journal of Clinical OncologyPatients (Pts) with MSI-H or BRAF V600E mutant tumors were prioritized to be included. PD-L1 (22C3) and PD-L2 expressions were centrally assessed using immunohistochemical assays at QualTek and NeoGenomics, respectivelyFull Paper
2021Ho, CSL;Tüns, AI;Schildhaus, HU;Wiesweg, M;Grüner, BM;Hegedus, B;Schuler, M;Schramm, A;Oeck, S;HER2 mediates clinical resistance to the KRASG12C inhibitor sotorasib, which is overcome by co-targeting SHP2European journal of cancer (Oxford, England : 1990)34715459HUS is an employee of Targos Molecular Pathology, Inc.; received research grants (outside this study) from Novartis Oncology; and received honoraria and advisory board services from MSD, BMS, Roche Pharma, Novartis Oncology, ZytoVision, Eisai and PFull Paper
2021Israeli, S;Golden, A;Atalig, M;Mekki, N;Rais, A;Storey, H;Barbouche, MR;Peck, R;A Novel Point-of-Care Rapid Diagnostic Test for Screening Individuals for Antibody DeficienciesJournal of clinical immunology34839430These thirty-three specimens were acquired from Discovery Life Sciences (Los Osos, CA, USA) with IgG concentration characterized by Siemens BN II System nephelometer (Siemens Healthcare GmbH, Erlangen, Germany). IgG levels in the chosen samples SaFull Paper
2021Cheng, Y;Hall, TR;Xu, X;Yung, I;Souza, D;Zheng, J;Schiele, F;Hoffmann, M;Mbow, ML;Garnett, JP;Li, J;Targeting uPA-uPAR interaction to improve intestinal epithelial barrier integrity in inflammatory bowel diseaseEBioMedicine34933179anoids isolation and culture Isolation and culture of primary intestinal organoids was performed as previously described.2223 Briefly, human small intestinal tissues (obtained from Coversant Bio, now Discovery Life Sciences, https://www.dls.com/biospFull Paper
2021Cheng, L;Creasy, T;Pilataxi, F;Greenlees, L;Vence, L;Sridhar, S;Streicher, K;Effects of combination treatment with durvalumab plus tremelimumab on the tumor microenvironment in non-small-cell lung carcinomaCancer immunology, immunotherapy : CII34623465Frozen NSCLC tumor digests (untreated patients, three squamous cell carcinomas and one adenocarcinoma) were purchased from Discovery Life Sciences and cultured in 96-well plates in a medium containing low-dose interleukin 2 (IL-2) plus 20 µg/mL D aFull Paper
2021Bröske, AE;Korfi, K;Belousov, A;Wilson, S;Ooi, CH;Bolen, CR;Canamero, M;Alcaide, EG;James, I;Piccione, EC;Carlile, DJ;Dimier, N;Umaña, P;Bacac, M;Weisser, M;Dickinson, M;Pharmacodynamics and molecular correlates of response to glofitamab in relapsed/refractory non-Hodgkin lymphomaBlood advances34941996Biopsies were sent to the central pathology laboratory (Targos Molecular Pathology GmbH, Kassel, Germany) and fresh tissues were embedded on receipt. All biopsies were quality checked by a pathologist on hematoxylin and eosin (H&E) stainingFull Paper
2021Howard, FM;Villamar, D;He, G;Pearson, AT;Nanda, R;The emerging role of immune checkpoint inhibitors for the treatment of breast cancerExpert opinion on investigational drugs34569400PD-L1 status was initially assessed with the QualTek PD-L1 assay and subsequently with the Dako 22C3 PD-L1 assay (with With re-analysis of PD-L1 status, seven patients who had tested positive with the QualTek assay were negative by the 22C3 assayFull Paper
2021Manos, J;Preiss, C;Venkat, N;Tamm, J;Reinhardt, P;Kwon, T;Wu, J;Winter, A;Jahn, T;Yanamandra, K;Titterton, K;Karran, E;Langlois, X;UNCOVERING SPECIFICITY OF ENDOGENOUS TAU AGGREGATION IN A HUMAN IPSC-NEURON TAU SEEDING MODELiScience(Braak stage V/VI) and non-AD (Braak stage 0/I) male and female donors used in preparing sarkosyl-insoluble tau seeds were generously provided by the Massachusetts Alzheimer's Disease Research Center or purchased from Folio (now Discovery Life ScieFull Paper
2021Da Mesquita, S;Papadopoulos, Z;Dykstra, T;Brase, L;Farias, FG;Wall, M;Jiang, H;Kodira, CD;de Lima, KA;Herz, J;Louveau, A;Goldman, DH;Salvador, AF;Onengut-Gumuscu, S;Farber, E;Dabhi, N;Kennedy, T;Milam, MG;Baker, W;Smirnov, I;Rich, SS;Dominantly Inherited Alzheimer Network, ;Benitez, BA;Karch, CM;Perrin, RJ;Farlow, M;Chhatwal, JP;Holtzman, DM;Cruchaga, C;Harari, O;Kipnis, J;Meningeal lymphatics affect microglia responses and anti-Aβ immunotherapyNature33911285FC-404-2001) cartridges. Processing of total RNA extracted from mouse meningeal LECs (including linear RNA amplification and cDNA library generation) and RNA-seq was performed by HudsonAlpha Genomic Services Laboratory. For bulk RNA-seq experiments wFull Paper
2021Matusz-Fisher, A;Tan, AR;Combination of HER2-targeted agents with immune checkpoint inhibitors in the treatment of HER2-positive breast cancerExpert opinion on biological therapy34806498PD-L1-positivity was defined as staining in ≥ 1% of tumor cells or any staining in the stroma using the QualTek immunohistochemistry (IHC) assay. Of note, the assay was changed to the Dako IHC 22C3 pharmDx Q 2 Solutions assay mid-trial due to the pFull Paper
2021Luk, KC;Gersch, J;Harris, BJ;Holzmayer, V;Mbanya, D;Sauleda, S;Rodgers, MA;Cloherty, G;More DNA and RNA of HBV SP1 splice variants are detected in genotypes B and C at low viral replicationScientific reports34903774genotyping through the Abbott Global Surveillance Program38. All other plasma specimens sourced from France, Germany, Italy, Spain and Vietnam with known viral loads and genotypes were purchased from Discovery Life Sciences (Huntsville, AL). HBV DNAFull Paper
2021Connolly, P;Stapleton, S;Mosoyan, G;Fligelman, I;Tonar, YC;Fleming, F;Donovan, MJ;Analytical validation of a multi-biomarker algorithmic test for prediction of progressive kidney function decline in patients with early-stage kidney diseaseClinical proteomics34789168one specimens collected from patients receiving treatment with biologic therapeutic TNF-α inhibitors used to treat rheumatoid and psoriatic arthritis and other auto-immune diseases were sourced from Discovery Life Sciences (Huntsville, AL). SpecimensFull Paper
2021Jöhrens, K;Rüschoff, J;The Challenge to the Pathologist of PD-L1 Expression in Tumor Cells of Non-Small-Cell Lung Cancer-An OverviewCurrent oncology (Toronto, Ont.)34940076Institute of Pathology, Carl Gustav Carus University Hospital Dresden, 01307 Dresden, Germany.++Targos Molecular Pathology GmbH, 34119 Kassel, GermanyFull Paper
2021Hou, X;Wang, G;Fan, W;Chen, X;Mo, C;Wang, Y;Gong, W;Wen, X;Chen, H;He, D;Mo, L;Jiang, S;Ou, M;Guo, H;Liu, H;T-cell receptor repertoires as potential diagnostic markers for patients with COVID-19International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases34688948ad recovered from COVID-19. In the COVID-19-BWNW group, whole blood samples were collected at Bloodworks Northwest (Seattle, WA, USA). In the COVID-19-DLS group, whole blood samples were collected at Discovery Life Sciences (Huntsville, AL, USA). InFull Paper
2021Brosius, C;Caron, K;Sosnoff, C;Blount, B;Wang, L;Rapid Development and Validation of a Liquid Chromatography-Tandem Mass Spectrometry Method to Measure Cannabinoids in Bronchoalveolar-Lavage Fluid of Patients with e-Cigarette, or Vaping, Product Use-Associated Lung InjuryACS OmegaBAL pools were created using anonymous BAL samples acquired commercially from Discovery Life Sciences (Huntsville, AL). They were shipped frozen on dry ice and then stored in −70 C freezers until analyzed. Ten individual BAL fluids were screened foFull Paper
2021Sun, Q;Pastor, L;Du, J;Powell, MJ;Zhang, A;Bodmer, W;Wu, J;Zheng, S;Sha, MY;A novel xenonucleic acid-mediated molecular clamping technology for early colorectal cancer screeningPloS one34610014give an average DNA fragment length of about 150 bp, which mimics the size of cfDNA fragments, justifying their use as cfDNA references. Except for the 10 CRC whole blood samples were purchased from Discovery Life Sciences (Huntsville, AL, US), AllFull Paper
2021Pound, H;Gann, E;Wilhelm, S;A comparative study of metatranscriptomic assessment methods to characterize Microcystis bloomsLimnology and Oceanography: MethodsExtracted RNA was processed using a Illumina Stranded Total RNA Prep, Ligation with Ribo-Zero Plus and then 50-million 100-bp paired-end reads were generated on the Illumina NovaSeq platform at Hudson Alpha Discovery Life Sciences (Huntsville, SaFull Paper
2021Miao, LY;Kim, HJ;Whitlatch, K;Jaiswal, D;Navarro, A;Egan, R;Olivo, PD;A rapid homogenous bioassay for detection of thyroid-stimulating antibodies based on a luminescent cyclic AMP biosensorJournal of immunological methods34871593TSI-positive serum samples were a kind gift of Dr. George Kahaly. Anti-thyroid peroxidase (TPO) antibody-positive human serum samples and nonthyroidal autoimmune disease state human serum samples were obtained from Discovery Life Science (Los Osos, CFull Paper
2021Nuovo, G;Suster, D;Tili, E;Awad, H;Magro, C;A Standardization Protocol for the In Situ Detection of SARS-CoV2 RNA and ProteinsApplied Immunohistochemistry & Molecular Morphologyvid MD‡; Tili, Esmerina PhD§; Awad, Hamdy MD§; Magro, Cynthia MD∥ Author Information __ *Ohio State University Comprehensive Cancer Center §Ohio State University Medical Center, Columbus †Discovery Life Sciences, Powell, OH ‡Department of PatholoFull Paper
2021Nguyen, M;Gary, J;Sonoda, J;Low, M;Ring, C;Bishop, J;Feasibility of Lateral Flow Assays for Urinary Biomarkers to Nicotine Delivery ProductsOSF PREPRINTS2021A prospective collection of 212 individual urine specimens from users and non-nicotine users was completed between July 2020 and April 2021 by Discovery Life Sciences (Los Osos, CA). All enrollees selfidentified as non-users (112 samples) or singleFull Paper
2021Zhang, L;Pohl, C;Homan, K;Sun, V;Gaudette, S;Nelson, C;Erickson, J;Knight, H;Bose, S;Lynch, G;McRae, B;Sterman, A;Mitra, S;Imaging the Alternatively Spliced D Domain of Tenascin C in Preclinical Models of Inflammatory Bowel DiseaseResearch SquareClinical IBD and diseased cynomolgus macaque colon were evaluated using a biotinylated anti-TNC D antibody. Frozen human tissue was obtained from CHTN (National Cancer Institute, Bethesda, MD), Folio Biosciences (Columbus, OH), and UMASS Memorial GasFull Paper
2021Kehl, F;Cretu, V;Willis, P;Open-source lab hardware: Driver and temperature controller for high compliance voltage, fiber-coupled butterfly lasersHardwareXWe recommend applying 12 VDC at the voltage input (VIN), eg, by connecting a wall adapter with sufficient power such as the Qualtek QFWB-65-12-US01, which can provide up to 5 A at 12 VDC. The input voltage is directly fed into a voltage regulator (Full Paper
2021Lockhart, JW;Jacobs, AZ;Scientific Argument with Supervised LearningNeurIPS 2021 AI for Science WorkshopML for scientific discovery Life sciences often advance through creating and testing taxonomies or classifications of entities. Statistical methods to evaluate the theorized differences between groups offer the opportunity to validate such classifiFull Paper
2021Hair, J;Robinson, MJ;Wilkinson, RW;Dovedi, SJ;Deep phenotyping of surface stimulatory and inhibitory co-receptors on cancer-resident T and NK cells reveals cell subsets within the tumor-reactive CTL population that are uniquely defined by NKG2A expressionSLAS DiscoveryDisaggregated tumor cells (DTC; Discovery Life Sciences), which are a single-cell suspension of enzymatically-dissociated tumor tissue, from NSCLC (n=13), RC (n=10) and melanoma (n=10) patients were used. Detailed per-patient disease classificationFull Paper
2021Edmund, M;RISING STARSQuality ProgressQuality associate, lead auditor, Discovery Life Sciences (DLS), Powell, OHFull Paper
2021Valle, J;Kelley, R;Nervi, B;Oh, D;Zhu, A;Biliary tract cancerThe LancetIn KEYNOTE-028 PD-L1 positivity was defined as membranous PD-L1 expression in at least 1% of tumour and associated inflammatory cells, or positive staining in stroma (immunohistochemistry assay, QualTek, Goleta, CA, USA), and all patients were PD-L1Full Paper
2021Tiu, C;Derby, S;Haris, N;Welsh, L;Stansfeld, A;Hundsberger, T;Roth, P;König, F;Eisner, J;Kleinschmidt, M;Anderson, S;Bachmann, F;Lane, H;Engelhardt, M;Kaindl, T;Litherland, K;Stan, A;Evans, T;Plummer, E;Lopez, J;The potential utility of end-binding protein 1 (EB1) as response-predictive biomarker for lisavanbulin: A phase 2 study of lisavanbulin (BAL101553) in adult patients with recurrent glioblastoma.Journal of Clinical OncologyGallen, Switzerland; Department of Neurology, University Hospital Zurich, Zurich, Switzerland; Targos Molecular Pathology GmbH, Kassel, Germany; GeneCentric Therapeutics, Inc., Research Triangle Park, NC; Basilea Pharmaceutica International Ltd., BasFull Paper
2021Skowronska, M;Tiu, C;Tzankov, A;König, F;Lewis, J;Vivanco, I;Kleinschmidt, M;Beebe, K;Anderson, S;Bachmann, F;Engelhardt, M;Lane, H;Kaindl, T;Stan, A;Plummer, E;Evans, T;Zlobec, I;Lopez, J;Expression of end-binding protein 1 (EB1), a potential response-predictive biomarker for lisavanbulin, in glioblastoma and various other solid tumor types.Journal of Clinical Oncologyfor articles by this author. Show More Institute of Pathology, University of Bern, Bern, Switzerland; The Royal Marsden NHS Foundation Trust, Sutton, United Kingdom; Institute of Pathology, University Hospital Basel, Basel, Switzerland; Targos MolecuFull Paper
2021Pratto, F;Brick, K;Cheng, G;Lam, KG;Cloutier, JM;Dahiya, D;Wellard, SR;Jordan, PW;Camerini-Otero, RD;Meiotic recombination mirrors patterns of germline replication in mice and humansCell34260899Human testicular biopsy from cancer patient (Normal adjacent tissue) Folio Biosciences now Discovery Life Sciences biospecimen bank https://www.dls.comFull Paper
2021Scoazec, J;Bauchet, A;Adam, J;Rochaix, P;MacGrogan, G;Kim, J;Nuciforo, P;López-Rios, F;Frisman, D;Cesarone, G;Bernstein, S;Lee, J;Henry, C;Ozoux, M;Lefebvre, A;1313P Carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) tumor expression in a phase I/II study of tusamitamab ravtansine (SAR408701) in patients (pts) with advanced non-small cell lung cancer (NSCLC)Annals of Oncologyarticles by this author. D. Frisman D. Frisman. Affiliations Discovery Life Sciences, Goleta, CA, USA. Search for articles by this author. G. Cesarone G. Cesarone. Affiliations Discovery Life Sciences, Goleta, CA, USA. Search for articlesFull Paper
2021Salgado, R;Peg, V;Rüschoff, J;Vincent-Salomon, A;Castellano, I;Perner, S;Van de Vijver, K;Quinn, CM;Varga, Z;Gene expression signatures for tailoring adjuvant chemotherapy of luminal breast cancer: the pathologists' perspectiveAnnals of oncology : official journal of the European Society for Medical Oncology34461263Department of Pathology, GZA-ZNA Hospitals, Antwerp, Belgium; Division of Research, Peter MacCallum Cancer Centre, Melbourne, Australia. Electronic address: roberto@salgado.be.++Universidad Autónoma de Barcelona, Barcelona, Spain; Department of PathoFull Paper
2021Keenan, TE;Guerriero, JL;Barroso-Sousa, R;Li, T;O'Meara, T;Giobbie-Hurder, A;Tayob, N;Hu, J;Severgnini, M;Agudo, J;Vaz-Luis, I;Anderson, L;Attaya, V;Park, J;Conway, J;He, MX;Reardon, B;Shannon, E;Wulf, G;Spring, LM;Jeselsohn, R;Krop, I;Lin, NU;Partridge, A;Winer, EP;Mittendorf, EA;Liu, D;Van Allen, EM;Tolaney, SM;Molecular correlates of response to eribulin and pembrolizumab in hormone receptor-positive metastatic breast cancerNature communications34548479Tumors from 65/88 (74%) patients underwent PD-L1 testing assessed centrally by QualTek using the 22C3 antibodyFull Paper
2021Brägelmann, J;Lorenz, C;Borchmann, S;Nishii, K;Wegner, J;Meder, L;Ostendorp, J;Ast, DF;Heimsoeth, A;Nakasuka, T;Hirabae, A;Okawa, S;Dammert, MA;Plenker, D;Klein, S;Lohneis, P;Gu, J;Godfrey, LK;Forster, J;Trajkovic-Arsic, M;Zillinger, T;Haarmann, M;Quaas, A;Lennartz, S;Schmiel, M;D'Rozario, J;Thomas, ES;Li, H;Schmitt, CA;George, J;Thomas, RK;von Karstedt, S;Hartmann, G;Büttner, R;Ullrich, RT;Siveke, JT;Ohashi, K;Schlee, M;Sos, ML;MAPK-pathway inhibition mediates inflammatory reprogramming and sensitizes tumors to targeted activation of innate immunity sensor RIG-INature communications34535668M.L.S. is a founder and shareholder of PearlRiver Bio (now part of Centessa Pharmaceuticals) and received consulting honoraria from PearlRiver Bio. M.L.S. receives research funding from PearlRiver Bio and Novartis. R.B. is an employee of Targos MolecFull Paper
2021Ny, L;Jespersen, H;Karlsson, J;Alsén, S;Filges, S;All-Eriksson, C;Andersson, B;Carneiro, A;Helgadottir, H;Levin, M;Ljuslinder, I;Olofsson Bagge, R;Sah, VR;Stierner, U;Ståhlberg, A;Ullenhag, G;Nilsson, LM;Nilsson, JA;The PEMDAC phase 2 study of pembrolizumab and entinostat in patients with metastatic uveal melanomaNature communications34453044st was used to assess associations between immunohistochemical analyses (PD-L1 and TILs) and clinical benefit. Immunohistochemical analyses Tumor PD-L1 testing was performed at a central laboratory (QualTek Molecular Laboratories, Newtown, PennsylvaFull Paper
2021Cindy Yang, SY;Lien, SC;Wang, BX;Clouthier, DL;Hanna, Y;Cirlan, I;Zhu, K;Bruce, JP;El Ghamrasni, S;Iafolla, MAJ;Oliva, M;Hansen, AR;Spreafico, A;Bedard, PL;Lheureux, S;Razak, A;Speers, V;Berman, HK;Aleshin, A;Haibe-Kains, B;Brooks, DG;McGaha, TL;Butler, MO;Bratman, SV;Ohashi, PS;Siu, LL;Pugh, TJ;Pan-cancer analysis of longitudinal metastatic tumors reveals genomic alterations and immune landscape dynamics associated with pembrolizumab sensitivityNature communications34446728ary Fig. 9A. PD-L1 immunohistochemistry Immunohistochemical (IHC) staining for PD-L1 using the mouse monoclonal anti-PD-L1 antibody (clone 22C3 at 2 μg/mL, Merck, Palo Alto, CA) was performed by Qualtek Molecular Laboratories (Newtown, PA, USA). TheFull Paper
2021Fowler, TW;Mitchell, TL;Janda, CY;Xie, L;Tu, S;Chen, H;Zhang, H;Ye, J;Ouyang, B;Yuan, TZ;Lee, SJ;Newman, M;Tripuraneni, N;Rego, ES;Mutha, D;Dilip, A;Vuppalapaty, M;Baribault, H;Yeh, WC;Li, Y;Development of selective bispecific Wnt mimetics for bone loss and repairNature communications34059688The following method was used for human and mouse femur bone (Fig. 1d, e). Fresh human cadaveric femur tissue was purchased from vendor (Folio Conversant). Femur heads were shipped on wet ice within 24 h of death and tissue used immediately upon receFull Paper
2021Butler, D;Mozsary, C;Meydan, C;Foox, J;Rosiene, J;Shaiber, A;Danko, D;Afshinnekoo, E;MacKay, M;Sedlazeck, FJ;Ivanov, NA;Sierra, M;Pohle, D;Zietz, M;Gisladottir, U;Ramlall, V;Sholle, ET;Schenck, EJ;Westover, CD;Hassan, C;Ryon, K;Young, B;Bhattacharya, C;Ng, DL;Granados, AC;Santos, YA;Servellita, V;Federman, S;Ruggiero, P;Fungtammasan, A;Chin, CS;Pearson, NM;Langhorst, BW;Tanner, NA;Kim, Y;Reeves, JW;Hether, TD;Warren, SE;Bailey, M;Gawrys, J;Meleshko, D;Xu, D;Couto-Rodriguez, M;Nagy-Szakal, D;Barrows, J;Wells, H;O'Hara, NB;Rosenfeld, JA;Chen, Y;Steel, PAD;Shemesh, AJ;Xiang, J;Thierry-Mieg, J;Thierry-Mieg, D;Iftner, A;Bezdan, D;Sanchez, E;Campion, TR;Sipley, J;Cong, L;Craney, A;Velu, P;Melnick, AM;Shapira, S;Hajirasouliha, I;Borczuk, A;Iftner, T;Salvatore, M;Loda, M;Westblade, LF;Cushing, M;Wu, S;Levy, S;Chiu, C;Schwartz, RE;Tatonetti, N;Rennert, H;Imielinski, M;Mason, CE;Shotgun transcriptome, spatial omics, and isothermal profiling of SARS-CoV-2 infection reveals unique host responses, viral diversification, and drug interactionsNature communications33712587Department of Physiology and Biophysics, Weill Cornell Medicine, New York, NY, USA.++Department of Physiology and Biophysics, Weill Cornell Medicine, New York, NY, USA.++Department of Physiology and Biophysics, Weill Cornell Medicine, New York, NY, UFull Paper
2021Li, J;Conrad, C;Mills, TW;Berg, NK;Kim, B;Ruan, W;Lee, JW;Zhang, X;Yuan, X;Eltzschig, HK;PMN-derived netrin-1 attenuates cardiac ischemia-reperfusion injury via myeloid ADORA2B signalingThe Journal of experimental medicine33891683Materials and methods. MI patient and healthy donor samples. Serum/plasma samples of patients with MI or healthy donors were purchased from Discovery Life Sciences. Corresponding cTnI levels of patients with MI were documented in the patient sample dFull Paper
2021Dang, K;Castello, G;Clarke, SC;Li, Y;Balasubramani, A;Boudreau, A;Davison, L;Harris, KE;Pham, D;Sankaran, P;Ugamraj, HS;Deng, R;Kwek, S;Starzinski, A;Iyer, S;van Schooten, W;Schellenberger, U;Sun, W;Trinklein, ND;Buelow, R;Buelow, B;Fong, L;Dalvi, P;Attenuating CD3 affinity in a PSMAxCD3 bispecific antibody enables killing of prostate tumor cells with reduced cytokine releaseJournal for immunotherapy of cancer34088740Tumor cells were either isolated from fresh prostate tumor tissue procured from LF's lab at UCSF (San Francisco, California, USA) or received as frozen dissociated aliquots along with donor matched PBMCs from Discovery Life Sciences (Newtown, PennsylFull Paper
2021Nghiem, P;Bhatia, S;Lipson, EJ;Sharfman, WH;Kudchadkar, RR;Brohl, AS;Friedlander, PA;Daud, A;Kluger, HM;Reddy, SA;Boulmay, BC;Riker, A;Burgess, MA;Hanks, BA;Olencki, T;Kendra, K;Church, C;Akaike, T;Ramchurren, N;Shinohara, MM;Salim, B;Taube, JM;Jensen, E;Kalabis, M;Fling, SP;Homet Moreno, B;Sharon, E;Cheever, MA;Topalian, SL;Three-year survival, correlates and salvage therapies in patients receiving first-line pembrolizumab for advanced Merkel cell carcinomaJournal for immunotherapy of cancer33879601small T-antigen-specific serum antibodies21 or manifested large T-antigen expression in tumor biopsies via immunohistochemistry.22 PD-L1 staining (anti-PD-L1 clone 22C3, Merck & Co, Kenilworth, New Jersey, USA) was performed at QualTek MolecularFull Paper
2021Banchereau, R;Chitre, AS;Scherl, A;Wu, TD;Patil, NS;de Almeida, P;Kadel Iii, EE;Madireddi, S;Au-Yeung, A;Takahashi, C;Chen, YJ;Modrusan, Z;McBride, J;Nersesian, R;El-Gabry, EA;Robida, MD;Hung, JC;Kowanetz, M;Zou, W;McCleland, M;Caplazi, P;Eshgi, ST;Koeppen, H;Hegde, PS;Mellman, I;Mathews, WR;Powles, T;Mariathasan, S;Grogan, J;O'Gorman, WE;Intratumoral CD103+ CD8+ T cells predict response to PD-L1 blockadeJournal for immunotherapy of cancer33827905containing regimen. Fresh tumor samples and matched adjacent non-cancerous tissues were procured from a commercial vendor (Discovery Life Sciences) as part of adult patients undergoing surgical resection. Online supplemental ;h locally advancedFull Paper
2021Badve, SS;Penault-Llorca, F;Reis-Filho, JS;Deurloo, R;Siziopikou, KP;D'Arrigo, C;Viale, G;Determining PD-L1 Status in Patients with Triple-Negative Breast Cancer: Lessons Learned from IMpassion130Journal of the National Cancer Institute34286340CD has received consulting fees from Roche TD, Targos GmbH, Pfizer, Roche Pharma, LDPath Ltd, About Health Ltd, Uralensis INOV8 Ltd, and various NHS hospitals and has received nonfinan- cial support from UKNEQAS ICC&ISH and CADQAS cicFull Paper
2021Saura, C;Matito, J;Oliveira, M;Wildiers, H;Brufksy, AM;Waters, SH;Hurvitz, SA;Moy, B;Kim, SB;Gradishar, WJ;Queiroz, GS;Cronemberger, E;Wallweber, GJ;Bebchuk, J;Keyvanjah, K;Lalani, AS;Bryce, R;Vivancos, A;Eli, LD;Delaloge, S;Biomarker Analysis of the Phase III NALA Study of Neratinib + Capecitabine versus Lapatinib + Capecitabine in Patients with Previously Treated Metastatic Breast CancerClinical cancer research : an official journal of the American Association for Cancer Research34380637Yan (Puma Biotechnology). We thank Jeff Sperinde and Weidong Huang (Monogram Biosciences) for additional support for HERmark and p95 assay design and execution. We thank Sandra Bernard (Targos GMBH) for oversight of clinical sample management. WeFull Paper
2021Pedersen, KS;Foster, NR;Overman, MJ;Boland, PM;Kim, SS;Arrambide, KA;Jaszewski, BL;Bekaii-Saab, T;Graham, RP;Welch, J;Wilson, RH;McWilliams, RR;ZEBRA: A Multicenter Phase II Study of Pembrolizumab in Patients with Advanced Small-Bowel AdenocarcinomaClinical cancer research : an official journal of the American Association for Cancer Research33883178(clinicaltrials.gov). Biomarkers PD-L1 expression was centrally assessed (QualTek, Santa Barbara, CA) by immunohistochemical assays utilizing the Merck 22C3 antibody (Agilent/Dako). Samples required > 50 viable neoplastic cells. Modified Proportion SFull Paper
2021Larson, MH;Pan, W;Kim, HJ;Mauntz, RE;Stuart, SM;Pimentel, M;Zhou, Y;Knudsgaard, P;Demas, V;Aravanis, AM;Jamshidi, A;A comprehensive characterization of the cell-free transcriptome reveals tissue- and subtype-specific biomarkers for cancer detectionNature communications33883548We set out to validate the 23 cell-free mRNA biomarkers identified in our CCGA cohort in an orthogonal set of breast (n = 38) and lung (n = 18) cancer plasma samples obtained from a commercial vendor (Discovery Life Sciences) ;t to validate theFull Paper
2021Lorés-Motta, L;van Beek, AE;Willems, E;Zandstra, J;van Mierlo, G;Einhaus, A;Mary, JL;Stucki, C;Bakker, B;Hoyng, CB;Fauser, S;Clark, SJ;de Jonge, MI;Nogoceke, E;Koertvely, E;Jongerius, I;Kuijpers, TW;den Hollander, AI;Common haplotypes at the CFH locus and low-frequency variants in CFHR2 and CFHR5 associate with systemic FHR concentrations and age-related macular degenerationAmerican journal of human genetics34260947associated with AMD (locus-wide conditioning).15 All the association analyses were performed with the “glm” R function.40 Immunocytochemistry of human retinas Human donor eyes were obtained from Discovery Life Sciences. Eyes were collected within 12Full Paper
2021Egelston, C;Guo, W;Yost, S;Lee, JS;Rose, D;Avalos, C;Ye, J;Frankel, P;Schmolze, D;Waisman, J;Lee, P;Yuan, Y;Pre-existing effector T-cell levels and augmented myeloid cell composition denote response to CDK4/6 inhibitor palbociclib and pembrolizumab in hormone receptor-positive metastatic breast cancerJournal for immunotherapy of cancer33757987PD-L1 stain was performed using 22C3 antibody by Qualtek Molecular LaboratoryFull Paper
2021Campbell, JR;McDonald, BR;Mesko, PB;Siemers, NO;Singh, PB;Selby, M;Sproul, TW;Korman, AJ;Vlach, LM;Houser, J;Sambanthamoorthy, S;Lu, K;Hatcher, SV;Lohre, J;Jain, R;Lan, RY;Fc-optimized Anti-CCR8 Antibody Depletes Regulatory T Cells in Human Tumor ModelsCancer research33757978Study approval Human tumor, skin, spleen, patient blood, and healthy blood leukopack samples were collected through commercial providers (BioIVT, MT Group, Avaden, BioOptions, Discovery Life Sciences, AllCells) or the Cooperative Human Tissue NetworkFull Paper
2021Dieckmann, N;Schildhaus, HU;Bauer, S;Tropomyosin receptor kinases in sarcomas - of joy and despairCurrent opinion in oncology33989242Novartis, and Incyte; and received travel and accommodation funding from PharmaMar. H.U.S. is an employee of Targos Molecular pathology, Inc., received research funding from Novartis Oncology, has received honoria from MSD, BMS, Pfizer, Novartis OncoFull Paper
2021Yuan, Y;Lee, J;Yost, S;Frankel, P;Ruel, C;Egelston, C;Guo, W;Padam, S;Tang, A;Martinez, N;Schmolze, D;Presant, C;Ebrahimi, B;Yeon, C;Sedrak, M;Patel, N;Portnow, J;Lee, P;Mortimer, J;Phase I/II trial of palbociclib, pembrolizumab and letrozole in patients with hormone receptor-positive metastatic breast cancerEuropean Journal of Cancer2.4. Tumour immune biomarkers Percentage of stromal TILs in tumour was evaluated using haematoxylin and eosin diagnostic sections per International TIL Work Group guideline [23]. PD-L1 was determined by immunohistochemistry (IHC) using the PD-L1 IHCFull Paper
2021Liang, X;Wang, Y;Zhang, Y;Li, B;Radosevich, M;Bacteriophage-host depth distribution patterns in soil are maintained after nutrient stimulation in vitroThe Science of the total environment33991924The extracted DNA samples were quantified using PicoGreen Assay Kit (Invitrogen, Carlsbad, CA) and were then sent to the HudsonAlpha Genomic Services Laboratory (Huntsville, AL, USA) for preparation of 16S rRNA gene amplicon library and high-throughpFull Paper
2021Quaas, A;Pamuk, A;Klein, S;Quantius, J;Rehkaemper, J;Barutcu, AG;Rueschoff, J;Zander, T;Gebauer, F;Hillmer, A;Buettner, R;Schroeder, W;Bruns, CJ;Löser, H;Schoemig-Markiefka, B;Alakus, H;Sex-specific prognostic effect of CD66b-positive tumor-infiltrating neutrophils (TANs) in gastric and esophageal adenocarcinomaGastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association34009535Thomas Zander. Institute of Pathology, Nordhessen and Targos Molecular Pathology GmbH, Kassel, Germany. Josef Rueschoff. Authors: Alexander Quaas View author publications. You can also search for this author in PubMed Google ScholarFull Paper
2021Schoemig-Markiefka, B;Eschbach, J;Scheel, AH;Pamuk, A;Rueschoff, J;Zander, T;Buettner, R;Schroeder, W;Bruns, CJ;Loeser, H;Alakus, H;Quaas, A;Optimized PD-L1 scoring of gastric cancerGastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association33954872Thomas Zander. Institute of Pathology Nordhessen, Kassel, Germany. Josef Rueschoff. Targos Molecular Pathology GmbH, Kassel, Germany. Josef Rueschoff & Reinhard Buettner. Authors: Birgid Schoemig-Markiefka View author publicationsFull Paper
2021Onogi, S;Lee, SH;Fruehauf, KR;Shea, KJ;Abiotic Stimuli-Responsive Protein Affinity Reagent for IgGBiomacromolecules34009976Transferrin (80 kDa) from human plasma was obtained from Calbiochem. Human serum was procured from Discovery Life Sciences, Inc. F(ab′) 2 (110 kDa) and Fc (50 kDa) fragments from human IgG were sourced from Jackson ImmunoResearch Laboratories, IncFull Paper
2021Cao, XE;Kim, J;Mehta, S;Erickson, D;Two-Color Duplex Platform for Point-of-Care Differential Detection of Malaria and Typhoid FeverAnalytical chemistry34469115samples in serum. 2.4. Validation with Human Clinical Samples. The clinical validation was conducted to evaluate the performance of the duplex platform with 25 human samples (Discovery Life Sciences). These included eightFull Paper
2021Narla, RK;Modi, H;Bauer, D;Abbasian, M;Leisten, J;Piccotti, JR;Kopytek, S;Eckelman, BP;Deveraux, Q;Timmer, J;Zhu, D;Wong, L;Escoubet, L;Raymon, HK;Hariharan, K;Modulation of CD47-SIRPα innate immune checkpoint axis with Fc-function detuned anti-CD47 therapeutic antibodyCancer immunology, immunotherapy : CII34247273lenalidomide [30]. Cell samples from AML patients were obtained from Conversant Bio (Huntsville) and are described in Supplemental Table 1. CC-90002 binding on cells and blockade of SIRPα to CD47 positive cells. Evaluation ofFull Paper
2021Vos, H;Lambein, K;Richard, F;Mariën, B;Nevelsteen, I;Punie, K;Wildiers, H;Berben, L;Laenen, A;Floris, G;Desmedt, C;Smeets, A;Comparison of the tumor immune microenvironment of primary hormone receptor-negative HER2-positive and triple negative breast cancerNPJ breast cancer34556657PD-L1 (22C3 antibody, 2 μg/mL, Dako-Agilent) immunohistochemistry was performed by Qualtek Molecular Laboratories (Newtown PA, USA) as per agreement with Merck. QualTek provided a modified proportion score (MPSFull Paper
2021Pierson, SK;Shenoy, S;Oromendia, AB;Gorzewski, AM;Langan Pai, RA;Nabel, CS;Ruth, JR;Parente, SAT;Arenas, DJ;Guilfoyle, M;Reddy, M;Weinblatt, M;Shadick, N;Bower, M;Pria, AD;Masaki, Y;Katz, L;Mezey, J;Beineke, P;Lee, D;Tendler, C;Kambayashi, T;Fosså, A;van Rhee, F;Fajgenbaum, DC;Discovery and validation of a novel subgroup and therapeutic target in idiopathic multicentric Castleman diseaseBlood advances34438448this study. We wish to thank Daniel Martinez and the other members of the CHOP Pathology Core as well as Qualtek for their immunohistochemical analyses. We wish to thank Kevin Silk, Giovanni Insana, and James A. Lebovitz for their contributions to thFull Paper
2021Wang, A;Song, Z;Zheng, G;Nicolazzi, C;Fromm, JR;Shehu, E;Srinivasan, S;Chen, X;Zhu, C;Blondel, MC;Adrian, FJ;Evaluation of Preclinical Activity of Isatuximab in Patients with Acute Lymphoblastic LeukemiaMolecular cancer therapeutics34376579centrifugation in line with the manufacturer's instructions. Patient ALL PBMCs were obtained from Conversant Biologics, Inc. Antibodies and reagents Isatuximab was generated in-house. Human immunoglobulin (Ig) G1, IgG4, ATRAFull Paper
2021Reardon, DA;Kim, TM;Frenel, JS;Simonelli, M;Lopez, J;Subramaniam, DS;Siu, LL;Wang, H;Krishnan, S;Stein, K;Massard, C;Treatment with pembrolizumab in programmed death ligand 1-positive recurrent glioblastoma: Results from the multicohort phase 1 KEYNOTE-028 trialCancer33496357QualTek Molecular Laboratories evaluated archived or newly obtained formalin-fixed, paraffin-embedded tumor samples using the 22C3 PD-L1 antibody clone (Merck & Co., Inc., Kenilworth, NJ, USA) and a laboratory- developed prototype immunohistochemicalFull Paper
2021Preillon, J;Cuende, J;Rabolli, V;Garnero, L;Mercier, M;Wald, N;Pappalardo, A;Denies, S;Jamart, D;Michaux, AC;Pirson, R;Pitard, V;Bagot, M;Prasad, S;Houthuys, E;Brouwer, M;Marillier, R;Lambolez, F;Marchante, JR;Nyawouame, F;Carter, MJ;Baron-Bodo, V;Marie-Cardine, A;Cragg, M;Déchanet-Merville, J;Driessens, G;Hoofd, C;Restoration of T-cell Effector Function, Depletion of Tregs, and Direct Killing of Tumor Cells: The Multiple Mechanisms of Action of a-TIGIT Antagonist AntibodiesMolecular cancer therapeutics33277440Cryopreserved isolated PBMCs from healthy volunteers and patients with cancer were provided by ImmunXperts and ConversantBio, respectively. PBMCs were thawed, resuspended in RPMI medium supplemented with 10% FBS + 50 U/mL penicillin/streptomycin (WesFull Paper
2021MacFarlane, AW;Yeung, HM;Alpaugh, RK;Dulaimi, E;Engstrom, PF;Dasari, A;Campbell, KS;Vijayvergia, N;Impacts of pembrolizumab therapy on immune phenotype in patients with high-grade neuroendocrine neoplasmsCancer immunology, immunotherapy : CII33398390PD-L1 immunohistochemistry (IHC) assay was performed at Qualtek Research Laboratories on formalin-fixed, paraffin-embedded tissue sections using anti-PD-L1 monoclonal antibody clone 22C3 (Merck Research Laboratories)Full Paper
2021Holder, C;Adams, A;Allison, C;Cote, O;Lippens, R;Blount, BC;Wang, L;A Novel UHPLC-MS/MS Method for Measuring 8-iso-Prostaglandin F2α in Bronchoalveolar Lavage FluidFrontiers in chemistry34476231Non-EVALI BAL fluids used in this study were acquired from Discovery Life Sciences (Huntsville, AL, United States)Full Paper
2021Rodrigues, D;de Souza, T;Coyle, L;Di Piazza, M;Herpers, B;Ferreira, S;Zhang, M;Vappiani, J;Sévin, DC;Gabor, A;Lynch, A;Chung, SW;Saez-Rodriguez, J;Jennen, DGJ;Kleinjans, JCS;de Kok, TM;New insights into the mechanisms underlying 5-fluorouracil-induced intestinal toxicity based on transcriptomic and metabolomic responses in human intestinal organoidsArchives of toxicology341514005-Fluorouracil (5-FU) is a widely used chemotherapeutical that induces acute toxicity in the small and large intestine of patients. Symptoms can be severe. ;- 5-Fluorouracil (5-FU) is a widely used chemotherapeutical that induces acute toxicity inFull Paper
2021Comunale, BA;Engineer, L;Jiang, Y;Andrews, JC;Liu, Q;Ji, L;Yurkovich, JT;Comunale, RA;Xie, Q;Poliovirus Vaccination Induces a Humoral Immune Response That Cross Reacts With SARS-CoV-2Frontiers in medicine34414206ccination protocols, set by the Centers for Disease Control and Prevention (CDC). IRB approval for the collection of adult sera was obtained from BioMed IRB, and pediatric samples were purchased from Discovery Life Sciences (Huntsville, AL) in accordFull Paper
2021Haynes, WA;Kamath, K;Waitz, R;Daugherty, PS;Shon, JC;Protein-Based Immunome Wide Association Studies (PIWAS) for the Discovery of Significant Disease-Associated AntigensFrontiers in immunology33986742years, with a range of 22-72. Anti-Smith Cohort Samples from 34 subjects that tested positive for Anti-SM RNP (4) or Anti-Smith (30) antibodies by predicate ANA multiplex testing were obtained from Discovery Life Sciences. Subjects ranged in age froFull Paper
2021Kerr, KM;Bibeau, F;Thunnissen, E;Botling, J;Ryška, A;Wolf, J;Öhrling, K;Burdon, P;Malapelle, U;Büttner, R;The evolving landscape of biomarker testing for non-small cell lung cancer in EuropeLung cancer (Amsterdam, Netherlands)33690091He is a co-owner and CSO of Targos Molecular Pathology, Inc., GermanyFull Paper
2021Gentzel, RC;Toolan, D;Jinn, S;Schachter, JB;Ma, L;Kahle, PJ;Smith, SM;Marcus, JN;Intracranial administration of alpha-synuclein fibrils in A30P-synuclein transgenic mice causes robust synucleinopathy and microglial inductionNeurobiology of aging34225000comparison. Neuropathologically confirmed human post-mortem PD brain tissue, acquired from Folio/Discovery Life Sciences (California, USA), or A30P HET brain tissues were serially extracted to obtain a sarkosyl insoluble fractionFull Paper
2021Malik-Chaudhry, HK;Prabhakar, K;Ugamraj, HS;Boudreau, AA;Buelow, B;Dang, K;Davison, LM;Harris, KE;Jorgensen, B;Ogana, H;Pham, D;Schellenberger, U;Van Schooten, W;Buelow, R;Iyer, S;Trinklein, ND;Rangaswamy, US;TNB-486 induces potent tumor cell cytotoxicity coupled with low cytokine release in preclinical models of B-NHLmAbs33818299ground value. The percent of specific lysis was calculated as described above. Ex vivo cytotoxicity assay The ability of TNB-486 to kill CD19+ tumor cells from CLL or DLBCL patient-derived samples (Discovery Life Sciences and IQ Biosciences) was detFull Paper
2021Yamada, M;Eguchi, A;Okuno, K;Sakaguchi, K;Yamaguchi, T;Development of a highly sensitive chemiluminescent enzyme immunoassay for fragmented cytokeratin 18 using new antibodiesScientific reports34521905All methods were carried out in accordance with relevant guidelines and regulations. Human samples. Serum from healthy individuals and NASH patients was purchased from Discovery Life Sciences (CA, USA) with approval and informed consent;defined belowFull Paper
2021Awad, H;Tili, E;Nuovo, G;Kelani, H;Ramadan, ME;Williams, J;Binzel, K;Rajan, J;Mast, D;Efanov, AA;Rasul, KB;Moore, S;Basso, M;Mikhail, A;Eltobgy, M;Malbrue, RA;Bourekas, E;Oglesbee, M;Bergdall, V;Knopp, M;Michaille, JJ;El-Sayed, H;Endovascular repair and open repair surgery of thoraco-abdominal aortic aneurysms cause drastically different types of spinal cord injuryScientific reports33837260The remainder of the tissue was stored at − 80 °C for metabolome analyses. All sections were subsequently analyzed blindly. Immunohistochemistry (IHC). All sections were dealt with blindly using an automated Leica Bond Max platform at Phylogeny Inc.Full Paper
2021Mezache, L;Nuovo, G;Veeraraghavan, R;A Multipronged Microscopy Approach Identifies Common Anti-Arrhythmic Strategy for Atrial Fibrillation and Myocardial InfarctionMicroscopy and Microanalysis1 The Ohio State University, United States, 2 Discovery Life Sciences, United States Vascular leak and inflammation are associated with arrhythmic heart diseases such as atrial fibrillation (AF) and myocardial infarction (MI)Full Paper
2021Ermann, J;Matmusaev, M;Haley, E;Braun, C;Jost, F;Mayer-Wrangowski, S;Hsiao, P;Ting, N;Li, L;Terenzio, D;Chime, J;Lukas, S;Patnaude, L;Panzenbeck, M;Csordas, D;Zheng, J;Mierz, D;Simpson, T;King, FJ;Klimowicz, A;Mbow, ML;Fine, JS;Miller, C;Fogal, S;Byrne, FR;The potent and selective RIPK2 inhibitor BI 706039 improves intestinal inflammation in the TRUC mouse model of Inflammatory Bowel DiseaseAmerican journal of physiology. Gastrointestinal and liver physiology34494462Human IBD Intestinal biopsy Immuno-histo-chemical analysis 231 Tissue blocks from surgical resections for ulcerative colitis (n=6) and Crohn's Disease (n=5) were 232 acquired from Discovery Life Sciences. 4 µm sections were fluorescently stained usinFull Paper
2021Reisenauer, KN;Tao, Y;Das, P;Song, S;Svatek, H;Patel, SD;Mikhail, S;Ingros, A;Sheesley, P;Masi, M;Boari, A;Evidente, A;Kornienko, A;Romo, D;Taube, J;Epithelial-mesenchymal transition sensitizes breast cancer cells to cell death via the fungus-derived sesterterpenoid ophiobolin AScientific reports34017048ke to acknowledge Dr. Michelle Nemec, Director of the Molecular Bioscience Center (Baylor University) for assistance with flow cytometry and Dr. Maria Boccia (Baylor University) and Dr. Gerard Nuovo (Discovery Life Sciences, Powell, OH, USA) for assiFull Paper
2021Caldwell, C;Rottman, JB;Paces, W;Bueche, E;Reitsma, S;Gibb, J;Adisetiyo, V;Haas, MS;Heath, H;Newman, W;Baum, J;Gianani, R;Kagey, MH;Validation of a DKK1 RNAscope chromogenic in situ hybridization assay for gastric and gastroesophageal junction adenocarcinoma tumorsScientific reports33972574chromogen kit (Biocare Medical). RNAscope. G/GEJ FFPE tumor resections were commercially acquired from Avaden Biosciences, Discovery Life Sciences or BioOptions following IRB compliance. RNAscope was performed ;emperature for 30 min, washed, andFull Paper
2021Wong, RL;Yu, EY;Refining Immuno-Oncology Approaches in Metastatic Prostate Cancer: Transcending Current LimitationsCurrent treatment options in oncology33433743028 phase 1b trial of pembrolizumab in PD-L1-positive advanced solid tumors included 23 patients with CRPC and PD-L1 expression ≥ 1% in tumor or stroma cells by a laboratory-developed prototype immunohistochemistry (IHC) assay (QualTek MolecularFull Paper
2021Meyer, L;Delgado-Cunningham, K;Lorig-Roach, N;Ford, J;DuBois, RM;Human Astrovirus 1-8 Seroprevalence Evaluation in a United States Adult PopulationViruses340704192.7. Human Plasma Samples. Human plasma samples were obtained from Discovery Life Sciences Supplementary Materials. The following are available online at https://www.mdpi. com/article/10.3390/v13060979/s1, Table S1: Plasma Samples from Discovery LiFull Paper
2021Lopez-Anido, RN;Harrington, AM;Hamlin, HJ;Coping with stress in a warming Gulf: the postlarval American lobster's cellular stress response under future warming scenariosCell stress & chaperones34115338The RNA samples from five replicate animals reared at each temperature were shipped to HudsonAlpha Discovery (formerly the Genomic Services Lab) at the HudsonAlpha Institute for Biotechnology (Huntsville, AL, USA) for library preparation and sequenciFull Paper
2021Magro, C;Crowson, A;Franks, L;Schaffer, P;Whelan, P;Nuovo, G;The histologic and molecular correlates of COVID-19 vaccine-induced changes in the skinClinics in Dermatologyonald O. Perelman Department of Dermatology, New York University Grossman School of Medicine, New York, New York eDepartment of Pediatrics, Geffen School of Medicine at UCLA, Los Angeles, California fDiscovery Life Sciences, Powell, Ohio gThe Ohio StFull Paper
2021Magro, C;Nuovo, G;Mulvey, J;Laurence, J;Harp, J;Crowson, A;The skin as a critical window in unveiling the pathophysiologic principles of COVID-19Clinics in DermatologyJoanna MD e Crowson A. Neil MD f aDepartment of Pathology and Laboratory Medicine, Weill Cornell Medicine, New York, New York bThe Ohio State University Comprehensive Cancer Center, Columbus Ohio and Discovery Life Sciences, Powell, Ohio cDepartmentFull Paper
2021Xia, B;Blount, BC;Wang, L;Sensitive Quantification of Nicotine in Bronchoalveolar Lavage Fluid by Acetone Precipitation Combined With Isotope-Dilution Liquid Chromatography-Tandem Mass SpectrometryACS omega34124421We directly injected 1 μL of the residual supernatant onto the LC-MS/MS. BAL fluid pools were created for method validation experiments of the method from 12 anonymous BAL fluids purchased commercially from Discovery Life Sciences (Huntsville, AL)Full Paper
2021Cirillo, PDR;Margiotti, K;Fabiani, M;Barros-Filho, MC;Sparacino, D;Cima, A;Longo, SA;Cupellaro, M;Mesoraca, A;Giorlandino, C;Multi-analytical test based on serum miRNAs and proteins quantification for ovarian cancer early detectionPloS one34352040All serum samples from ovarian cancer patients were obtained through MTA (Material Transfer Agreement) signed consent form from the following centers: Discovery Life Sciences (Huntsville, USA), BioIVT (London, UK), Victorian Cancer Bank (Melbourne, AFull Paper
2021Walsh, CS;Kamrava, M;Rogatko, A;Kim, S;Li, A;Cass, I;Karlan, B;Rimel, BJ;Phase II trial of cisplatin, gemcitabine and pembrolizumab for platinum-resistant ovarian cancerPloS one34081738that had membrane staining at low (1+) intensities or greater. An H-score was calculated ranging from 0–300, reflecting the percentage of cells staining at each of the following intensities: negative (1), low (1+), moderate (2+), high (3+). IHC assayFull Paper
2021Bernstein, DE;Trinh, HN;Schiff, ER;Smith, CI;Mospan, AR;Zink, RC;Fried, MW;Lok, AS;Safety and Effectiveness of Tenofovir Alafenamide in Usual Clinical Practice Confirms Results of Clinical Trials: TARGET-HBVDigestive diseases and sciences34059991ERS: Grant support: Eiger, Galmed, Zydus, Celgene, Beckman, Biokit, Bristol Myers Squibb, Conatus, Celgene, Discovery Life Sciences, Genfit, Gilead, Intercept, Novartis, Novo Nordisk, Orasure Technologies, Ortho Diagnostics, Pfizer, Prometheus Lab, RFull Paper
2021Varlet, P;Bouffet, E;Casanova, M;Giangaspero, F;Antonelli, M;Hargrave, D;Ladenstein, R;Pearson, A;Hawkins, C;König, FB;Rüschoff, J;Schmauch, C;Bühnemann, C;Garin-Chesa, P;Schweifer, N;Uttenreuther-Fischer, M;Gibson, N;Ittrich, C;Krämer, N;Solca, F;Stolze, B;Geoerger, B;Comprehensive analysis of the ErbB receptor family in pediatric nervous system tumors and rhabdomyosarcomaPediatric blood & cancer34546642Institute, Medical University, Vienna, Austria 8 Paediatric Drug Development, Children and Young People's Unit, Royal Marsden Hospital, London, UK 9 Division of Clinical Studies, Institute of Cancer Research, London, UK 10 Targos Molecular PathologyFull Paper
2021Bio, S;Nunes, B;Twists and turns of an oyster's life: effects of different depuration periods on physiological biochemical functions of oystersEnvironmental science and pollution research international33559825Aquaculture activities are often established in the vicinity of highly populated, potentially contaminated areas. Animals cultured at such locations, namely bivalves, are frequently used as test organisms in ecotoxicological testing. In this case, aFull Paper
2021Chen, YC;Figliozzi, RW;Hsia, SV;Pilot Analyses of Interferon Subtype Expression Profiles in Patients with Herpes Zoster or Postherpetic NeuralgiaViral immunology33857386A variety of blood samples containing ICD10 codes of HZ or PHN (Table 1) were purchased from Discovery Life Sciences (800 Hudson Way, Suite 1700, Huntsville, AL 35806) The sera of healthy controls were purchased from Discovery Life Sciences with anFull Paper
2021Kam, K;Kumar, V;Lamport, Z;Kymissis, I;A laboratory course on information display technologies for remote learningJournal of the Society for Information DisplaySurvey response percentage, 55.55%. TABLE 2. Listed components and suppliers Component, Brand. AC/DC wall mount adapter 12 V 12 W, Qualtek. LED matrix 5 × 7, Kingbright. Fan axial 40 × 10mm 12VDC wire, CUI Devices. Switch push, C&KFull Paper
2021Rüschoff, J;Baretton, G;Bläker, H;Dietmaier, W;Dietel, M;Hartmann, A;Horn, LC;Jöhrens, K;Kirchner, T;Knüchel, R;Mayr, D;Merkelbach-Bruse, S;Schildhaus, HU;Schirmacher, P;Tiemann, M;Tiemann, K;Weichert, W;Büttner, R;MSI testing : What's new? What should be considered?Der Pathologe34477921Institute of Pathology, Nordhessen und Targos Molecular Pathology GmbH, Germaniastr. 7, 34119, Kassel, Germany. josef.rueschoff@targos-gmbh.de.++Institute of Pathology, University Hospital Carl Gustav Carus, Fetscherstr. 74, 01307, Dresden, Germany.+Full Paper
2021Rüschoff, J;Baretton, G;Bläker, H;Dietmaier, W;Dietel, M;Hartmann, A;Horn, LC;Jöhrens, K;Kirchner, T;Knüchel, R;Mayr, D;Merkelbach-Bruse, S;Schildhaus, HU;Schirmacher, P;Tiemann, M;Tiemann, K;Weichert, W;Büttner, R;[MSI testing : What is new? What should be considered? German version]Der Pathologe34043067What should be considered? German version]. Josef Ruschoff Institut fur Pathologie Nordhessen, TARGOS Molecular Pathology GmbH, Germaniastr Affiliations. 1 author 1. Institut fur Pathologie Nordhessen, TARGOS Molecular Pathology GmbH, GermaniastrFull Paper
2021Schildhaus, HU;Weichert, W;[Predictive diagnostics for checkpoint inhibitors]Der Pathologe33956171H.-U. Schildhaus ist Mitarbeiter der Targos Molecular Pathology GmbH und gibt Honorare und Advisory Boards von MSD, BMS, AstraZeneca, Pfizer,Full Paper
2021Cromer, MK;Camarena, J;Martin, RM;Lesch, BJ;Vakulskas, CA;Bode, NM;Kurgan, G;Collingwood, MA;Rettig, GR;Behlke, MA;Lemgart, VT;Zhang, Y;Goyal, A;Zhao, F;Ponce, E;Srifa, W;Bak, RO;Uchida, N;Majeti, R;Sheehan, VA;Tisdale, JF;Dever, DP;Porteus, MH;Gene replacement of α-globin with β-globin restores hemoglobin balance in β-thalassemia-derived hematopoietic stem and progenitor cellsNature medicine33737751Human CD34+ HSPCs were cultured as previously described18,24,33,36,46,47. CD34+ HSPCs were sourced from fresh cord blood (generously provided by the Binns Family program for Cord Blood Research); from frozen cord blood and Plerixafor- and/or G-CSF-moFull Paper
2021Gaidt, MM;Morrow, A;Fairgrieve, MR;Karr, JP;Yosef, N;Vance, RE;Self-guarding of MORC3 enables virulence factor-triggered immunityNature34759314(PBMCs) from de-identified donors were obtained from AllCells (Alameda) under donor-informed consent and Alpha IRB approval obtained by AllCells (7000-SOP-045) for the study ' SaveFull Paper
2021Mimitou, EP;Lareau, CA;Chen, KY;Zorzetto-Fernandes, AL;Hao, Y;Takeshima, Y;Luo, W;Huang, TS;Yeung, BZ;Papalexi, E;Thakore, PI;Kibayashi, T;Wing, JB;Hata, M;Satija, R;Nazor, KL;Sakaguchi, S;Ludwig, LS;Sankaran, VG;Regev, A;Smibert, P;Scalable, multimodal profiling of chromatin accessibility, gene expression and protein levels in single cellsNature biotechnology34083792Cryopreserved healthy donor peripheral blood mononuclear cells (PBMCs) and bone marrow cells (BM) were obtained from AllCells (USA) or Cellular Technology Limited (CTL) and processed immediately after thawing. NIH-3T3 and HEK293FT cells were maintainFull Paper
2021Lareau, CA;Ludwig, LS;Muus, C;Gohil, SH;Zhao, T;Chiang, Z;Pelka, K;Verboon, JM;Luo, W;Christian, E;Rosebrock, D;Getz, G;Boland, GM;Chen, F;Buenrostro, JD;Hacohen, N;Wu, CJ;Aryee, MJ;Regev, A;Sankaran, VG;Massively parallel single-cell mitochondrial DNA genotyping and chromatin profilingNature biotechnology32788668Cryopreserved PBMCs from patients with CLL consented on institutional review board approved protocols were obtained from AllCells (Patient 1) or from Adrian Wiestner at the SaveFull Paper
2021Hao, Y;Hao, S;Andersen-Nissen, E;Mauck, WM;Zheng, S;Butler, A;Lee, MJ;Wilk, AJ;Darby, C;Zager, M;Hoffman, P;Stoeckius, M;Papalexi, E;Mimitou, EP;Jain, J;Srivastava, A;Stuart, T;Fleming, LM;Yeung, B;Rogers, AJ;McElrath, JM;Blish, CA;Gottardo, R;Smibert, P;Satija, R;Integrated analysis of multimodal single-cell dataCell34062119stom made clone UCHL1 ------------------------- Biological samples ------------------------- Human PBMC Cape Town HVTN Immunology Lab, South Africa https://www.chil.org.za/ Human PBMC AllCells Lot 3032552 -------------------------Full Paper
2021Okuchi, Y;Reeves, J;Ng, SS;Doro, DH;Junyent, S;Liu, KJ;El Haj, AJ;Habib, SJ;Wnt-modified materials mediate asymmetric stem cell division to direct human osteogenic tissue formation for bone repairNature materials32958876hSSCs were isolated from a commercially available bone marrow aspirate (AllCells). The bone marrow aspirate was plated onto culture flasks precoated with 10 ng ml−1 fibronectin (Sigma-Aldrich, 356000) and the cells were allowed to attach. Surface marFull Paper
2021Wu, SZ;Al-Eryani, G;Roden, DL;Junankar, S;Harvey, K;Andersson, A;Thennavan, A;Wang, C;Torpy, JR;Bartonicek, N;Wang, T;Larsson, L;Kaczorowski, D;Weisenfeld, NI;Uytingco, CR;Chew, JG;Bent, ZW;Chan, CL;Gnanasambandapillai, V;Dutertre, CA;Gluch, L;Hui, MN;Beith, J;Parker, A;Robbins, E;Segara, D;Cooper, C;Mak, C;Chan, B;Warrier, S;Ginhoux, F;Millar, E;Powell, JE;Williams, SR;Liu, XS;O'Toole, S;Lim, E;Lundeberg, J;Perou, CM;Swarbrick, A;A single-cell and spatially resolved atlas of human breast cancersNature genetics34493872Percentage of neoplastic cells in each tumor that are classified as each of the SCSubtypes. Tumor samples are grouped according to their Allcells-Pseudobulk classifications. NL, normal-like. c, Representative images of CK5 (top) and ER (bottom) IHC fFull Paper
2021Ge, Y;Tian, T;Huang, S;Wan, F;Li, J;Li, S;Wang, X;Yang, H;Hong, L;Wu, N;Yuan, E;Luo, Y;Cheng, L;Hu, C;Lei, Y;Shu, H;Feng, X;Jiang, Z;Wu, Y;Chi, Y;Guo, X;Cui, L;Xiao, L;Li, Z;Yang, C;Miao, Z;Chen, L;Li, H;Zeng, H;Zhao, D;Zhu, F;Shen, X;Zeng, J;An integrative drug repositioning framework discovered a potential therapeutic agent targeting COVID-19Signal transduction and targeted therapy33895786e performed at a flow rate of 30 μL/min. Data processing and analyses were performed using BIAevaluation 1.1 software. LPS-induced cytokine production in PBMCs Peripheral blood mononuclear cells (Allcells) were cultured at 37 °C at concentration 5%Full Paper
2021Miller, IC;Zamat, A;Sun, LK;Phuengkham, H;Harris, AM;Gamboa, L;Yang, J;Murad, JP;Priceman, SJ;Kwong, GA;Enhanced intratumoural activity of CAR T cells engineered to produce immunomodulators under photothermal controlNature biomedical engineering34385695Primary human CD3+ cells were obtained from an anonymous donor blood after apheresis (AllCells) and were cryopreserved in 90% FBS and 10% dimethylsulfoxide until subsequent SaveFull Paper
2021Frede, J;Anand, P;Sotudeh, N;Pinto, RA;Nair, MS;Stuart, H;Yee, AJ;Vijaykumar, T;Waldschmidt, JM;Potdar, S;Kloeber, JA;Kokkalis, A;Dimitrova, V;Mann, M;Laubach, JP;Richardson, PG;Anderson, KC;Raje, NS;Knoechel, B;Lohr, JG;Dynamic transcriptional reprogramming leads to immunotherapeutic vulnerabilities in myelomaNature cell biology34675390registration was 68.5 years (range 45-80). Myeloma cells were enriched using the EasySep Human CD138 positive selection kit (STEMCELL Technologies). Bone marrow from normal donors was obtained from AllCells. Single cell sorting Bone marrow cells werFull Paper
2021Duault, C;Kumar, A;Taghi Khani, A;Lee, SJ;Yang, L;Activated natural killer cells predict poor clinical prognosis in high-risk B-and T-cell acute lymphoblastic leukemiablood36107453processed from patients with B/T-ALL and healthy donors according to Institutional Review Board policies. Healthy BMMCs were purchased from AllCells (Alameda, CA). Healthy PBMCs were isolated from buffy coats procured from Stanford Blood Center, CityFull Paper
2021Duault, C;Kumar, A;Taghi Khani, A;Lee, SJ;Yang, L;Huang, M;Hurtz, C;Manning, B;Ghoda, L;McDonald, T;Lacayo, NJ;Sakamoto, KM;Carroll, M;Tasian, SK;Marcucci, G;Yu, J;Caligiuri, MA;Maecker, HT;Swaminathan, S;Activated natural killer cells predict poor clinical prognosis in high-risk B- and T-cell acute lymphoblastic leukemiaBlood34077953ripheral blood mononuclear cells (PBMCs) were collected and processed from patients with B/T-ALL and healthy donors according to Institutional Review Board policies. Healthy BMMCs were purchased from AllCells (Alameda, CA). Healthy PBMCs were isolateFull Paper
2021Alavi, A;Krishnamurti, L;Abedi, M;Galeon, I;Reiner, D;Smith, S;Wang, L;Ramezi, A;Rendo, P;Walters, M;Preliminary Safety and Efficacy Results from Precizn-1: An Ongoing Phase 1/2 Study on Zinc Finger Nuclease-Modified Autologous CD34+ HSPCs for Sickle Cell Disease (SCD)BloodIntroduction Sickle cell disease (SCD) is caused by pathologic variants in both alleles of the β-globin gene, affecting ~100,000 patients in the US (Strouse. Handb Clin Neurol 2016;138:311-24). Elevated fetal hemoglobin (HbF) levels amFull Paper
2021Kwiatkowski, J;Locatelli, F;Walters, M;Porter, J;Hongeng, S;Yannaki, E;Kulozik, A;Sauer, M;Thrasher, A;Thuret, I;Lal, A;Guo, R;Colvin, R;Gruppioni, K;Thompson, A;Improvement in Health-Related Quality of Life Following Treatment with Betibeglogene Autotemcel in Patients with Transfusion-Dependent β-Thalassemia Enrolled in Phase 3 StudiesBloodIntroduction: Patients with transfusion-dependent β-thalassemia (TDT) have increased morbidity and mortality and reduced health-related quality of life (HRQoL) compared with the general population owing to the mental, physical, and time demands of chFull Paper
2021Hall, A;Winestone, L;Sullivan, E;Wu, Q;Lamble, A;Walters, M;Aguayo-Hiraldo, P;Baez Conde, L;Coker, T;Dave, H;Dornsife, D;Keating, A;Merino, D;Ramsey, B;Park, J;Agrawal, A;Access to CAR-T Cell Therapy in Underrepresented Populations: A Multicenter Cohort Study of Pediatric and Young Adult ALL PatientsBloodIntroduction: Social determinants of health such as race, ethnicity, and socioeconomic status (SES) are associated with inferior outcomes in patients with B-cell acute lymphoblastic leukemia (B-ALL). Latinx patients have worse event-free survival andFull Paper
2021Thompson, A;Locatelli, F;Yannaki, E;Walters, M;Porter, J;Hongeng, S;Kulozik, A;Sauer, M;Thrasher, A;Thuret, I;Lal, A;Cavazzana, M;Rasko, J;Du, L;Colvin, R;Kwiatkowski, J;Restoring Iron Homeostasis in Pts Who Achieved Transfusion Independence after Treatment with Betibeglogene Autotemcel Gene Therapy: Results from up to 7 Years of Follow-upBloodIntroduction: Transfusion-dependent β-thalassemia (TDT) is a severe genetic disease requiring lifelong, regular packed red blood cell (pRBC) transfusions and iron chelation treatment. Betibeglogene autotemcel (beti-cel) is a one-time ex vivo gene theFull Paper
2021Walters, M;Smith, A;Schiller, G;Esrick, E;Williams, D;Gogoleva, T;Rouy, D;Cockroft, B;Vercellotti, G;Updated Results of a Phase 1/2 Clinical Study of Zinc Finger Nuclease-Mediated Editing of BCL11A in Autologous Hematopoietic Stem Cells for Transfusion-Dependent Beta ThalassemiaBloodIntroduction: Persistently elevated fetal hemoglobin (HbF) can ameliorate transfusion-dependent beta thalassemia (TDT) (Musallam et al ., 2012). BCL11A is a repressor of γ-globin expression and HbF production in adult erythrocytes. Down-regulation ofFull Paper
2021Tisdale, J;Thompson, A;Mapara, M;Kwiatkowski, J;Krishnamurti, L;Aygun, B;Kasow, K;Rifkin-Zenenberg, S;Schmidt, M;Pierciey, F;Whitney, D;Rogers, C;Nnamani, M;Foos, M;Miller, A;Zhang, X;Lynch, J;Walters, M;Kanter, J;Bonner, M;Polyclonality Strongly Correlates with Biological Outcomes and Is Significantly Increased Following Improvements to the Phase 1/2 HGB-206 Protocol and Manufacturing of LentiGlobin for Sickle Cell Disease (SCD; bb1111) Gene Therapy (GT)BloodBackground: The ongoing Phase 1/2 HGB-206 study (NCT02140554) of LentiGlobin for SCD (bb1111) GT uses a modified human β-globin gene that expresses an anti-sickling hemoglobin (HbA T87Q). The relationships between biological outcomes, clinical outcomFull Paper
2021Walters, M;Tisdale, J;Mapara, M;Krishnamurti, L;Kwiatkowski, J;Aygun, B;Kasow, K;Rifkin-Zenenberg, S;Jaroscak, J;Garbinsky, D;Chirila, C;Gallagher, M;Zhang, X;Ho, P;Thompson, A;Kanter, J;Sustained Improvements in Patient-Reported Quality of Life up to 24 Months Post-Treatment with LentiGlobin for Sickle Cell Disease (bb1111) Gene TherapyBloodBackground: Sickle cell disease (SCD) is characterized by painful vaso-occlusive events (VOEs), progressive vasculopathy, hemolytic anemia, and organ damage resulting in frequent hospitalizations and decreased quality of life (QoL). The ongoing phaseFull Paper
2021Kruta, M;Sunshine, MJ;Chua, BA;Fu, Y;Chawla, A;Dillingham, CH;Hidalgo San Jose, L;De Jong, B;Zhou, FJ;Signer, RAJ;Hsf1 promotes hematopoietic stem cell fitness and proteostasis in response to ex vivo culture stress and agingCell stem cell34388375Human cord blood derived CD34 + HSPCs were purchased from AllCells. Cell number and viability were assessed with a hemocytometer based on trypan blue exclusion. SaveFull Paper
2021Turchiano, G;Andrieux, G;Klermund, J;Blattner, G;Pennucci, V;El Gaz, M;Monaco, G;Poddar, S;Mussolino, C;Cornu, TI;Boerries, M;Cathomen, T;Quantitative evaluation of chromosomal rearrangements in gene-edited human stem cells by CAST-SeqCell stem cell33626327Experimental models: cell lines human CD34+ HSPCs AllCells Cat.# CB008F human CD34+ HSPCs StemCell-Technologies Cat.# 70008.3 K562 N/A RRID:CVCL_0004; authenticated by STR profilingFull Paper
2021Mondala, PK;Vora, AA;Zhou, T;Lazzari, E;Ladel, L;Luo, X;Kim, Y;Costello, C;MacLeod, AR;Jamieson, CHM;Crews, LA;Selective antisense oligonucleotide inhibition of human IRF4 prevents malignant myeloma regeneration via cell cycle disruptionCell stem cell33476575In multiple myeloma, inflammatory and anti-viral pathways promote disease progression and cancer stem cell generation. Using diverse pre-clinical models, we investigated the role of SaveFull Paper
2021Su, M;Lin, Y;Cui, C;Tian, X;Lai, L;ERMAP is a B7 family-related molecule that negatively regulates T cell and macrophage responsesCellular & molecular immunology32620788T cells that were negatively isolated from mononuclear cells using an indirect immunomagnetic Pan-T labeling system were purchased from ALLCELLS, LLC (Alameda, CA). Murine CD3+ T cells were purified from C57BL/6 mice by an immunomagnetic system (MiltFull Paper
2021Seo, H;Masuda, H;Asagoshi, K;Uchiki, T;Kawata, S;Sasaki, G;Yabuki, T;Miyai, S;Takahashi, N;Hashimoto, SI;Sawada, A;Takaiwa, A;Koyama, C;Tamai, K;Kurosawa, K;Lin, KY;Ohta, K;Nakazaki, Y;Streamlined human antibody generation and optimization by exploiting designed immunoglobulin loci in a B cell lineCellular & molecular immunology32457406The germline-derived divergent hV H harboring CDR3 was prepared from normal human peripheral blood CD19 + B-cell cDNA (ALLCELLS) using degenerate primers that annealed to SaveFull Paper
2021Sadras, T;Martin, M;Kume, K;Robinson, ME;Saravanakumar, S;Lenz, G;Chen, Z;Song, JY;Siddiqi, T;Oksa, L;Knapp, AM;Cutler, J;Cosgun, KN;Klemm, L;Ecker, V;Winchester, J;Ghergus, D;Soulas-Sprauel, P;Kiefer, F;Heisterkamp, N;Pandey, A;Ngo, V;Wang, L;Jumaa, H;Buchner, M;Ruland, J;Chan, WC;Meffre, E;Martin, T;Müschen, M;Developmental partitioning of SYK and ZAP70 prevents autoimmunity and cancerMolecular cell33878293Cord blood derived human CD34 + cells (ALLCELLS) were thawed and were lentivirally transduced with pCL6-ZAP70-GFP or an empty vector control. To obtain optimal transduction, SaveFull Paper
2021Lattanzi, A;Camarena, J;Lahiri, P;Segal, H;Srifa, W;Vakulskas, CA;Frock, RL;Kenrick, J;Lee, C;Talbott, N;Skowronski, J;Cromer, MK;Charlesworth, CT;Bak, RO;Mantri, S;Bao, G;DiGiusto, D;Tisdale, J;Wright, JF;Bhatia, N;Roncarolo, MG;Dever, DP;Porteus, MH;Development of β-globin gene correction in human hematopoietic stem cells as a potential durable treatment for sickle cell diseaseScience translational medicine34135108Human CD34+ HSPCs were cultured in small-scale conditions as previously described (67, 20, 25, 68, 69). Frozen purified CD34+ HSPCs were sourced from plerixafor- and/or G-CSF-mobilized peripheral blood (AllCells, Alameda, CA, USA and STEMCELL TechnolFull Paper
2021Jain, MS;Polanski, K;Conde, CD;Chen, X;Park, J;Mamanova, L;Knights, A;Botting, RA;Stephenson, E;Haniffa, M;Lamacraft, A;Efremova, M;Teichmann, SA;MultiMAP: dimensionality reduction and integration of multimodal dataGenome biology34930412sed to identify genes whose expression changes significantly along the trajectory. Acquisition and processing of human PBMCs PBMCs from two donors were acquired from a LeukoLab (Clinical division of AllCells). Frozen PBMC samples were thawed quicklyFull Paper
2021Thongon, N;Ma, F;Santoni, A;Marchesini, M;Fiorini, E;Rose, A;Adema, V;Ganan-Gomez, I;Groarke, EM;Gutierrez-Rodrigues, F;Chen, S;Lockyer, P;Schneider, S;Bueso-Ramos, C;Montalban-Bravo, G;Class, CA;Soltysiak, KA;Pellegrini, M;Sahin, E;Bertuch, AA;DiNardo, CD;Garcia-Manero, G;Young, NS;Dwyer, K;Colla, S;Hematopoiesis under telomere attrition at the single-cell resolutionNature communications34824242BM samples from HDs were obtained from AllCells. Written informed consent was obtained from all donors. The clinical characteristics and the PB counts of the individuals with SaveFull Paper
2021Qiao, Y;Qiu, Y;Ding, J;Luo, N;Wang, H;Ling, X;Sun, J;Wu, Z;Wang, Y;Liu, Y;Guo, F;Sun, T;Shen, W;Zhang, M;Wu, D;Chen, B;Xu, W;Wang, X;Cancer immune therapy with PD-1-dependent CD137 co-stimulation provides localized tumour killing without systemic toxicityNature communications34737267Human PBMCs were purchased from Allcells and the informed consent was obtained from all donors. Human PBMCs were cultured in RPMI 1640 medium supplemented with 10% FBS SaveFull Paper
2021Duren, Z;Lu, WS;Arthur, JG;Shah, P;Xin, J;Meschi, F;Li, ML;Nemec, CM;Yin, Y;Wong, WH;Sc-compReg enables the comparison of gene regulatory networks between conditions using single-cell dataNature communications34362918itial analysis has considered the HiChIP data. We will extend our sc-compReg software to enable this type of analysis. Methods Single-cell ATAC Cryopreserved BMMCs from two donors were obtained from AllCells. One donor was a 93-year-old non-HispanicFull Paper
2021Amit, I;Iancu, O;Levy-Jurgenson, A;Kurgan, G;McNeill, MS;Rettig, GR;Allen, D;Breier, D;Ben Haim, N;Wang, Y;Anavy, L;Hendel, A;Yakhini, Z;CRISPECTOR provides accurate estimation of genome editing translocation and off-target activity from comparative NGS dataNature communications34031394ubation at room temperature before the electroporation. Genome editing in mobilized CD34+ HSPCs and in HEK293/HEK293-Cas9 cell lines Human CD34+ HSPCs, derived from mobilized peripheral blood (MPB) (AllCells, Alameda, CA), were thawed and cultured fFull Paper
2021Lal, A;Chiang, ZD;Yakovenko, N;Duarte, FM;Israeli, J;Buenrostro, JD;Deep learning-based enhancement of epigenomics data with AtacWorksNature communications336860690 or 1 representing whether that position was part of a CTCF binding motif on the reverse strand. Generation of dscATAC-seq data for FACS-isolated HSCs Cryopreserved human BMMCs were purchased from Allcells (catalog number BM, CR, MNC, 10 M). CellsFull Paper
2021Sharma, R;Dever, DP;Lee, CM;Azizi, A;Pan, Y;Camarena, J;Köhnke, T;Bao, G;Porteus, MH;Majeti, R;The TRACE-Seq method tracks recombination alleles and identifies clonal reconstitution dynamics of gene targeted human hematopoietic stem cellsNature communications33473139For in vivo studies presented, cord blood-derived CD34 + cells were purchased from AllCells or STEMCELL Technologies and were thawed according to the manufacturer's SaveFull Paper
2021Yang, KD;Belyaeva, A;Venkatachalapathy, S;Damodaran, K;Katcoff, A;Radhakrishnan, A;Shivashankar, GV;Uhler, C;Multi-domain translation between single-cell imaging and sequencing data using autoencodersNature communications33397893nly limited functional data is available by acquiring chromatin imaging data. Methods Cell culture and immunostaning CD4+/CD45RA+ naive helper T-cells from human peripheral blood were purchased from AllCells. These cells were revived and cultured inFull Paper
2021Gnanapragasam, M;Planutis, A;Glassberg, J;Bieker, J;Identification of a genomic DNA sequence that quantitatively modulates KLF1 expression in differentiating human hematopoietic cellsbioRxivCD34+ cells were purchased from AllCells or obtained from the Yale Cooperative Center of Excellence in Hematology. These were differentiated under three-phase protocols, initially based on (Antoniani et al., 2018; Yien and Bieker, 2012) but then lateFull Paper
2021Shy, B;Vykunta, V;Ha, A;Roth, T;Talbot, A;Nguyen, D;Chen, Y;Blaeschke, F;Vedova, S;Mamedov, M;Chung, J;Li, H;Wolf, J;Martin, T;Ye, L;Eyquem, J;Esensten, J;Marson, A;Hybrid ssDNA repair templates enable high yield genome engineering in primary cells for disease modeling and cell therapy manufacturingbioRxivPrimary adult blood cells were obtained from anonymous healthy human donors as a leukapheresis pack purchased from StemCell Technologies, Inc. or Allcells Inc, or as a Trima residual from Vitalant. If needed, peripheral blood mononuclear cells were iFull Paper
2021Amin, OE;Colbeck, EJ;Daffis, S;Khan, S;Ramakrishnan, D;Pattabiraman, D;Chu, R;Micolochick Steuer, H;Lehar, S;Peiser, L;Palazzo, A;Frey, C;Davies, J;Javanbakht, H;Rosenberg, WMC;Fletcher, SP;Maini, MK;Pallett, LJ;Therapeutic Potential of TLR8 Agonist GS-9688 (Selgantolimod) in Chronic Hepatitis B: Remodeling of Antiviral and Regulatory MediatorsHepatology (Baltimore, Md.)33368377In select experiments, whole blood was obtained from AllCells (Alameda, CA) and the MT Group (Van Nuys, CA). In this instance, consent was obtained from the donor or donor's legal SaveFull Paper
2021Shukla, S;Ying, W;Gray, F;Yao, Y;Simes, ML;Zhao, Q;Miao, H;Cho, HJ;González-Alonso, P;Winkler, A;Lund, G;Purohit, T;Kim, E;Zhang, X;Ray, JM;He, S;Nikolaidis, C;Ndoj, J;Wang, J;Jaremko, Ł;Jaremko, M;Ryan, RJH;Guzman, ML;Grembecka, J;Cierpicki, T;Small-molecule inhibitors targeting Polycomb repressive complex 1 RING domainNature chemical biology34155404CD34-positive bone marrow blood cells were obtained from Allcells (ABM021F) and stored in liquid nitrogen until use. For treatment experiments that lasted more than 4 d, media were SaveFull Paper
2021Jang, S;Song, J;Kim, N;Bak, J;Jung, K;Park, YW;Park, BC;Kim, HM;Development of an antibody-like T-cell engager based on VH-VL heterodimer formation and its application in cancer therapyBiomaterials33774526All healthy donor PBMCs and CD8 + T cells used in this study were purchased from AllCells (#PB004F and #PB009-3 F), Zenbio (#SER-PBMC-200-F), and Lonza (#3W-270). CD3 + T SaveFull Paper
2021Davis-Marcisak, EF;Fitzgerald, AA;Kessler, MD;Danilova, L;Jaffee, EM;Zaidi, N;Weiner, LM;Fertig, EJ;Transfer learning between preclinical models and human tumors identifies a conserved NK cell activation signature in anti-CTLA-4 responsive tumorsGenome medicine34376232Fresh healthy donor NK cells were purchased from AllCells (PB012-P). These NK cells were positively selected from donor peripheral blood using CD56 positivity. Donor NK cell purity SaveFull Paper
2021Steinbuck, MP;Seenappa, LM;Jakubowski, A;McNeil, LK;Haqq, CM;DeMuth, PC;A lymph node-targeted Amphiphile vaccine induces potent cellular and humoral immunity to SARS-CoV-2Science advances33547083scent serum/plasma Convalescent serum samples (n = 7) and plasma samples (n = 15) from patients who had recovered from SARS-CoV-2 infection (COVID-19) were obtained from US Biolab (Rockville, MD) and AllCells (Alameda, CA), respectively. All samplesFull Paper
2021Lin, Y;Cui, C;Su, M;Silbart, LK;Liu, H;Zhao, J;He, L;Huang, Y;Xu, D;Wei, X;Du, Q;Lai, L;Identification of TAPBPL as a novel negative regulator of T-cell functionEMBO molecular medicine33938620itro T‐cell assays Normal human peripheral blood CD3+ Pan T cells that were negatively isolated from mononuclear cells using an indirect immunomagnetic Pan‐T labeling system were purchased from ALLCELLS, LLC (Alameda, CA). Murine CD3+ T cells were puFull Paper
2021Kim, WT;Hennick, K;Johnson, J;Finnerty, B;Choo, S;Short, SB;Drubin, C;Forster, R;McMaster, ML;Hockemeyer, D;Cancer-associated POT1 mutations lead to telomere elongation without induction of a DNA damage responseThe EMBO journal33934394e aging or age‐associated diseases (Chakravarti et al, 2021). Materials and Methods Cell culture and cryopreservation Human bone marrow CD34+ hematopoietic stem/progenitor cells were obtained from AllCells and Fred Hutchinson Cancer Research Center.Full Paper
2021Deegen, P;Thomas, O;Nolan-Stevaux, O;Li, S;Wahl, J;Bogner, P;Aeffner, F;Friedrich, M;Liao, MZ;Matthes, K;Rau, D;Rattel, B;Raum, T;Kufer, P;Coxon, A;Bailis, JM;The PSMA-targeting Half-life Extended BiTE Therapy AMG 160 has Potent Antitumor Activity in Preclinical Models of Metastatic Castration-resistant Prostate CancerClinical cancer research : an official journal of the American Association for Cancer Research33504551Human T cells were obtained from AllCells. Human peripheral blood mononuclear cells (PBMC) were isolated from buffy coats collected at the Institute of Clinical Transfusion Medicine SaveFull Paper
2021Giffin, MJ;Cooke, K;Lobenhofer, EK;Estrada, J;Zhan, J;Deegen, P;Thomas, M;Murawsky, CM;Werner, J;Liu, S;Lee, F;Homann, O;Friedrich, M;Pearson, JT;Raum, T;Yang, Y;Caenepeel, S;Stevens, J;Beltran, PJ;Canon, J;Coxon, A;Bailis, JM;Hughes, PE;AMG 757, a Half-Life Extended, DLL3-Targeted Bispecific T-Cell Engager, Shows High Potency and Sensitivity in Preclinical Models of Small-Cell Lung CancerClinical cancer research : an official journal of the American Association for Cancer Research33203642human CD3+ T cells (2 × 107) by intravenous infusion on study day 0. Human CD3+ T cells, isolated from PBMCs from two different donors using negative selection, were purchased from AllCells and activated in vitro using IL2 and CD3/CD28/CD2 (STEMCELLFull Paper
2021Kögler, AC;Kherdjemil, Y;Bender, K;Rabinowitz, A;Marco-Ferreres, R;Furlong, EEM;Extremely rapid and reversible optogenetic perturbation of nuclear proteins in living embryosDevelopmental cell34363757were also taken from regions not overlapping any mCherry-expressing cells (background (BG)) and from regions overlapping the entire group of cells investigated (AllCells) to Save;each time point, the same measurements were also taken from regions nFull Paper
2021Montalban-Bravo, G;Kanagal-Shamanna, R;Darbaniyan, F;Siddiqui, MT;Sasaki, K;Wei, Y;Yang, H;Chien, KS;Naqvi, K;Jabbour, E;Kadia, TM;Daver, N;DiNardo, C;Ravandi, F;Pemmaraju, N;Bose, P;Verstovsek, S;Pierce, S;Bueso-Ramos, C;Patel, K;Do, KA;Kantarjian, H;Garcia-Manero, G;Clinical, genomic, and transcriptomic differences between myelodysplastic syndrome/myeloproliferative neoplasm with ring sideroblasts and thrombocytosis (MDS/MPN-RS-T) and myelodysplastic syndrome with ring sideroblasts (MDS-RS)American journal of hematology33811786seven patients with MDS-RS, and 17 healthy individuals obtained from AllCells (Emeryville, CA) were isolated using the CD34 MicroBead Kit and RNA was isolated using the PicoPure RNA isolation kit, following manufacturer's instructions. Fastq files weFull Paper
2021Kwee, BJ;Lam, J;Akue, A;KuKuruga, MA;Zhang, K;Gu, L;Sung, KE;Functional heterogeneity of IFN-γ-licensed mesenchymal stromal cell immunosuppressive capacity on biomaterialsProceedings of the National Academy of Sciences of the United States of America34446555MSCs obtained from AllCells and Lonza cultured on the two hydrogels (SI Appendix Overall similar observations were obtained with a representative MSC line obtained from AllCells ( SaveFull Paper
2021Cui, L;Moraga, I;Lerbs, T;Van Neste, C;Wilmes, S;Tsutsumi, N;Trotman-Grant, AC;Gakovic, M;Andrews, S;Gotlib, J;Darmanis, S;Enge, M;Quake, S;Hitchcock, IS;Piehler, J;Garcia, KC;Wernig, G;Tuning MPL signaling to influence hematopoietic stem cell differentiation and inhibit essential thrombocythemia progenitorsProceedings of the National Academy of Sciences of the United States of America33384332Healthy deidentified human bone marrow samples were acquired from AllCells. Essential thrombocytosis bone marrow samples were deidentified and acquired from the Stanford SaveFull Paper
2021Poussin, M;Sereno, A;Wu, X;Huang, F;Manro, J;Cao, S;Carpenito, C;Glasebrook, A;Powell, DJ;Demarest, S;Dichotomous impact of affinity on the function of T cell engaging bispecific antibodiesJournal for immunotherapy of cancer34253637w cytometric evaluation of cell surface proteins on T cells 48 hours after mixing SKOV3 cells and biologic test articles is further described in online supplemental methods. Briefly, human T cells (ALLCELLS frozen normal human peripheral blood CD3+ PFull Paper
2021Roselli, E;Boucher, JC;Li, G;Kotani, H;Spitler, K;Reid, K;Cervantes, EV;Bulliard, Y;Tu, N;Lee, SB;Yu, B;Locke, FL;Davila, ML;4-1BB and optimized CD28 co-stimulation enhances function of human mono-specific and bi-specific third-generation CAR T cellsJournal for immunotherapy of cancer34706886Human peripheral blood mononuclear cells (PBMCs) were purchased from AllCells. T cells were enriched from PBMCs using the EasySep human T cell isolation kit according to SaveFull Paper
2021Paavola, KJ;Roda, JM;Lin, VY;Chen, P;O'Hollaren, KP;Ventura, R;Crawley, SC;Li, B;Chen, HH;Malmersjö, S;Sharkov, NA;Horner, G;Guo, W;Kutach, AK;Mondal, K;Zhang, Z;Lichtman, JS;Song, C;Rivera, LB;Liu, W;Luo, J;Wang, Y;Solloway, MJ;Allan, BB;Kekatpure, A;Starck, SR;Haldankar, R;Fan, B;Chu, C;Tang, J;Molgora, M;Colonna, M;Kaplan, DD;Hsu, JY;The Fibronectin-ILT3 Interaction Functions as a Stromal Checkpoint that Suppresses Myeloid CellsCancer immunology research34426457Human peripheral blood mononuclear cells (PBMC) of healthy donors were isolated from freshly drawn leukopaks (Allcells, catalog no. PB007) by density gradient centrifugation over SaveFull Paper
2021Badeaux, MD;Rolig, AS;Agnello, G;Enzler, D;Kasiewicz, MJ;Priddy, L;Wiggins, JF;Muir, A;Sullivan, MR;Van Cleef, J;Daige, C;Vander Heiden, MG;Rajamanickam, V;Wooldridge, JE;Redmond, WL;Rowlinson, SW;Arginase Therapy Combines Effectively with Immune Checkpoint Blockade or Agonist Anti-OX40 Immunotherapy to Control Tumor GrowthCancer immunology research33500272Primary human bone marrow (AllCells) was obtained from healthy patients and cultured as follows. Briefly, Hs5 cells were cultured for 72 hours in SFEM2 media (Stem Cell SaveFull Paper
2021Boucher, JC;Li, G;Kotani, H;Cabral, ML;Morrissey, D;Lee, SB;Spitler, K;Beatty, NJ;Cervantes, EV;Shrestha, B;Yu, B;Kazi, A;Wang, X;Sebti, SM;Davila, ML;CD28 Costimulatory Domain-Targeted Mutations Enhance Chimeric Antigen Receptor T-cell FunctionCancer immunology research33188139An obstacle to the development of chimeric antigen receptor (CAR) T cells is the limited understanding of CAR T-cell biology and the mechanisms behind their antitumor activity. We and SaveFull Paper
2021Li, J;Whelan, S;Kotturi, MF;Meyran, D;D'Souza, C;Hansen, K;Liang, S;Hunter, J;Trapani, JA;Neeson, PJ;PVRIG is a novel natural killer cell immune checkpoint receptor in acute myeloid leukemiaHaematologica33147937nt clinical characteristics are summarised in the Online Supplementary Table S2. Healthy donor bone marrow samples were obtained from Royal Melbourne Hospital (Melbourne, Australia) or purchased from AllCells (Alameda, California). All bone marrow saFull Paper
2021Gilmartin, AG;Groy, A;Gore, ER;Atkins, C;Long, ER;Montoute, MN;Wu, Z;Halsey, W;McNulty, DE;Ennulat, D;Rueda, L;Pappalardi, M;Kruger, RG;McCabe, MT;Raoof, A;Butlin, R;Stowell, A;Cockerill, M;Waddell, I;Ogilvie, D;Luengo, J;Jordan, A;Benowitz, AB;In vitro and in vivo induction of fetal hemoglobin with a reversible and selective DNMT1 inhibitorHaematologica32586904Cryopreserved human bone marrow CD34+ cells (AllCells) were confirmed to be sourced ethically, and their research use was in accord with the terms of the informed consents under SaveFull Paper
2021Zhang, C;Zhang, X;Huang, L;Guan, Y;Huang, X;Tian, XL;Zhang, L;Tao, W;ATF3 drives senescence by reconstructing accessible chromatin profilesAging cell33539668accessibility in IARs. Accordingly, our research provides a target to aim for in the exploration of senescence and aging. 4 EXPERIMENTAL PROCEDURES 4.1 Cell culture We purchased primary HUVECs from AllCells Biotech Shanghai Co., Ltd., and cultured tFull Paper
2021Nesterenko, PA;McLaughlin, J;Tsai, BL;Burton Sojo, G;Cheng, D;Zhao, D;Mao, Z;Bangayan, NJ;Obusan, MB;Su, Y;Ng, RH;Chour, W;Xie, J;Li, YR;Lee, D;Noguchi, M;Carmona, C;Phillips, JW;Kim, JT;Yang, L;Heath, JR;Boutros, PC;Witte, ON;HLA-A∗02:01 restricted T cell receptors against the highly conserved SARS-CoV-2 polymerase cross-react with human coronavirusesCell reports34919800Cryo preserved peripheral blood mononuclear cells (PBMCs) were commercially purchased (Allcells and Hemacare) or obtained from the CFAR Virology Core Laboratory at the UCLA Save;d virus strains ------------------------- NFAT-zsGreen virus UCLA,Full Paper
2021Qian, Y;Arellano, G;Ifergan, I;Lin, J;Snowden, C;Kim, T;Thomas, JJ;Law, C;Guan, T;Balabanov, RD;Kaech, SM;Miller, SD;Choi, J;ZEB1 promotes pathogenic Th1 and Th17 cell differentiation in multiple sclerosisCell reports34433042FN-γ, 1 μg/mL anti-IL2 (Cat #554375, clone: S4B6, BD). Isolation of human CD4+ naive T cells and Th cells differentiation Fresh Leukopak samples from de-identified blood donors were purchased from AllCells, LLC. Peripheral blood mononuclear cells (PFull Paper
2021Hamilton, JR;Tsuchida, CA;Nguyen, DN;Shy, BR;McGarrigle, ER;Sandoval Espinoza, CR;Carr, D;Blaeschke, F;Marson, A;Doudna, JA;Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineeringCell reports34077734ons. Isolation and culture of human primary T cells Primary adult blood cells were obtained from anonymous healthy human donors as a leukoreduction pack purchased from StemCell Technologies, Inc. or Allcells Inc, or as a Trima residual from VitalantFull Paper
2021Jiang, Q;Isquith, J;Ladel, L;Mark, A;Holm, F;Mason, C;He, Y;Mondala, P;Oliver, I;Pham, J;Ma, W;Reynoso, E;Ali, S;Morris, IJ;Diep, R;Nasamran, C;Xu, G;Sasik, R;Rosenthal, SB;Birmingham, A;Coso, S;Pineda, G;Crews, L;Donohoe, ME;Venter, JC;Whisenant, T;Mesa, RA;Alexandrov, LB;Fisch, KM;Jamieson, C;Inflammation-driven deaminase deregulation fuels human pre-leukemia stem cell evolutionCell reports33503434Aged normal and MPN Patient samples Obtained through patients consenting at UCSD Moores Cancer Center according to Institutional Review Boardapproved protocols. N/A Young Cord blood CD34+ cells Purchased from AllCells or StemCell TechnologiesFull Paper
2021Bunis, DG;Bronevetsky, Y;Krow-Lucal, E;Bhakta, NR;Kim, CC;Nerella, S;Jones, N;Mendoza, VF;Bryson, YJ;Gern, JE;Rutishauser, RL;Ye, CJ;Sirota, M;McCune, JM;Burt, TD;Single-Cell Mapping of Progressive Fetal-to-Adult Transition in Human Naive T CellsCell reports33406429Matched adult peripheral blood and BM samples were obtained from healthy volunteer donors through AllCells (Alameda, CA). UCB and longitudinal post-natal samples were obtained SaveFull Paper
2021Yang, Z;Huang, Y;Zhu, L;Yang, K;Liang, K;Tan, J;Yu, B;SIRT6 promotes angiogenesis and hemorrhage of carotid plaque via regulating HIF-1α and reactive oxygen speciesCell death & disease33436551oCl2) was purchased from Sigma-Aldrich, Inc. (Burlington, MA, USA). The work concentration and time were confirmed by instructions combined with experimental requirements. HUVECs were purchased from Allcells, Inc. (Alameda, CA, USA) and cultured inFull Paper
2021Yang, Z;Wei, X;Pan, Y;Xu, J;Si, Y;Min, Z;Yu, B;A new risk factor indicator for papillary thyroid cancer based on immune infiltrationCell death & disease33414407d. The sections were fixed and images were obtained with an inverted microscope (Olympus IX71, Japan). Cell culture and co-culture Human umbilical vein endothelial cells (HUVECs) were purchased from Allcells, Inc. (Alameda, CA, USA) and cultured inFull Paper
2021Everitt, ML;Boegner, DJ;Birukov, KG;White, IM;Sample-to-Answer Diagnostic System for the Detection of Circulating Histones in Whole BloodACS sensors34270219Varying concentrations of histone octamers (Sigma-Aldrich) (0-65 μg/mL final concentrations) are suspended in either fetal bovine serum (FBS) (ATCC) or whole blood (AllCells) (medium is indicated in figure caption). Fifteen microliters of histone-spiFull Paper
2021Varricchio, L;Iancu-Rubin, C;Upadhyaya, B;Zingariello, M;Martelli, F;Verachi, P;Clementelli, C;Denis, JF;Rahman, AH;Tremblay, G;Mascarenhas, J;Mesa, RA;O'Connor-McCourt, M;Migliaccio, AR;Hoffman, R;TGF-β1 protein trap AVID200 beneficially affects hematopoiesis and bone marrow fibrosis in myelofibrosisJCI insight34383713n and response to TGF-β. Methods Further information and complete unedited blots can be found in Supplemental Methods. Human subjects. Primary ND specimens were purchased from a commercial source (AllCells, LLC), whereas MF MNCs were provided by thFull Paper
2021Pan, Y;You, Y;Sun, L;Sui, Q;Liu, L;Yuan, H;Chen, C;Liu, J;Wen, X;Dai, L;Sun, H;The STING antagonist H-151 ameliorates psoriasis via suppression of STING/NF-κB-mediated inflammationBritish journal of pharmacology34460100Peripheral blood mononuclear cells (PBMCs) were purchased from AllCells Shanghai and were used immediately after resuscitation. H-151 was synthesized according to the published SaveFull Paper
2021Hu, X;Qie, C;Jiang, J;Xie, X;Chen, W;Liu, W;Liu, J;M351-0056 is a novel low MW compound modulating the actions of the immune-checkpoint protein VISTABritish journal of pharmacology33450048Peripheral blood mononuclear cells (PBMCs) were purchased from AllCells and were used immediately after resuscitation; these cells cannot be subcultured. Human CD4 + T cells SaveFull Paper
2021Wang, X;Guo, J;Wen, J;Zhang, X;Cao, L;Zeng, D;Liu, X;Jiang, X;Novel vascular strategies on polyetheretherketone modification in promoting osseointegration in ovariectomized ratsMaterials & DesignHUVECs were purchased from AllCells Biology Technology Company (Shanghai, China). HUVECs were cultured in endothelial basal medium (EBM, Lonza) without endothelial cell growth supplementation. HUVECs at a density of 2 × 104 cells per mL were seeded oFull Paper
2021Iftakhar-E-Khuda, I;Pessia, A;Zheng, S;Kankainen, M;Kontro, M;Karikoski, M;Laurila, J;Gerke, H;Tadayon, S;Hollmén, M;Tang, J;Imhof, BA;Salmi, M;Jalkanen, S;Vascular adhesion protein-1 defines a unique subpopulation of human hematopoietic stem cells and regulates their proliferationCellular and molecular life sciences : CMLS34719737Five hundred cryopreserved and thawed human BM CD34 + cells (AllCells) were cultured in complete methylcellulose-based medium (H4436, STEMCELL Technologies) with or SaveFull Paper
2021Huang, YJ;Cao, J;Lee, CY;Wu, YM;Umbilical cord blood plasma-derived exosomes as a novel therapy to reverse liver fibrosisStem cell research & therapy34772443Human UCB and peripheral blood (PB) plasma were purchased from AllCells LLC (Alameda, CA), and exosomes were acquired using ExoQuick Exosome isolation reagent (System SaveFull Paper
2021Pieles, O;Reichert, TE;Morsczeck, C;Classical isoforms of protein kinase C (PKC) and Akt regulate the osteogenic differentiation of human dental follicle cells via both β-catenin and NF-κBStem cell research & therapy33853677to examine the role of classical PKC isoforms and the potential downstream mechanisms during the osteogenic differentiation of DFCs. Materials and methods Cell culture Human DFCs were purchased from AllCells (Emeryville, USA) and grown in Dulbecco’sFull Paper
2021Lin, Z;Liu, X;Liu, T;Gao, H;Wang, S;Zhu, X;Rong, L;Cheng, J;Cai, Z;Xu, F;Tan, X;Lv, L;Li, Z;Sun, Y;Qian, Q;Evaluation of Nonviral piggyBac and lentiviral Vector in Functions of CD19chimeric Antigen Receptor T Cells and Their Antitumor Activity for CD19+ Tumor CellsFrontiers in immunology35082789Peripheral blood mononuclear cells (PBMCs) from whole blood were purchased from AllCells (Shanghai, China) and isolated by Ficoll density gradient centrifugation (Cat#17-5442-03, SaveFull Paper
2021Cui, X;Jia, H;Xin, H;Zhang, L;Chen, S;Xia, S;Li, X;Xu, W;Chen, X;Feng, Y;Wei, X;Yu, H;Wang, Y;Zhan, Y;Zhu, X;Zhang, X;A Novel Bispecific Antibody Targeting PD-L1 and VEGF With Combined Anti-Tumor ActivitiesFrontiers in immunology34925354Human PBMCs and DCs were acquired by using the Easy MLR Kit (Allcells, Alameda). DCs were treated with mitomycin (H19999025, Hisun Pharm Co., Ltd.) for 30 min before co- SaveFull Paper
2021Ceglia, V;Kelley, EJ;Boyle, AS;Zurawski, S;Mead, HL;Harms, CE;Blanck, JP;Flamar, AL;Kirschman, JH;Ogongo, P;Ernst, JD;Levy, Y;Zurawski, G;Altin, JA;A Framework to Identify Antigen-Expanded T Cell Receptor Clusters Within Complex RepertoiresFrontiers in immunology34917073cificity, are described in other studies (16, 17, 19). Cohesin-Influenza Matrix 1 (Flu M1) protein is described in (16). Donors Cryopreserved human PBMC from normal donors were sourced commercially (AllCells, CA. ND1001 ID:A5983, ND1002 ID:9441, ND1Full Paper
2021Teo Hansen Selnø, A;Schlichtner, S;Yasinska, IM;Sakhnevych, SS;Fiedler, W;Wellbrock, J;Berger, SM;Klenova, E;Gibbs, BF;Fasler-Kan, E;Sumbayev, VV;High Mobility Group Box 1 (HMGB1) Induces Toll-Like Receptor 4-Mediated Production of the Immunosuppressive Protein Galectin-9 in Human Cancer CellsFrontiers in immunology34234778Medical Centre Hamburg-Eppendorf (Ethik Kommission der Ärztekammer Hamburg, reference: PV3469). Primary human AML mononuclear blasts (AML-PB001F, newly diagnosed/untreated) were also purchased from AllCells (Alameda, CA, USA) and handled in accordancFull Paper
2021Xie, X;Chen, C;Chen, W;Jiang, J;Wang, L;Li, T;Sun, H;Liu, J;Structural Basis of VSIG3: The Ligand for VISTAFrontiers in immunology33841409azole buffer (GenScript). Protein was concentrated using 10K MWCO spin columns (Merck). The purified protein was used for functional verification. Cell Culture and Reagents PBMCs were purchased from Allcells Biotechnology (Shanghai) Co., LTD, and weFull Paper
2021Jost, M;Jacobson, AN;Hussmann, JA;Cirolia, G;Fischbach, MA;Weissman, JS;CRISPR-based functional genomics in human dendritic cellseLife33904395t al., 2018 Referred to as ‘B. theta 4PP’ in the text Mutant producing tetra-acylated, di-phosphorylated lipid A in a capsule-producing background Biological sample (human) PBMCs AllCells Freshly isolated from de-identified healtFull Paper
2021Gao, X;Guan, M;Liu, X;Xu, H;Huang, Q;Chen, L;Huang, S;Xiao, Y;Shi, X;Lin, Z;Sustained delivery of growth factors and alendronate using partially demineralized dentin matrix for endogenous periodontal regenerationApplied Materials Todaycells (HUVECs) were purchased from AllCells (Shanghai, China). HUVECs were cultured in endothelial cell growth medium (EGM; AllCells, Shanghai, China). Angiogenesis SaveFull Paper
2021Scherer, SD;Riggio, AI;Haroun, F;DeRose, YS;Ekiz, HA;Fujita, M;Toner, J;Zhao, L;Li, Z;Oesterreich, S;Samatar, AA;Welm, AL;An immune-humanized patient-derived xenograft model of estrogen-independent, hormone receptor positive metastatic breast cancerBreast cancer research : BCR34717714CD34 + hematopoietic stem cells (HSCs) isolated from healthy donor bone marrow (BM) were purchased from AllCells. On the day of injection, cells were thawed in a 37 C water bath SaveFull Paper
2021Nada, MH;Wang, H;Hussein, AJ;Tanaka, Y;Morita, CT;PD-1 checkpoint blockade enhances adoptive immunotherapy by human Vγ2Vδ2 T cells against human prostate cancerOncoimmunology34712512e IgG1 (clone MOPC-21) antibodies were from Bio X Cell (West Lebanon, NH). Ex vivo expansion of Vγ2Vδ2 T cells by pulse zoledronic acid stimulation PBMC were isolated from random donor leukopaks (AllCells, LLC, Alameda, CA) by density centrifugationFull Paper
2021Jiang, H;Ni, H;Zhang, P;Guo, X;Wu, M;Shen, H;Wang, J;Wu, W;Wu, Z;Ding, J;Tang, R;Zhou, S;Chen, B;Yu, M;Jing, H;Liu, J;PD-L1/LAG-3 bispecific antibody enhances tumor-specific immunityOncoimmunology34239776oduced by Innovent Biologics Co., Ltd. (Suzhou, China). Human IgG was purchased from Equitech-Bio (Kerrville). Peripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs) were purchased from AllCells (Shanghai, China). Cynomolgus macaque PBMFull Paper
2021Wang, X;Peticone, C;Kotsopoulou, E;Göttgens, B;Calero-Nieto, FJ;Single-cell transcriptome analysis of CAR T-cell products reveals subpopulations, stimulation, and exhaustion signaturesOncoimmunology33489472or samples PBMCs were derived from healthy donors leukapheresis. Peripheral blood leukapaheresis were obtained from the NHS as part of a research study (IRAS ID 185945) or purchased as LeukoPaks from AllCells. Manufacturing of CAR T cells product GeFull Paper
2021Zhang, C;Delawary, M;Huang, P;Korchak, JA;Suda, K;Zubair, AC;IL-10 mRNA Engineered MSCs Demonstrate Enhanced Anti-Inflammation in an Acute GvHD ModelCells34831324g T7 promoter, 5′ UTRs, 3′ UTRs, and poly-A tail. 2.3. MSC Culture and Time Course Experiment Human MSCs were generated from commercial de-identified bone marrow (Catalog# ABM002) purchased from AllCells (Alameda, CA, USA). The donor was a healthy 2Full Paper
2021Ahn, Y;An, JH;Yang, HJ;Lee, DG;Kim, J;Koh, H;Park, YH;Song, BS;Sim, BW;Lee, HJ;Lee, JH;Kim, SU;Human Blood Vessel Organoids Penetrate Human Cerebral Organoids and Form a Vessel-Like SystemCells34440805Human Induced Pluripotent Stem Cells (hiPSCs) and Culture Conditions The hiPSCs were reprogrammed from primary human bone marrow cells (Allcells, Emeryville, CA, USA) as Save;The hiPSCs were reprogrammed from primary human bone marrow cells (AllcelFull Paper
2021Dogan, F;Aljumaily, RMK;Kitchen, M;Forsyth, NR;DNMT3B Is an Oxygen-Sensitive De Novo Methylase in Human Mesenchymal Stem CellsCells33925659nd Methods 2.1. Isolation and Culture of BM-hMSCs Three human BM-hMSCs BMA-16 (Male, Age—29 years, Lonza, MD, USA), BMA-20 (Female, Age—50 years, Lonza, MD, USA) and BMA-25 (Male, Age—27 years, AllCells, LLC, Alameda, CA, USA) were isolated from commFull Paper
2021Miao, G;Sun, X;Development of a novel anti-B7-H4 antibody enhances anti-tumor immune response of human T cellsBiomedicine & pharmacotherapy = Biomedecine & pharmacotherapie34328096Human PBMCs were purchased from ALLCELLS. Hybridoma cell lines were cultured in H-SFM complete medium. CD8+ T cells were cultured in RPMI 1640 medium containing 2 mM L- SaveFull Paper
2021Gu, C;Cao, X;Wang, Z;Hu, X;Yao, Y;Zhou, Y;Liu, P;Liu, X;Gao, G;Hu, X;Zhang, Y;Chen, Z;Gao, L;Peng, Y;Jia, F;Shan, C;Yu, L;Liu, K;Li, N;Guo, W;Jiang, G;Min, J;Zhang, J;Yang, L;Shi, M;Hou, T;Li, Y;Liang, W;Lu, G;Yang, C;Wang, Y;Xia, K;Xiao, Z;Xue, J;Huang, X;Chen, X;Ma, H;Song, D;Pan, Z;Wang, X;Guo, H;Liang, H;Yuan, Z;Guan, W;Deng, SJ;A human antibody of potent efficacy against SARS-CoV-2 in rhesus macaques showed strong blocking activity to B.1.351mAbs34097570ed SARS-CoV-2 RBD (Sino Biological, 40592-V05H). Phage libraries were constructed using antibody gene fragments amplified from peripheral blood mononuclear cells (PBMCs) of 50 healthy human subjects (Allcells, PB003F and PB003 C) and total RNA from PFull Paper
2021Chen, J;Ding, J;Wu, Y;Zhang, S;Zheng, N;Yang, J;Xu, J;Chromium Oxide Nanoparticle Impaired Osteogenesis and Cellular Response to Mechanical StimulusInternational journal of nanomedicine34511912Human MSCs were isolated from bone marrow aspirate (ALLCELLS, Lot No: BM2893). The cells were grown in α-MEM (Gibco, Thermo Fisher Scientific, UK) supplemented with 10% SaveFull Paper
2021Shin, Y;Park, CM;Kim, HG;Kim, DE;Choi, MS;Kim, JA;Choi, BS;Yoon, CH;Identification of Aristolactam Derivatives That Act as Inhibitors of Human Immunodeficiency Virus Type 1 Infection and Replication by Targeting Tat-Mediated Viral TranscriptionVirologica Sinica32779073Peripheral blood mononuclear cells (PBMCs) were purchased from AllCells (Alameda, CA, USA) and cultured, as described previously (Yoon et al. 2015). HIV-1 clones pNL4-3 and AD8, as well as TZM-bl and A3.01 cells, were obtained from the National InstiFull Paper
2021Wang, Y;Ni, H;Zhou, S;He, K;Gao, Y;Wu, W;Wu, M;Wu, Z;Qiu, X;Zhou, Y;Chen, B;Pan, D;Huang, C;Li, M;Bian, Y;Yang, M;Miao, L;Liu, J;Tumor-selective blockade of CD47 signaling with a CD47/PD-L1 bispecific antibody for enhanced anti-tumor activity and limited toxicityCancer immunology, immunotherapy : CII32761423CD4+ T cells were isolated from human PBMC (AllCells) using EasySep human CD4+ T cells enrichment kit (StemCell Technologies). DCs were generated by incubating PBMC first SaveFull Paper
2021Luban, J;Sattler, RA;Mühlberger, E;Graci, JD;Cao, L;Weetall, M;Trotta, C;Colacino, JM;Bavari, S;Strambio-De-Castillia, C;Suder, EL;Wang, Y;Soloveva, V;Cintron-Lue, K;Naryshkin, NA;Pykett, M;Welch, EM;O'Keefe, K;Kong, R;Goodwin, E;Jacobson, A;Paessler, S;Peltz, SW;The DHODH inhibitor PTC299 arrests SARS-CoV-2 replication and suppresses induction of inflammatory cytokinesVirus research33249060c. Uridine, brequinar, and A77 were obtained from Sigma-Aldrich (St. Louis, MO). Anti IL-4 and anti-IFL-γ antibodies were obtained from BD Biosciences (San Jose, CA). Frozen PBMCs were obtained from AllCells (Alameda, CA). IL-17, IL-17 F and IL-23 ELFull Paper
2021Satani, N;Zhang, X;Giridhar, K;Wewior, N;Cai, C;Aronowski, J;Savitz, SI;A Combination of Atorvastatin and Aspirin Enhances the Pro-Regenerative Interactions of Marrow Stromal Cells and Stroke-Derived Monocytes In VitroFrontiers in pharmacology33959001d of stroke patients. Methods Isolation and Culture of Human Mesenchymal Stromal Cells (MSCs) MSCs were isolated from commercially available fresh human bone marrow aspirates of a 34 year old male (AllCells, Alameda, CA) using density centrifugationFull Paper
2021Sun, LK;Engineering genetic thermal switches for remote control of therapeutic T cellsThesisPrimary human CD3+ T cells were obtained from anonymous donor blood following apheresis (AllCells) and were cryopreserved until subsequent use. Two days prior to lentiviral SaveFull Paper
2021Wu, HH;Ralph, KL;Sepuldeva, E;Hansen, G;Li, H;Huang, ZF;Liu, D;Dziegelewski, M;Ahlberg, J;Frego, L;Fogal, S;van Tongeren, S;Grimaldi, C;Litzenberger, T;Presky, D;Singh, S;Brodeur, S;Kroe-Barrett, R;An optimally designed anti-human CD40 antibody with potent B cell suppression for the treatment of autoimmune diseasesInternational journal of pharmaceutics34624444Effector cells were generated by stimulating human peripheral blood mononuclear cells (PBMCs) (AllCells) with 10 ng/mL human IL-2 (R&D Systems) in RPMI 1640 medium (Invitrogen) SaveFull Paper
2021Xiang, H;Chan, AG;Ahene, A;Bellovin, DI;Deng, R;Hsu, AW;Jeffry, U;Palencia, S;Powers, J;Zanghi, J;Collins, H;Preclinical characterization of bemarituzumab, an anti-FGFR2b antibody for the treatment of cancermAbs34719330the full-length human FGFR2b described as Ba/F3 FGFR2b, and the effector cells were peripheral blood mononuclear cells obtained fresh from individual human donors (AllCells; SaveFull Paper
2021Li, G;Guo, J;Zheng, Y;Ding, W;Han, Z;Qin, L;Mo, W;Luo, M;CXCR5 guides migration and tumor eradication of anti-EGFR chimeric antigen receptor T cellsMolecular therapy oncolytics34553036CAR-T cells were generated from commercial normal donor peripheral blood mononuclear cells (PBMCs) from AllCells. The cells were further enriched from PBMC by CD3 magnetic Save;.22-μm filter, aliquoted to 2 mL cryotubes, quick frozen on dry ice, anFull Paper
2021Chen, X;Yang, S;Li, S;Qu, Y;Wang, HY;Liu, J;Dunn, ZS;Cinay, GE;MacMullan, MA;Hu, F;Zhang, X;Wang, P;Secretion of bispecific protein of anti-PD-1 fused with TGF-β trap enhances antitumor efficacy of CAR-T cell therapyMolecular therapy oncolytics33981830Frozen human PBMCs were obtained from AllCells. The T cell culture medium (TCM) was composed of AIM-V medium with 5% (v/v) human AB serum, 10 mM HEPES, 1% (v/v) Save;ng gag-pol. The supernatants were harvested at 48 h after transfection and filtereFull Paper
2021Branquinho, MV;Ferreira, SO;Alvites, RD;Magueta, AF;Ivanov, M;Sousa, AC;Amorim, I;Faria, F;Fernandes, MHV;Vilarinho, PM;Maurício, AC;In Vitro and In Vivo Characterization of PLLA-316L Stainless Steel Electromechanical Devices for Bone Tissue Engineering-A Preliminary StudyInternational journal of molecular sciences34299274e enthalpy of fusion of 100% crystalline material [54]. (1)XC (%)=ΔHfΔHf0×100 4.3. In Vitro Assays 4.3.1. Cell Culture and Maintenance Human Dental Pulp stem/stromal cells (hDPSCs) obtained from AllCells, LLC, Alameda, CA, USA (Cat. DP0037F, Lot no.Full Paper
2021Thavapalachandran, S;Le, TYL;Romanazzo, S;Rashid, FN;Ogawa, M;Kilian, KA;Brown, P;Pouliopoulos, J;Barry, AM;Fahmy, P;Kelly, K;Kizana, E;Chong, JJH;Pluripotent stem cell-derived mesenchymal stromal cells improve cardiac function and vascularity after myocardial infarctionCytotherapy34588150Cells were kept cold on ice until administration to animals. BM-MSCs were purchased from AllCells (Alameda, CA, USA). Cryopreserved BM-MSCs were washed twice in DMEM and resuspended at the same density as Cymerus MSC derivatives (5 × 106 cells per 10Full Paper
2021Kavanagh, H;Dunne, S;Martin, DS;McFadden, E;Gallagher, L;Schwaber, J;Leonard, S;O'Dea, S;A novel non-viral delivery method that enables efficient engineering of primary human T cells for ex vivo cell therapy applicationsCytotherapy33941482cells with minimal perturbation of cell function. Methods Ethics All experimental methods were carried out in accordance with the approved guidelines. Leukopaks from healthy donors were sourced from AllCells (Quincy, MA, USA) or BioIVT (Westbury, NYFull Paper
2021Wang, Y;Zhong, K;Ke, J;Chen, X;Chen, Y;Shu, W;Chen, C;Hu, S;Sun, X;Huang, H;Luo, C;Liu, L;Yang, J;Zhang, Y;Zhi, H;Combined 4-1BB and ICOS co-stimulation improves anti-tumor efficacy and persistence of dual anti-CD19/CD20 chimeric antigen receptor T cellsCytotherapy33863641Human peripheral blood mononuclear cells (PBMCs) from healthy donors were obtained from AllCells. The cryopreserved PBMCs were thawed into the T-cell culture medium and SaveFull Paper
2021Martin, A;Daris, M;Johnston, JA;Cui, J;HLA-A*02:01-directed chimeric antigen receptor/forkhead box P3-engineered CD4+ T cells adopt a regulatory phenotype and suppress established graft-versus-host diseaseCytotherapy33309258A*02:01- peripheral blood mononuclear cells (PBMCs) from four donors were isolated from fresh Leukopak (AllCells) using Ficoll density gradient media. CD4+ T cells or Tregs were SaveFull Paper
2021Story, JY;Zoine, JT;Burnham, RE;Hamilton, JAG;Spencer, HT;Doering, CB;Raikar, SS;Bortezomib enhances cytotoxicity of ex vivo-expanded gamma delta T cells against acute myeloid leukemia and T-cell acute lymphoblastic leukemiaCytotherapy33168453PBMCs (50-100 million per donor) from six different healthy donors were obtained through AllCells ( Eight total expansions from PBMCs from AllCells were performed, with two separate SaveFull Paper
2021Banerjee, A;Lu, Y;Do, K;Mize, T;Wu, X;Chen, X;Chen, J;Validation of Induced Microglia-Like Cells (iMG Cells) for Future Studies of Brain DiseasesFrontiers in cellular neuroscience33897370ity for polarization. With whole-genome transcript profile, we also demonstrated that iMG cells were clustered closely with human microglia. Materials and Methods Materials PBMCs were purchased from AllCells, LLC (Alameda, CA, USA, #PB003F and #PB00Full Paper
2021Stem, C;Rodman, C;Ramamurthy, RM;George, S;Meares, D;Farland, A;Atala, A;Doering, CB;Spencer, HT;Porada, CD;Almeida-Porada, G;Investigating Optimal Autologous Cellular Platforms for Prenatal or Perinatal Factor VIII Delivery to Treat Hemophilia AFrontiers in cell and developmental biology34447745Bone marrow mononuclear cells from two different biological donors were purchased from AllCells (Alameda, CA, United States) and their purchase approved by the Office of Human SaveFull Paper
2021Han, Y;Chen, Q;Zhang, L;Dissanayaka, WL;Indispensable Role of HIF-1α Signaling in Post-implantation Survival and Angio-/Vasculogenic Properties of SHEDFrontiers in cell and developmental biology34368116e expression of target proteins that mediate adaptive metabolic mechanisms in both in vivo and in vitro survival and angiogenesis in SHED. Materials and Methods Cell Culture SHED were purchased from AllCells (Alameda, CA, United States) and culturedFull Paper
2021Yazawa, T;Inaba, H;Imamichi, Y;Sekiguchi, T;Uwada, J;Islam, MS;Orisaka, M;Mikami, D;Ida, T;Sato, T;Miyashiro, Y;Takahashi, S;Khan, MRI;Suzuki, N;Umezawa, A;Kitano, T;Profiles of 5α-Reduced Androgens in Humans and Eels: 5α-Dihydrotestosterone and 11-Ketodihydrotestosterone Are Active Androgens Produced in Eel GonadsFrontiers in endocrinology33833737healthy women volunteers (obtaining informed consent) at University of Fukui Hospital in 2007. Plasma was separated by centrifugation at 1000g for 5 minutes. Other plasma samples were purchased from AllCells (Alameda, CA, USA) and ProMedDX (Norton, MFull Paper
2021Sternjak, A;Lee, F;Thomas, O;Balazs, M;Wahl, J;Lorenczewski, G;Ullrich, I;Muenz, M;Rattel, B;Bailis, JM;Friedrich, M;Preclinical Assessment of AMG 596, a Bispecific T-cell Engager (BiTE) Immunotherapy Targeting the Tumor-specific Antigen EGFRvIIIMolecular cancer therapeutics33632870Human pan-T cells (AllCells) were added at an E:T ratio of 10:1 with a dose range of AMG 596. Microvesicles were added simultaneously with T cells and AMG 596 to maintain SaveFull Paper
2021Massimino, M;Tirrò, E;Stella, S;Manzella, L;Pennisi, MS;Romano, C;Vitale, SR;Puma, A;Tomarchio, C;Di Gregorio, S;Antolino, A;Di Raimondo, F;Vigneri, P;Impact of the Breakpoint Region on the Leukemogenic Potential and the TKI Responsiveness of Atypical BCR-ABL1 TranscriptsFrontiers in pharmacology34276365CD34-positive cells derived from healthy donors were obtained from ALLCELLS. CD34-positive cells were maintained in Stem Span SFEM supplemented with cytokines at low SaveFull Paper
2021Tang, J;Zou, Y;Li, L;Lu, F;Xu, H;Ren, P;Bai, F;Niedermann, G;Zhu, X;BAY 60-6583 Enhances the Antitumor Function of Chimeric Antigen Receptor-Modified T Cells Independent of the Adenosine A2b ReceptorFrontiers in pharmacology33776765ed States) + 10% FBS (10099141C, ThermoFisher Scientific) were used to expand and culture CAR T cells. Frozen human peripheral blood mononuclear cells (PBMCs) from healthy donors were purchased from AllCells (PB005F, Alameda, CA, United States). AftFull Paper
2021Sim, DS;Mallari, CR;Teare, JM;Feldman, RI;Bauzon, M;Hermiston, TW;In vitro characterization of CT-001-a short-acting factor VIIa with enhanced prohemostatic activityResearch and practice in thrombosis and haemostasis34263099e binding of FVIIa to activated platelet surfaces was detected by Alexa488‐anti‐FVII (clone AA3). Donor informed consent and collection protocols are approved by the Institutional Review Board of AllCells. 2.4 Inhibition by antithrombin and tissue fFull Paper
2021Xu, Y;Barauskas, O;Kim, C;Babusis, D;Murakami, E;Kornyeyev, D;Lee, G;Stepan, G;Perron, M;Bannister, R;Schultz, BE;Sakowicz, R;Porter, D;Cihlar, T;Feng, JY;Off-Target In Vitro Profiling Demonstrates that Remdesivir Is a Highly Selective Antiviral AgentAntimicrobial agents and chemotherapy33229429Normal human primary bone marrow (BM) light-density cells were from three different lots obtained from AllCells (Emeryville, CA) or Lonza (Walkersville, MD). All primary human cells SaveFull Paper
2021Huang, Y;Jia, F;Zhao, J;Hou, Y;Hu, SQ;Novel ACE Inhibitory Peptides Derived from Yeast Hydrolysates: Screening, Inhibition Mechanisms and Effects on HUVECsJournal of agricultural and food chemistry33593053Primary HUVECs, as well as the endothelial growth medium (EGM) and endothelial basal serum-free medium, were purchased from Allcells Co., Ltd. (Shanghai, China). Penicillin/ SaveFull Paper
2021Jing, L;Fan, S;Yao, X;Zhang, Y;Effects of compound stimulation of fluid shear stress plus ultrasound on stem cell proliferation and osteogenesisRegenerative biomaterials34868635lopment kit was purchased from Beyotime Biotechnology Co., Ltd. (China). The MagneSil@ Total RNA mini isolation system was purchased from Promega (USA). Primary rat BMSCs were purchased from Shanghai AllCells Biotech Co., Ltd. (China). The polytetrafFull Paper
2021Chai, ZT;Zhang, XP;Ao, JY;Zhu, XD;Wu, MC;Lau, WY;Sun, HC;Cheng, SQ;AXL Overexpression in Tumor-Derived Endothelial Cells Promotes Vessel Metastasis in Patients With Hepatocellular CarcinomaFrontiers in oncology34123800Primary human umbilical vein endothelial cells (HUVECs; AllCells, Shanghai, China) were cultured in endothelial cell growth medium-2 (Lonza, Basel, Switzerland) supplemented with SaveFull Paper
2021Romito, M;Juillerat, A;Kok, YL;Hildenbeutel, M;Rhiel, M;Andrieux, G;Geiger, J;Rudolph, C;Mussolino, C;Duclert, A;Metzner, KJ;Duchateau, P;Cathomen, T;Cornu, TI;Preclinical Evaluation of a Novel TALEN Targeting CCR5 Confirms Efficacy and Safety in Conferring Resistance to HIV-1 InfectionBiotechnology journal33103367and data analyzed with CRISPResso2.[49] p values were adjusted with the Benjamini & Hochberg[50] method. For OCA, 1 × 106 PBMCs (ALLCELLS, USA)/mL in X-Vivo15 medium (Lonza), supplemented with 5% human AB serum (Gemini, USA) and 20 ng mL−1 of IL-2 (MFull Paper
2021Kitanaga, Y;Yamajuku, D;Kubo, S;Nakamura, K;Maeda, M;Seki, M;Kaneko, Y;Kinugasa, F;Morokata, T;Kondo, Y;Yoshinari, H;Nakayamada, S;Sumida, T;Tanaka, Y;Discovery of a novel Igβ and FcγRIIB cross-linking antibody, ASP2713, and its potential application in the treatment of systemic lupus erythematosusInternational immunopharmacology34781122Human peripheral blood mononuclear cells (PBMCs; Lonza, Basel, Switzerland) and normal human peripheral blood B cells (AllCells, CA, USA) were purchased. Whole blood samples were obtained from healthy subjects and patients with SLE at the UniversityFull Paper
2021Chen, YL;Cui, Y;Liu, X;Liu, G;Dong, X;Tang, L;Hung, Y;Wang, C;Feng, MQ;A bispecific antibody targeting HER2 and PD-L1 inhibits tumor growth with superior efficacyThe Journal of biological chemistry34798072man IgG (H + L) was obtained from Jackson ImmunoResearch. Monocyte purification kit was obtained from Miltenyi Biotec. Ficoll gradient was obtained from GE healthcare. Human PBMCs were obtained from Allcells. Humanization of anti-PD-L1 mAb by framewFull Paper
2021Langrish, CL;Bradshaw, JM;Francesco, MR;Owens, TD;Xing, Y;Shu, J;LaStant, J;Bisconte, A;Outerbridge, C;White, SD;Hill, RJ;Brameld, KA;Goldstein, DM;Nunn, PA;Preclinical Efficacy and Anti-Inflammatory Mechanisms of Action of the Bruton Tyrosine Kinase Inhibitor Rilzabrutinib for Immune-Mediated DiseaseJournal of immunology (Baltimore, Md. : 1950)33674445Human whole blood from healthy donors was purchased from AllCells and assayed for rilzabrutinib inhibition of IgE basophil activation. Whole blood was treated with ten 3-fold dilutions SaveFull Paper
2021Andrejeva, G;Capoccia, BJ;Hiebsch, RR;Donio, MJ;Darwech, IM;Puro, RJ;Pereira, DS;Novel SIRPα Antibodies That Induce Single-Agent Phagocytosis of Tumor Cells while Preserving T CellsJournal of immunology (Baltimore, Md. : 1950)33431660were differentiated from CD14+ monocytes purchased from Astarte Biologics or selected using Pan Monocyte Isolation Kit (Miltenyi Biotec) from PBMCs (AllCells and Hemacare). Monocytes were seeded onto 96-well, flat-bottom plates at 3 × 104 cells per wFull Paper
2021Chaerkady, R;Zhou, Y;Delmar, JA;Weng, SHS;Wang, J;Awasthi, S;Sims, D;Bowen, MA;Yu, W;Cazares, LH;Sims, GP;Hess, S;Characterization of Citrullination Sites in Neutrophils and Mast Cells Activated by Ionomycin via Integration of Mass Spectrometry and Machine LearningJournal of proteome research34008986For mast cell preparation, three donors were used. Briefly, leukocytes were collected from Leukopak (ALLCells) and mixed with Robo II Buffer (StemCell Technologies) at 1:4 and centrifuged at 500g for 15 mins. The pellet was resuspended in 1× VitalyseFull Paper
2021Deng, M;Wu, D;Zhang, Y;Jin, Z;Miao, J;MiR-29c downregulates tumor-expressed B7-H3 to mediate the antitumor NK-cell functions in ovarian cancerGynecologic oncology33875234The human CD56 + NK cells were obtained from ALLCELLS (Emeryville, California) and were confirmed by flow cytometric analyses. NK cells were maintained in Human NK cell SaveFull Paper
2021Friedman, D;Dozor, AJ;Milner, J;D'Souza, M;Talano, JA;Moore, TB;Shenoy, S;Shi, Q;Walters, MC;Vichinsky, E;Parsons, SK;Braniecki, S;Moorthy, CR;Ayello, J;Flower, A;Morris, E;Mahanti, H;Fabricatore, S;Klejmont, L;van de Ven, C;Baxter-Lowe, LA;Cairo, MS;Stable to improved cardiac and pulmonary function in children with high-risk sickle cell disease following haploidentical stem cell transplantationBone marrow transplantation33958740Bioverativ, Sangamo, Veevo, Editas Medicine and is medical director for AllCells, Inc. Biosciences. SKP is a consultant to Seattle Genetics, also unrelated to this study. EV is a consultant for ApoPharma, on the advisory committee for Global Blood ThFull Paper
2021Song, D;Liu, X;Dong, C;Wang, Q;Sha, C;Liu, C;Ning, Z;Han, J;Liu, H;Zong, M;Zhao, Y;Li, Y;Liu, G;Shao, X;Dou, C;Two novel human anti-CD25 antibodies with antitumor activity inversely related to their affinity and in vitro activityScientific reports34824364The effector cells PBMCs (PB003F-C, ALLCELLS) were added and the mixture was incubated at 37 C for 5 h. After substrate was added, OD490 value was read on the microplate Save;The effector cells PBMCs (PB003F-C, ALLCELLS) were added and the mixtureFull Paper
2021Loo, J;Sicher, I;Goff, A;Kim, O;Clary, N;Alexeev, A;Sulchek, T;Zamarayeva, A;Han, S;Calero-Garcia, M;Microfluidic transfection of mRNA into human primary lymphocytes and hematopoietic stem and progenitor cells using ultra-fast physical deformationsScientific reports34725429Mobilized peripheral blood CD34-selected hematopoietic stem and progenitor cells (mPB CD34 + HSPCs, purchased from AllCells) were taken from liquid nitrogen freezer and placed SaveFull Paper
2021Wang, X;Negrou, E;Maloney, MT;Bondar, VV;Andrews, SV;Montalban, M;Llapashtica, C;Maciuca, R;Nguyen, H;Solanoy, H;Arguello, A;Przybyla, L;Moerke, NJ;Huntwork-Rodriguez, S;Henry, AG;Understanding LRRK2 kinase activity in preclinical models and human subjects through quantitative analysis of LRRK2 and pT73 Rab10Scientific reports34145320University of Dundee (https://mrcppureagents.dundee.ac.uk/). For the total Rab10 assay, recombinant Rab10 protein (LSBio, LS-G2178) and Rab8 protein (LS-G29310) were used. Human cryopreserved PBMCs (AllCells, PB005F) were thawed and cultured in RPMIFull Paper
2021Xue, X;De Leon-Tabaldo, A;Luna-Roman, R;Castro, G;Albers, M;Schoetens, F;DePrimo, S;Devineni, D;Wilde, T;Goldberg, S;Kinzel, O;Hoffmann, T;Fourie, AM;Thurmond, RL;Preclinical and clinical characterization of the RORγt inhibitor JNJ-61803534Scientific reports34040108mentary materials and methods). Human nTreg suppressive assay Frozen purified human CD4+CD25+ natural Treg cells (nTreg), monocyte-derived dendritic cells (DC) and CD4+CD25- T effector cells (Teff) (Allcells, LLC, Alameda, CA) were thawed and co-culFull Paper
2021Harris, KE;Lorentsen, KJ;Malik-Chaudhry, HK;Loughlin, K;Basappa, HM;Hartstein, S;Ahmil, G;Allen, NS;Avanzino, BC;Balasubramani, A;Boudreau, AA;Chang, K;Cuturi, MC;Davison, LM;Ho, DM;Iyer, S;Rangaswamy, US;Sankaran, P;Schellenberger, U;Buelow, R;Trinklein, ND;A bispecific antibody agonist of the IL-2 heterodimeric receptor preferentially promotes in vivo expansion of CD8 and NK cellsScientific reports34011961resuspended in 125 µL/well flow buffer and acquired on a BD FACSCelesta. Whole blood cytokine release assay Cytokine secretion was detected using fresh human whole blood (heparinized) obtained from AllCells. The following method was adapted from B.Full Paper
2021Tago, Y;Kobayashi, C;Ogura, M;Wada, J;Yamaguchi, S;Yamaguchi, T;Hayashi, M;Nakaishi, T;Kubo, H;Ueda, Y;Human amnion-derived mesenchymal stem cells attenuate xenogeneic graft-versus-host disease by preventing T cell activation and proliferationScientific reports33510297Human BMSC from healthy donors were purchased from AllCells (CA, USA). The culture conditions of AMSC and BMSC (ie, MSC) were determined based on previous studies 43 . In SaveFull Paper
2021Subhi, H;Husein, A;Mohamad, D;Nik Abdul Ghani, NR;Nurul, AA;Chitosan-Based Accelerated Portland Cement Promotes Dentinogenic/Osteogenic Differentiation and Mineralization Activity of SHEDPolymers34641172SHED employed in this study were obtained from ALLCELLS, USA (Catalog No. DP004F; lot number SHED092211-01). Upon being received, the cells were characterized using stem SaveFull Paper
2021Kim, OH;Park, JH;Son, JI;Yoon, OJ;Lee, HJ;Bone Marrow Mesenchymal Stromal Cells on Silk Fibroin Scaffolds to Attenuate Polymicrobial Sepsis Induced by Cecal Ligation and PuncturePolymers33946773y (FE-SEM; JSM 7500F, JEOL Ltd., Akishima, Tokyo, Japan). 2.3. MSC Preparation Human bone marrow MSCs were derived from the whole bone marrow of independent human donors (commercially available from AllCells, Alameda, CA, USA). The cells were culturFull Paper
2021Wang, X;Sandberg, ML;Martin, AD;Negri, KR;Gabrelow, GB;Nampe, DP;Wu, ML;McElvain, ME;Toledo Warshaviak, D;Lee, WH;Oh, J;Daris, ME;Chai, F;Yao, C;Furney, J;Pigott, C;Kamb, A;Xu, H;Potent, Selective CARs as Potential T-Cell Therapeutics for HPV-positive CancersJournal of immunotherapy (Hagerstown, Md. : 1997)34432728For human peripheral blood mononuclear cells (PBMCs), collection protocols and donor informed-consent were approved by an Institutional Review Board at Allcells. Allcells followed SaveFull Paper
2021Martin, AD;Wang, X;Sandberg, ML;Negri, KR;Wu, ML;Toledo Warshaviak, D;Gabrelow, GB;McElvain, ME;Lee, B;Daris, ME;Xu, H;Kamb, A;Re-examination of MAGE-A3 as a T-cell Therapeutic TargetJournal of immunotherapy (Hagerstown, Md. : 1997)33284140purchased from Allcells according to the method described by Garcia et al31 Collection protocols and donor informed-consent were approved by an institutional review board at Allcells. SaveFull Paper
2021Xu, F;Liu, X;Zhang, D;Zhao, F;Fan, Z;Hu, S;Mei, S;Huang, Y;Sun, H;Wei, L;Guo, L;Wang, J;Cen, S;Liang, C;Guo, F;The Engineered MARCH8-Resistant Vesicular Stomatitis Virus Glycoprotein Enhances Lentiviral Vector TransductionHuman gene therapy33678011Peripheral blood mononuclear cells (PBMCs) isolated from healthy donors were purchased from AllCells (Shanghai, China), and cultured in RPMI 1640 media containing 10% FBS ( SaveFull Paper
2021Chen, Z;Chen, Z;Xu, S;Zhang, Q;LncRNA SOX2-OT/miR-30d-5p/PDK1 Regulates PD-L1 Checkpoint Through the mTOR Signaling Pathway to Promote Non-small Cell Lung Cancer Progression and Immune EscapeFrontiers in GeneticsThe microporous 2-compartment co-culture system was applied for co-culture. Transfected NSCLC cells were inoculated in the upper chamber, while CD8+ T (PB009-3-C, ALLCELLS, Shanghai) cells were inoculated in the lower chamber, allowing direct contactFull Paper
2021Raskin, S;Van Pelt, S;Toner, K;Balakrishnan, PB;Dave, H;Bollard, CM;Yvon, E;Novel TCR-like CAR-T cells targeting an HLA∗0201-restricted SSX2 epitope display strong activity against acute myeloid leukemiaMolecular therapy. Methods & clinical development34729377Steady-state apheresis units were purchased from AllCells and peripheral blood mononuclear cells (PBMCs) were isolated using lymphoprep density gradient. Before cryopreserving Save;ng a phase I clinical trial to evaluate the safety and anti-tumor eFull Paper
2021Xue, L;Gao, X;Zhang, H;Tang, J;Wang, Q;Li, F;Li, X;Yu, X;Lu, Z;Huang, Y;Tang, R;Yang, W;Antiangiogenic antibody BD0801 combined with immune checkpoint inhibitors achieves synergistic antitumor activity and affects the tumor microenvironmentBMC cancer34686154#0025), 1% penicillin/streptomycin (GIBCO, Invitrogen Inc., Carlsbad, CA, USA, #15140-122) and 1% ECGS (ScienCell, #1052). For HUVEC Western blot, migration inhibition, and scratch assays, HUVECs (AllCells, Alameda, CA, USA) were maintained in HUVECFull Paper
2021Noaks, E;Peticone, C;Kotsopoulou, E;Bracewell, DG;Enriching leukapheresis improves T cell activation and transduction efficiency during CAR T processingMolecular therapy. Methods & clinical development33718517Peripheral blood leukapheresis products were obtained from the NHS or purchased as LeukoPaks from AllCells, Cellex, and Anthony Nolan as part of research study NREC ID 15/LO/ Save;omplex and expensive magnetic cell sorting. Materials and methods CuFull Paper
2021Green, R;Elliott, JL;Norona, W;Go, F;Nguyen, VT;Ge, J;Short, ML;Mulero, JJ;Zhong, C;Developmental validation of VeriFiler™ Plus PCR Amplification Kit: A 6-dye multiplex assay designed for casework samplesForensic science international. Genetics33740707Human genomic DNA used for the degraded DNA experiments was extracted from normal peripheral blood mononuclear cells (PBMC) of a male donor (ALLCELLS, Emeryville, CA) using a QiAamp DNA Blood Maxi Kit (Qiagen)Full Paper
2021Park, S;Huang, NWY;Wong, CXY;Pan, J;Albakr, L;Gu, J;Kang, L;Microstructured Hyaluronic Acid Hydrogel for Tooth Germ BioengineeringGels (Basel, Switzerland)34449604ovine serum (Thermo Fisher, Waltham, MA, USA), penicillin-Streptomycin solution with 10,000 units penicillin and 10 mg streptomycin / mL (Thermo Fisher, Waltham, MA, USA). The culture media for DPSC (AllCells, Alameda, CA, USA) were α-Minimum essentiFull Paper
2021Garbuzova-Davis, S;Boccio, KJ;Llauget, A;Shell, R;Hailu, S;Mustafa, H;Ehrhart, J;Sanberg, PR;Appel, SH;Borlongan, CV;Beneficial Effects of Transplanted Human Bone Marrow Endothelial Progenitors on Functional and Cellular Components of Blood-Spinal Cord Barrier in ALS MiceeNeuro34479980Cryopreserved human bone marrow CD34+ cells (hBM34+) and human bone marrow-derived endothelial progenitor cells (hBM-EPCs) were purchased from AllCells and CELPROGEN SaveFull Paper
2021Chu, J;Pieles, O;Pfeifer, CG;Alt, V;Morsczeck, C;Docheva, D;Dental follicle cell differentiation towards periodontal ligament-like tissue in a self-assembly three-dimensional organoid modelEuropean cells & materials34251657according to AllCells company regulations, further donor information such gender and exact age was not provided to the purchaser). The PDL-hTERT immortal cell line has already SaveFull Paper
2021Madanagopal, TT;Tai, YK;Lim, SH;Fong, CH;Cao, T;Rosa, V;Franco-Obregón, A;Pulsed electromagnetic fields synergize with graphene to enhance dental pulp stem cell-derived neurogenesis by selectively targeting TRPC1 channelsEuropean cells & materials33644848hDPSC culture The use of human cells was approved by the NUS Institutional Review Board (NUS2094/2015). hDPSC (DPF003, AllCells, Quincy, MA, USA) were cultured in basal growth medium (DMEM, Invitrogen), supplemented with 10 % FBS (Invitrogen) in theFull Paper
2021Wang, X;Martin, AD;Negri, KR;McElvain, ME;Oh, J;Wu, ML;Lee, WH;Ando, Y;Gabrelow, GB;Toledo Warshaviak, D;Sandberg, ML;Xu, H;Kamb, A;Extensive functional comparisons between chimeric antigen receptors and T cell receptors highlight fundamental similaritiesMolecular immunology34419823Collection protocols and donor informed consent were approved by an Institutional Review Board (IRB) at Allcells . Allcells also followed HIPAA compliance and approved protocols SaveFull Paper
2021Zacharia, A;Harberts, E;Valencia, SM;Myers, B;Sanders, C;Jain, A;Larson, NR;Middaugh, CR;Picking, WD;Difilippantonio, S;Kirnbauer, R;Roden, RB;Pinto, LA;Shoemaker, RH;Ernst, RK;Marshall, JD;Optimization of RG1-VLP vaccine performance in mice with novel TLR4 agonistsVaccine33309485cells were also cultured in the presence of BECC470 or TLR4 agonists and the resulting upregulation of surface co-stimulatory markers was measured by flow cytometry (AllCells). SaveFull Paper
2021Liu, C;Yang, G;Zhou, M;Zhang, X;Wu, X;Wu, P;Gu, X;Jiang, X;Magnesium Ammonium Phosphate Composite Cell-Laden Hydrogel Promotes Osteogenesis and Angiogenesis In VitroACS omega33869925Human umbilical vein endothelial cells (HUVECs; eahy926) were purchased from AllCells and cultured in EBM. They were seeded in the upper chamber, while the lower chambers SaveFull Paper
2021Jangjoo, M;Goodman, SJ;Choufani, S;Trost, B;Scherer, SW;Kelley, E;Ayub, M;Nicolson, R;Georgiades, S;Crosbie, J;Schachar, R;Anagnostou, E;Grunebaum, E;Weksberg, R;An Epigenetically Distinct Subset of Children With Autism Spectrum Disorder Resulting From Differences in Blood Cell CompositionFrontiers in neurology33935932ed, B cell, CD4T, CD8T, monocyte, granulocytes, and NK. These blood cell types were those on which the Houseman method was originally trained, using peripheral blood leukocyte subtypes purchased from AllCells , LLC (Emeryville, CA) or sorted cells frFull Paper
2021Zhou, N;Chen, Y;Yang, L;Xu, T;Wang, F;Chen, L;Liu, J;Liu, G;LncRNA SNHG4 promotes malignant biological behaviors and immune escape of colorectal cancer cells by regulating the miR-144-3p/MET axisAmerican journal of translational research34786048The transfected CACO2 cells were co-cultured with CD4+ T cells (PB009-2-C, AllCells Biotechnology Co., Ltd., Shanghai, China), followed by the addition of PD-1 antibody (ab52587, Abcam, UK) and PD-L1 antibody (ab205921, Abcam, UK). CD4+ T cell isolatFull Paper
2021Horton, TM;Hoff, FW;van Dijk, A;Jenkins, GN;Morrison, D;Bhatla, T;Hogan, L;Romanos-Sirakis, E;Meyer, J;Carroll, WL;Qiu, Y;Wang, T;Mo, Q;Kornblau, SM;The effects of sample handling on proteomics assessed by reverse phase protein arrays (RPPA): Functional proteomic profiling in leukemiaJournal of proteomics33212251Normalization controls were commercially available normal adult CD34+ bone marrow cells (AllCells). Peripheral blood mononuclear cells (PBMC) were isolated using Lymphoprep SaveFull Paper
2021Khouri, J;Faiman, BM;Grabowski, D;Mahfouz, RZ;Khan, SN;Wei, W;Valent, J;Dean, R;Samaras, C;Jha, BK;Lazarus, H;Campagnaro, EL;Malek, E;Reed, J;Karam, MA;Hamilton, K;Fada, S;Kalaycio, M;Liu, H;Sobecks, R;Saunthararajah, Y;Chew, Y;Orloff, M;Reu, FJ;DNA methylation inhibition in myeloma: Experience from a phase 1b study of low-dose continuous azacitidine in combination with lenalidomide and low-dose dexamethasone in relapsed or refractory multiple myelomaSeminars in hematology33509443Normal bone marrow mononuclear cells for separation of CD138 positive and negative fractions of 3 healthy donors was obtained commercially from ALLCELLS and processed the SaveFull Paper
2021Schölzel, C;Blesius, V;Ernst, G;Goesmann, A;Dominik, A;Countering reproducibility issues in mathematical models with software engineering techniques: A case study using a one-dimensional mathematical model of the atrioventricular nodePloS one34280231This means that the release version of the AllCells model is not only executable in OpenModelica, but also in any of the over 100 tools that support the Functional Mock-up Interface (FMI SaveFull Paper
2021Dulay, RM;Valdez, BC;Li, Y;Chakrabarti, S;Dhillon, B;Kalaw, SP;Reyes, RG;Cabrera, EC;Cytotoxicity of Gymnopilus purpureosquamulosus extracts on hematologic malignant cells through activation of the SAPK/JNK signaling pathwayPloS one34048499esuspended in freezing medium (50% heat-inactivated fetal bovine serum, 40% RPMI, 10% DMSO), and cryopreserved in liquid nitrogen until used. Mononuclear cells from healthy donors were purchased from ALLCELLS LLC (Almeda, CA, USA). For extract exposuFull Paper
2021Caplan, HW;Prabhakara, KS;Toledano Furman, NE;Zorofchian, S;Martin, C;Xue, H;Olson, SD;Cox, CS;Human-derived Treg and MSC combination therapy may augment immunosuppressive potency in vitro, but did not improve blood brain barrier integrity in an experimental rat traumatic brain injury modelPloS one34038436Bone marrow-derived MSC were isolated from a commercially available fresh human bone marrow aspirate (AllCells, Alameda, CA) and expanded following established procedures [8, SaveFull Paper
2021Baik, R;Wyman, SK;Kabir, S;Corn, JE;Genome editing to model and reverse a prevalent mutation associated with myeloproliferative neoplasmsPloS one33661998Frozen human mobilized peripheral blood CD34+ HSPCs were purchased from AllCells and thawed according to manufacturer's instructions. CD34+ cells were cultured in StemSpan SaveFull Paper
2021Garbuzova-Davis, S;Boccio, KJ;Ehrhart, J;Sanberg, PR;Appel, SH;Borlongan, CV;Detection of endothelial cell-associated human DNA reveals transplanted human bone marrow stem cell engraftment into CNS capillaries of ALS miceBrain research bulletin33545308Cryopreserved human bone marrow CD34+ cells (hBM34+) and human bone marrow-derived endothelial progenitor cells (hBM-EPCs) were purchased from AllCells (Alameda, CA, USA) and CELPROGEN (Torrance, CA, USA), respectively. According to the company reporFull Paper
2021Montalban-Bravo, G;Darbaniyan, F;Kanagal-Shamanna, R;Ganan-Gomez, I;Class, CA;Sasaki, K;Naqvi, K;Wei, Y;Yang, H;Soltysiak, KA;Chien, KS;Bueso-Ramos, C;Do, KA;Kantarjian, H;Garcia-Manero, G;Type I interferon upregulation and deregulation of genes involved in monopoiesis in chronic myelomonocytic leukemiaLeukemia research33517186BM samples from healthy individuals were obtained from AllCells (Emeryville, CA). Informed consent was obtained according to protocols approved by the MDACC institutional review SaveFull Paper
2021Lu, J;Collins, P;Lee, KJ;Li, CM;Wang, S;In vitro assessment of an engineered tBID-based safety switch system in human T lymphocytesAnnals of translational medicine34988150n 12-well plate and incubated the plate in incubator at 37 °C. Human T-cell samples were purchased anonymously from the vendor and considered exempt from IRB approval. The frozen human pan-T cells (AllCells, LLC., Cat# S-ISO004-06) were thawed and cFull Paper
2021Maucort, C;Di Giorgio, A;Azoulay, S;Duca, M;Differentiation of Cancer Stem Cells by Using Synthetic Small Molecules: Toward New Therapeutic Strategies against Therapy ResistanceChemMedChem32803855In an analogous work, it was found that ICG-001 could safely eradicate the drug-resistant CSC-like population and initiate cell differentiation in leukemia (pre-B ALLcells). The same SaveFull Paper
2021Hu, J;Zhang, J;Yu, M;Liu, Z;Zou, Y;Hong, L;Zhang, T;Sun, J;Zheng, M;Zhu, X;Wang, Z;Liu, S;Circulating miR-221/222 reduces CD4+ T cells by inhibiting CD4 expression in colorectal cancerActa biochimica et biophysica Sinica34357372Peripheral blood mononuclear cells (PBMCs) were purchased from ALLCELLS (PB005F; Shanghai, China). PBMCs were incubated with DynaBeads (11141D; Gibco, Carlsbad, USA), and CD3+ T cells were isolated in a magnet by binding to DynaBeads containing anti-Full Paper
2021Yang, Y;Wang, C;Dai, C;Liu, X;Li, W;Huang, M;Zhao, X;Ji, D;Li, J;Guo, W;Amplification and expression of c-MET correlate with poor prognosis of patients with gastric cancer and upregulate the expression of PDL1Acta biochimica et biophysica Sinica33693450The prognostic significance of c-MET in gastric cancer (GC) remains uncertain. In the present study, we examined the amplification, expression, and the prognostic value of c-MET, SaveFull Paper
2021Thorarensen, A;Balbo, P;Banker, ME;Czerwinski, RM;Kuhn, M;Maurer, TS;Telliez, JB;Vincent, F;Wittwer, AJ;The advantages of describing covalent inhibitor in vitro potencies by IC50 at a fixed time point. IC50 determination of covalent inhibitors provides meaningful data to medicinal chemistry for SAR optimizationBioorganic & medicinal chemistry33285410Cryopreserved human PBMCs (Catalog No. PB005F), which were used in the IL-2, IL-10, IL-15, and IFNα assays, were purchased from Allcells (Emeryville, CA). Frozen PBMCs were thawed in a water bath (37 °C), and washed once with RPMI1640 medium (CatalogFull Paper
2021Jiang, J;Li, X;Mao, F;Wu, X;Chen, Y;Small molecular fluorescence dyes for immuno cell analysisAnalytical biochemistry33306976Statement of Ethical Use of Human Samples: All human PBMCs used in this study were obtained from AllCells Alameda, 1301 Harbor Bay Parkway, Suite 200, Alameda, CA 94502, Save;h as leukemia; and provide a quick and efficient way to study the immuneFull Paper
2021Takahashi, N;Higa, A;Hiyama, G;Tamura, H;Hoshi, H;Dobashi, Y;Katahira, K;Ishihara, H;Takagi, K;Goda, K;Okabe, N;Muto, S;Suzuki, H;Shimomura, K;Watanabe, S;Takagi, M;Construction of in vitro patient-derived tumor models to evaluate anticancer agents and cancer immunotherapyOncology letters33841567patient, were used in this study. Patient-derived hematopoietic tumor cells were provided by Fukushima Medical University Hospital, the Japanese Pediatric Cancer Group ALL-R14 study, ProteoGenex, or AllCells. Peripheral blood mononuclear cells (PBMCsFull Paper
2021Yoshida, K;Takabayashi, T;Imoto, Y;Sakashita, M;Kato, Y;Narita, N;Fujieda, S;Increased Thrombin-Activatable Fibrinolysis Inhibitor in Response to Sublingual Immunotherapy for Allergic RhinitisThe Laryngoscope33844301Systems, Minneapolis, Minnesota ), 100 ng IL-13 (R&D Systems), 100 ng IL-4 plus 1 μg/mL TAFI (Abcam, Cambridge, UK), and 100 ng IL-13 with 1 μg/mL TAFI. Human mast cells were differentiated from CD34+ hematopoietic progenitor cells (ALLCELLS, AlamedFull Paper
2021Hashim, SNM;Yusof, MFH;Zahari, W;Noordin, KBAA;Akamatsu, T;Azlina, A;Amniotic membrane matrix effects on calcineurin-NFAT-related gene expressions of SHED treated with VEGF for endothelial differentiationIn vitro cellular & developmental biology. Animal34021476SHED (AllCells, Alameda, California) were cultured in a complete medium made of the Minimum Essential Medium (MEM) Alpha Medium (α-MEM) (Gibco, Waltham, Massachusetts), supplemented with 15% of fetal bovine serum (FBS) (Gibco, Waltham, Massachusetts)Full Paper
2021Pieles, O;Hartmann, M;Morsczeck, C;AMP-activated protein kinase and the down-stream activated process of autophagy regulate the osteogenic differentiation of human dental follicle cellsArchives of oral biology332540472.1. Cell culture Human dental follicle cells were purchased from AllCells and cultivated in DMEM (Dulbecco’s Modified Eagle’s Medium) high glucose with 10 % FBS (fetal bovine serum) and 1% penicillin (10,000 units/mL) / streptomycin (10 mg/mL) solutFull Paper
2021Wang, Z;Jiang, L;Wang, J;Chai, Z;Xiong, W;Morphine promotes angiogenesis by activating PI3K/Akt/HIF-1α pathway and upregulating VEGF in hepatocellular carcinomaJournal of gastrointestinal oncology34532126Academy of Science (Shanghai, China). The cells were cultured in 10% FBS DMEM, 37 °C, 5% CO2 incubator. HUVECs were obtained from the Allcells Company(Shanghai, China) and cultured in 10% FBS Endothelial Cell Growth Medium (ECM, Lonza, Switzerland),Full Paper
2021Hayashi, Y;Kawaki, H;Hori, M;Shintani, K;Hasegawa, T;Tanaka, M;Kondoh, N;Yoshida, T;Kawano, S;Tamaki, Y;Evaluation of the mechanical properties and biocompatibility of gypsum-containing calcium silicate cementsDental materials journal33642445Evaluation of the cytotoxicity of cement-immersed media Samples of hDPSCs (Allcells, Emeryville, CA, USA), which had been subcultured 11-14 times in 10% fetal bovine serum (FBS)-containing α-MEM, were seeded within a 96-well plate at a density of 4,0Full Paper
2021Iwasa, M;Fujii, S;Fujishiro, A;Maekawa, T;Andoh, A;Takaori-Kondo, A;Ichinohe, T;Miura, Y;Impact of 2 Gy γ-irradiation on the hallmark characteristics of human bone marrow-derived MSCsInternational journal of hematology33386593Bone marrow of multiple healthy adults aged 21-44 years (#4362, #4615, and #4641) was purchased from AllCells (Emeryville, CA). Human BM-MSCs were isolated from bone marrow according to our previously published methods [12, 13]. In brief, a single-ceFull Paper
2021Cui, L;Yin, F;Cheng, J;Liu, H;Zheng, M;Liu, D;Wu, Z;Qian, Q;Optimized cytotoxicity assay for co-suspended effector and target cellsJournal of immunological methods34270976Peripheral blood mononuclear cells (PBMCs) obtained from whole blood of healthy volunteers (AllCells, Silicon Valley, CA, USA) were isolated by density gradient centrifugation with SaveFull Paper
2021Sunderic, K;Li, C;Ahmed, AHR;Dawkins, D;Azar, T;Cardoso, L;Wang, S;Tuning Thermal Dosage to Facilitate Mesenchymal Stem Cell Osteogenesis in Pro-Inflammatory EnvironmentJournal of biomechanical engineering32601701Human bone marrow explanted from the iliac crest of donors was purchased from AllCells, LLC (Berkeley, CA). Human mesenchymal stem cells were enriched using the RosetteSep SaveFull Paper
2021Koh, H;Kwon, SY;Zhen, X;Ha, HY;Lee, JH;Generation of induced pluripotent stem cell line (KRIBBi004-A) from adult bone marrow CD34+ cells from a patient carrying 46,XX,t(1;5)(p31.1;35.1) karyotypeStem cell research34736040Cell Source iPSC was derived from CD34+ bone marrow (BM) cells, obtained from AllCells, LLC Clonality Clonal Associated disease N/A Gene/locus Chromosome translocation t(1;5)(p31.1;35.1) Date archived/stock date Jun.2021 Cell line repository/bank TheFull Paper
2021Kim, J;Koh, H;Zhen, X;Lee, DS;Ha, HY;Lee, JH;Establishment of iPSC (KRIBBi001-A) from CD34+ group O D-negative bone marrow bloodStem cell research33529979Cell Source iPSC was derived from CD34+ bone marrow (BM) cells, obtained from AllCells, LLC Clonality Clonal Method of reprogramming Integration-free Sendai virus-based vectors (CytoTune™-iPS 2.0 Sendai Reprogramming Kit, Life Technologies)Full Paper
2021Fu, X;Shen, X;Yin, X;Zhang, Y;Wang, X;Han, Z;Lin, Q;Fan, J;Antioxidant and pro-apoptosis activities of coffee husk (Coffea arabica) anthocyaninsInternational Food Research JournalThe HUVEC and Caco-2 cell lines were purchased from ALLCELLS Biotechnology Company (Shanghai, China) and Kunming Institute of Zoology Cell Line Bank (Yunnan, China), respectively. Dulbecco’s Modified Eagle’s Medium (DMEM), foetal bovine serum, peniciFull Paper
2021Choi, J;Goulding, SP;Conn, BP;McGann, CD;Dietze, JL;Kohler, J;Lenkala, D;Boudot, A;Rothenberg, DA;Turcott, PJ;Srouji, JR;Foley, KC;Rooney, MS;van Buuren, MM;Gaynor, RB;Abelin, JG;Addona, TA;Juneja, VR;Systematic discovery and validation of T cell targets directed against oncogenic KRAS mutationsCell reports methods35474673(HLA-A∗03:01, HLA-A∗11:01, HLA-A∗68:01, HLA-B∗07:02, HLA-C∗01:02, HLA-C∗03:04, and/or HLA-C∗08:02) were isolated using Ficoll separation from apheresis material (AllCells Save;130-050-201; RRID:AB_2665482 CD25 MicroBeads, human Miltenyi BiotecFull Paper
2021Cai, W;Dong, J;Gallolu Kankanamalage, S;Titong, A;Shi, J;Jia, Z;Wang, B;Huang, C;Zhang, J;Lin, J;Kan, SZ;Han, S;Zhou, J;Liu, Y;Biological activity validation of a computationally designed Rituximab/CD3 T cell engager targeting CD20+ cancers with multiple mechanisms of actionAntibody therapeutics34805746They were cultured in RPMI 1640 (Thermo fisher) medium supplemented with 10% fetal bovine serum (FBS) (GIBCO) at 37 °C, 5% CO2. Human peripheral blood mononuclear cells (hPBMC) were purchased from AllCells (Alameda, CA) and HumanCells Bio (San Jose,Full Paper
2021Moe, GR;Steirer, LM;Lee, JA;Shivakumar, A;Bolanos, AD;A cancer-unique glycan: de-N-acetyl polysialic acid (dPSA) linked to cell surface nucleolin depends on re-expression of the fetal polysialyltransferase ST8SIA2 geneJournal of experimental & clinical cancer research : CR34544457rting (FACS) binding, and fluorescence labeling experiments were treated with Accutase and washed with medium before use. Human normal peripheral blood mononuclear cells (PBMCs) were purchased from AllCells (Alameda, CA). Protein extraction from ceFull Paper
2021Xing, Y;Chu, KA;Wadhwa, J;Chen, W;Zhu, J;Bradshaw, JM;Shu, J;Foulke, MC;Loewenstein, N;Nunn, P;By, K;Phiasivongsa, P;Goldstein, DM;Langrish, CL;Preclinical Mechanisms of Topical PRN473, a Bruton Tyrosine Kinase Inhibitor, in Immune-Mediated Skin Disease ModelsImmunoHorizons34326199Human whole blood (AllCells) pretreated for 1 h with eleven 3-fold serial dilutions of PRN473, starting at a concentration of 10 μM, was incubated overnight with goat anti-human IgM F( SaveFull Paper
2021Pohlmeyer, CW;Shang, C;Han, P;Cui, ZH;Jones, RM;Clarke, AS;Murray, BP;Lopez, DA;Newstrom, DW;Inzunza, MD;Matzkies, FG;Currie, KS;Di Paolo, JA;Characterization of the mechanism of action of lanraplenib, a novel spleen tyrosine kinase inhibitor, in models of lupus nephritisBMC rheumatology33781343healthy donors or individuals with SLE (AllCells) were treated with lanraplenib or dimethyl Naive B cells were isolated from freshly collected PBMCs (AllCells) by negative selection ( SaveFull Paper
2021Nordin, NS;Mokhtar, KI;Mustafa, BE;Effects of Flaxseed (Linum usitatissimum) Extract on the Osteoblast Differentiation Potential of Stem Cells Derived from Human Exfoliated Deciduous TeethMakara Journal of Health ResearchSHED (ALLCells, USA) were cultured in complete growth media (alpha-MEM; 10% FBS; 0.5% Pen-Strep) until confluence. SHED at 80%-90% confluence were subjected to osteoblast differentiation. The complete growth medium was replaced with osteoblast inductFull Paper
2021Turkson, A;Addor, J;Kharib, D;Validating Intrinsic Factors Informing E-Commerce: Categorical Data Analysis DemoOpen Journal of Statisticsows a chi-square distribution, and the conclusion depends on whether or not the obtained statistic is greater that the critical statistic at a chosen alpha level. The test statistics is: χ 2 = ∑ allcells ( Observed − Expected ) 2 Expected = ∑ i , jFull Paper
2021Xu, Y;Shen, L;Li, G;The The Effect of Elution Volume for Immunoprecipitation on m6A-Seq AnalysisProceedings of Anticancer ResearchThe Mouse Renal Carcinoma cells (RenCa) were cultured in DMEM medium (Invitrogen) containing 10% FBS, 2 mM L-Glutamine and 1% penicillin-streptomycin. RenCa cell line was purchased from Allcells Biotechnology (Shanghai, China) and were routinely testFull Paper
2021Zhou, Z;Zheng, J;Lin, D;Chen, Y;Hu, X;Exosomes Derived from Dental Pulp Stem Cells Accelerate Cutaneous wound Healing by Enhancing Angiogenesis via Cdc42/p38 MAPK PathwayResearch Square1% penicillin-streptomycin (Sigma, USA). HUVECs were bought from ALLCELLS (Shanghai, China) and expanded in endothelial cell growth medium (EGM). For exosome co-cultures experiment, 10μg/ml of exosomes were added to the culture medium of HUVECs. AllFull Paper
2021Blitzer, G;Paz, C;Glassey, A;Ganz, O;Giri, J;Pennati, A;Meyers, R;Lunga, T;Robbins, D;Thibeault, S;Bates, A;Nickel, K;Morris, Z;Mattison, R;Chappell, R;Glazer, T;Rogus-Pulia, N;Galipeau, J;Kimple, R;A Pilot Study to Assess the Salivary Gland Regenerative Potential of Bone Marrow Mesenchymal Stromal Cells from Treated Head and Neck Cancer PatientsResearch SquareBone marrow from healthy adult control volunteers were purchased from a commercial source (AllCells, Alameda, CA). We had originally planned to enroll 15 patients: 5 patients with SaveFull Paper
2021Tie, B;Guo, Z;Li, L;Wang, W;Liu, R;Fang, J;miR-3156-5p Enhances Hypoxia-Induced Angiogenesis in Hepatocellular Carcinoma via Modulating the SOCS5/HIF-1α/VEGF PathwayResearch SquareHuman umbilical vein endothelial cells (HUVECs) were purchased from Allcells (Shanghai, China) and cultured in the medium containing 50 U/mL penicillin and 50 U/mL streptomycin (Invitgen, San Diego, CA), 50 mL endothelial cell growth additive (UpstatFull Paper
2021Chen, S;Barrientos, J;Ferrer, G;Ravichandran, P;Ibrahim, M;Kieso, Y;Kutok, J;Peluso, M;Sharma, S;Weaver, D;Pachter, J;Rai, K;Chiorazzi, N;Duvelisib Eliminates CLL B Cells, Impairs CLL-Supporting Cells, and Overcomes Ibrutinib Resistance in Preclinical ModelsResearch SquareHuman PBMCs from CLL donors obtained from whole blood from a commercial source (Bioreclamation IVT or ALLCELLS) were resuspended (1 x 106 cells/mL) in RPMI-1640 medium SaveFull Paper
2021Valadkhan, S;Plasek, L;Gunawardane, L;Niazi, F;Mason, S;Leskov, K;Perez, G;Dobrowolski, C;Shukla, M;Nutt, W;Karn, J;An HIV-induced mechanism for T cell quiescence andproviral latencyResearch SquarePeripheral blood mononuclear cells from HIV negative Caucasian male donors were purchased from Allcells. Naive CD4+ T cells were isolated using EasySep Human Naive CD4+ T SaveFull Paper
2021Cai, W;Dong, J;Kankanamalage, S;Titong, A;Shi, J;Jia, Z;Wang, B;Huang, C;Zhang, J;Lin, J;Kan, S;Zhou, J;Liu, Y;A computationally designed Rituximab/CD3 T cell engager targeting CD20+ cancers with multiple mechanisms of actionResearch Squaremedium supplemented with 10% fetal bovine serum (FBS) (GIBCO) 115 at 37°C, 5% CO2. Human peripheral blood mononuclear cells (hPBMC) were purchased from 116 AllCells (Alameda, CA) and HumanCells Bio (San Jose, CA). Rituximab resistant Raji cells 117 (Full Paper
2021Zhao, C;Zhang, W;Gong, G;Xie, L;Wang, M;Hu, Y;A New Approach to Produce IgG4-like Bispecific AntibodiesResearch SquareHuman CD4+ T cells were purified from PBMC (AllCells, China) by negative selection with CD4+ T cell enrichment cocktail kit (Stemcell, Vancouver, Canada) according to the manufacturer’s instruction. Immature DC (iDC) was generated from monocytes by cFull Paper
2021Noto, P;Analysis of Liver X Receptor target gene expression across speciesDrexel UniversitycDNA from Human MTC™ Panels I and II were purchased from Clontech (catalog# 636742 and 636743) and subjected to real-time PCR. Whole blood from human donors was purchased from AllCells (catalog# WB001)Full Paper
2021Dunbar, A;Kim, D;Lu, M;Farina, M;Yang, J;Park, Y;Gobbo, F;Verachi, P;Martelli, F;Karzai, A;Xiao, W;Xia, L;Elmansy, N;Kleppe, M;Chen, Z;Xiao, Y;McGovern, E;Snyder, J;Krishnan, A;Hill, C;Cordner, K;Zouak, A;Salama, M;Yohai, J;Tucker, E;Chen, J;Zhou, J;McConnell, T;Koche, R;Rampal, R;Migliaccio, A;Fan, R;Levine, R;Hoffman, R;CXCL8/CXCR2 signaling mediates bone marrow fibrosis and represents a therapeutic target in myelofibrosisbioRxivPro-inflammatory signaling is a hallmark feature of human cancer, including in myeloproliferative neoplasms (MPNs), most notably myelofibrosis (MF). Dysregulated inflammatory SaveFull Paper
2021Kartha, V;Duarte, F;Hu, Y;Ma, S;Chew, J;Lareau, C;Earl, A;Burkett, Z;Kohlway, A;Lebofsky, R;Buenrostro, J;Functional Inference of Gene Regulation using Single-Cell Multi-OmicsbioRxivCD4+, CD8+, CD14+, CD19+ and CD56+ cells were purchased from AllCells (see Table S1 for catalog numbers and donor information). Cells were quickly thawed in a 37°C water bath, rinsed with culture medium (Iscove’s ModifiedFull Paper
2021Kong, T;Laranjeira, A;Yang, K;Fisher, D;Yu, L;Wang, A;Ruzinova, M;Fowles, J;Allen, M;Celik, H;Challen, G;Huang, S;Oh, S;DUSP6 mediates resistance to JAK2 inhibition and drives leukemic progressionbioRxivgradient extraction and cryopreserved according to standard procedures. Additional BMMCs were purchased from AllCells (Alameda, California). A list of patient samples utilized in this study is provided in Table 1Full Paper
2021Qi, J;D’Souza, D;Dawson, T;Geanon, D;Stefanos, H;Marvin, R;Walker, L;Rahman, A;Multimodal Single-Cell Characterization of the Human Granulocyte LineagebioRxivFresh whole bone marrow was purchased from AllCells Inc. and delivered on the day of the experiment. The bone marrow was in a volume of 3mL and the sample was limited to 2 units/ SaveFull Paper
2021Kim, J;Schulte, A;Sarver, A;Angelos, M;Frantz, A;Forster, C;O’Brien, T;Cornax, I;O’Sullivan, M;Cheng, N;Lewellen, M;Oseth, L;Kumar, S;Bullman, S;Pedamallu, C;Goyal, S;Meyerson, M;Lund, T;Alfoldi, J;Breen, M;Lindblad-Toh, K;Dickerson, E;Kaufman, D;Modiano, J;Transcriptional and Functional Activity of Hemangiosarcoma Support Bone Marrow Nurse Cell OntogenybioRxivHuman BM-derived mesenchymal stromal cells (hBM-MSCs) were isolated from whole bone marrow purchased from AllCells (Emeryville, CA, USA) as previously described [24-27]. M2- SaveFull Paper
2021Maughon, T;Shen, X;Huang, D;Michael, A;Shockey, W;Andrews, S;McRae, J;Platt, M;Fernández, F;Edison, A;Stice, S;Marklein, R;Multi-omics characterization of mesenchymal stem/stromal cells for the identification of putative critical quality attributesbioRxivPBMCs (AllCells, Alameda CA) were thawed in RPMI media (RPMI, 20% FBS, 2mM L-glutamine, 50 U/mL penicillin, 50 μg/mL streptomycin) and cultured overnight at 37°C and 5% CO2. Prior to co-culture, PBMCs were labeled with CFSE (Supplemental Table 1, BioFull Paper
2021Jain, S;Rick, J;Joshi, R;Beniwal, A;Spatz, J;Chang, A;Nguyen, A;Sudhir, S;Chandra, A;Haddad, A;Wadhwa, H;Shah, S;Choi, S;Hayes, J;Wang, L;Yagnik, G;Costello, J;Diaz, A;Aghi, M;Identification of Cancer-Associated Fibroblasts in Glioblastoma and Defining Their Pro-tumoral EffectsbioRxivTHP-1 cells and monocytes isolated from peripheral blood (AllCells) run through the MojoSort Human CD14 Selection Kit were treated with 50 ng/μL PMA (phorbol myristate acetate) SaveFull Paper
2021Andrews, S;Klinker, M;Bauer, S;Marklein, R;Morphological Landscapes from High Content Imaging Identify Optimal Priming Strategies that Enhance MSC ImmunosuppressionbioRxivHuman bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville, CA, USA), and RoosterBio (Frederick, MD, USA) (see Table S1 for donor information). MSC culture conditions for thFull Paper
2021Gu, C;Cao, X;Wang, Z;Hu, X;Yao, Y;Zhou, Y;Liu, P;Liu, X;Gao, G;Hu, X;Zhang, Y;Chen, Z;Gao, L;Peng, Y;Jia, F;Shan, C;Yu, L;Liu, K;Li, N;Guo, W;Jiang, G;Min, J;Zhang, J;Yang, L;Shi, M;Hou, T;Li, Y;Liang, W;Lu, G;Yang, C;Wang, Y;Xia, K;Xiao, Z;Xue, J;Huang, X;Chen, X;Ma, H;Song, D;Pan, Z;Wang, X;Guo, H;Liang, H;Yuan, Z;Guan, W;Deng, S;A human antibody with blocking activity to RBD proteins of multiple SARS-CoV-2 variants including B.1.351 showed potent prophylactic and therapeutic efficacy against SARS-CoV-2 in rhesus macaquesbioRxivPhage libraries were constructed using antibody gene fragments amplified from PBMCs of 50 healthy human subjects (Allcells, PB003F and PB003C) and total RNA from PBMCs ( SaveFull Paper
2021Fitzgerald, A;Marcisak, E;Nasir, A;Glasgow, E;Jablonski, S;Van Der Veken, P;Pearson, G;Fertig, E;Mace, E;Weiner, L;Fibroblast activation protein regulates natural killer cell migration, extravasation and tumor infiltrationbioRxivfrom AllCells with either CD56 positive selection or CD56 negative selection (Allcells, cat# T cells, B cells and monocytes were isolated from PBMCs (Allcells) using Mojosort magnetic SaveFull Paper
2021Brooks, J;Preclinical Dynamic Contrast Enhanced Imaging for Longitudinal Biophysical Assessments of the Healthy and Malignant Vasculature after RadiotherapyThesisC57BL/6J mice (Strain 000664, Jackson Laboratory, Bar Harbor, ME) mice were injected with 1x106 GFP+ BCR-ABL (p190Kd) expressing B-cell ALLcells [66], suspended in 200 µl of phosphate buffered saline, through the tail vein. To test drug delivery, injFull Paper
2021O'Connor, EI;Mechanisms Behind the Causal Role of Dietary Oxylipins of the Lipoxygenase Pathway in the Development of Pulmonary Arterial HypertensionThesisPAECs were incubated with or without 15-HETE and 12 hours later healthy CD8 cells (ALLCELLS, Lot# 3003028) were added. After 12 hours of contact between EC and CD8 cells, the cells were collected, fixed, and stained for cleaved caspase 3Full Paper
2021McIntyre, P;The Effects of a Pyk2 Kinase Inhibitor on the Proliferation and Differentiation of Human Dental Pulp Stem CellsThesisCommercially available human DPSCs, collected from the pulp of extracted teeth, have been previously purchased from ALLCells and stored in liquid nitrogen (Alameda, CA, USA). • SaveFull Paper
2021Noaks, E;Enhancing the consistency of donor derived peripheral blood mononuclear cells for CAR T-cell manufacturingThesisFor work completed at the company site healthy peripheral blood leukapheresis were obtained from the NHS or purchased as LeukoPaks from AllCells, Cellex and Anthony Nolan, as part of research study NREC ID 15/LO/1322. Experiments using healthy leukapFull Paper
2021Osman, ZF;Zahari, W;Kannan, TP;Ultrastructure changes in BMP-2-treated SHED cultured on glycerol preserved human amniotic membraneActa MicroscópicaommerciallysourcedSHED(AllCells,USA)wasculturedonde-epithelialized2cmx2cmglycerol-preserved γ-radiated AM in a culture dish containing 3 mlof media at different cell density for the respective days asthefollowing;2x105forday1,5x104forday7,2.5x104Full Paper
2021Luecken, MD;Burkhardt, DB;Cannoodt, R;A sandbox for prediction and integration of dna, rna, and proteins in single cellsConferenceWe sourced multiple samples of BMMCs from 10 donors via AllCells (California, USA), all healthy non-smokers without recent medical treatment. Donors varied by age (22 - 40), sex, SaveFull Paper
2021Vladimirova, T;Implementation and Evaluation of Verlet List-based Methods in AutoPasThesisInside the 2D vector for AllCells or 3D vector for CellPair respectively, the method adds the particle indices corresponding to the particle pointers from the same spot in the AoS neighbor SaveFull Paper
2021Maser, IP;In-depth characterization of myeloid enhanced humanized mouse strainsThesiswas diluted with 0.9% sodium chloride (Braun) and 15 mg/kg was intraperitoneally (i.p.) injected into mice. 24 hours later 1×105 human CD34+ umbilical cord blood-derived hematopoietic stem cells (HSCs) (Stem Cell Technologies/Allcells) in 100 µl phosFull Paper
2021Fitzgerald, AA;Enhancing Anti-Cancer Properties of Human Natural Killer CellsThesisFresh healthy donor NK cells were purchased from AllCells with either CD56 positive selection or CD56 negative selection (Allcells, cat#PB012-P or PB012-N). T cells, B cells and monocytes were isolated from PBMCs (Allcells) using Mojosort magnetic ceFull Paper
2021Butler, A;Computational Methods for the Integration of Single-Cell DataThesisWe therefore repeated the original experiment, where PBMCs from a healthy human donor (ALLCELLS) were cultured with RPMI medium supplemented with 10% FBS and stimulated for 6 h with IFNβ (100 U/ml, PBL Assay Science), with a subset of cells left unexFull Paper
2021Nataraja, S;Singh, M;Demes, S;Olson, L;Stanwix, J;Biddle, M;Clarke, E;Huang, Y;Nguyen, J;Chen, C;Zhang, P;Abdulla, F;Vercellotti, G;Belcher, J;ML-0207/ASP8731: A Novel BACH1 Inhibitor That Induces Fetal Hemoglobin in Treatment of Sickle Cell DiseaseBloodTranslational Development, Mitobridge, Cambridge, MA++Translational Science, Mitobridge, Cambridge, MA++Clinical Pharmacology and Exploratory Development, Astellas, Northbrook, IL++Translational Science, Mitobridge, Cambridge, MA++Translational ScienFull Paper
2021Qing, Y;Dong, L;Gao, L;Li, C;Li, Y;Han, L;Prince, E;Tan, B;Deng, X;Wetzel, C;Shen, C;Gao, M;Chen, Z;Li, W;Zhang, B;Braas, D;Ten Hoeve, J;Sanchez, GJ;Chen, H;Chan, LN;Chen, CW;Ann, D;Jiang, L;Müschen, M;Marcucci, G;Plas, DR;Li, Z;Su, R;Chen, J;R-2-hydroxyglutarate attenuates aerobic glycolysis in leukemia by targeting the FTO/m6A/PFKP/LDHB axisMolecular cell33434505The Lin− progenitor cells were then subject to retroviral transduction with MSCV-Neo-MA9 construct by two rounds of ‘spinoculation’, as described previously (Li et al., 2015). After being selected for 7 days with 0.5 mg/mL G418 Sulfate (10131027, GibFull Paper
2021Li, C;Wang, H;Georgakopoulou, A;Gil, S;Yannaki, E;Lieber, A;In Vivo HSC Gene Therapy Using a Bi-modular HDAd5/35++ Vector Cures Sickle Cell Disease in a Mouse ModelMolecular therapy : the journal of the American Society of Gene Therapy32949495The lineage-minus (Lin−) cells were isolated by depletion of lineage-committed cells in bone marrow MNCs using the Mouse Lineage Cell Depletion Kit (Miltenyi Biotec, San Diego, CA, USA) according to the manufacturer’s instructions. CFU assays were peFull Paper
2021Loftus, JP;Yahiaoui, A;Brown, PA;Niswander, LM;Bagashev, A;Wang, M;Schauf, A;Tannheimer, S;Tasian, SK;Combinatorial efficacy of entospletinib and chemotherapy in patient-derived xenograft models of infant acute lymphoblastic leukemiaHaematologica32414848s Supplementary Appendix Acknowledgments We acknowledge Dr Ann Forslund and Ms Chelsea Mullins formerly at Gilead Sciences for study protocol management and data analysis, and Dr Emer Clarke at ReachBio Research Labs for assistance with experimFull Paper
2021DiLillo, DJ;Olson, K;Mohrs, K;Meagher, TC;Bray, K;Sineshchekova, O;Startz, T;Kuhnert, J;Retter, MW;Godin, S;Sharma, P;Delfino, F;Lin, J;Smith, E;Thurston, G;Kirshner, JR;A BCMAxCD3 bispecific T cell-engaging antibody demonstrates robust antitumor efficacy similar to that of anti-BCMA CAR T cellsBlood advances33651100T cells were purified from normal donor PBMCs (ReachBio) by using magnetic beads (Thermo Fisher Scientific) and activated with CD3/CD28 microbeads (Thermo Fisher Scientific) in SaveFull Paper
2021Byrgazov, K;Besse, A;Kraus, M;Slipicevic, A;Lehmann, F;Driessen, C;Besse, L;Novel Peptide-drug Conjugate Melflufen Efficiently Eradicates Bortezomib-resistant Multiple Myeloma Cells Including Tumor-initiating Myeloma Progenitor CellsHemaSphere34136753of MM were assessed in a semisolid methylcellulose-based media formulation containing 10% phytohemagglutinin (PHA)-stimulated leukocyte conditioned medium (ReachBio, WA). Save;cell outgrowth assay Clonogenic progenitors of MM were assessed in a semFull Paper
2021Swaminathan, M;Kopyt, N;Atta, MG;Radhakrishnan, J;Umanath, K;Nguyen, S;O'Rourke, B;Allen, A;Vaninov, N;Tilles, A;LaPointe, E;Blair, A;Gemmiti, C;Miller, B;Parekkadan, B;Barcia, RN;Pharmacological effects of ex vivo mesenchymal stem cell immunotherapy in patients with acute kidney injury and underlying systemic inflammationStem cells translational medicine34581517Flow cytometry testing of patient leukocytes was performed by ReachBio (Spokane, Washington). Blood was collected in CPT tubes (362 753; BD Biosciences), and peripheral blood Save;n a plasma preparation tube (362 788; BD Biosciences, San Jose, CaliFull Paper
2021Lin, M;Kowolik, CM;Xie, J;Yadav, S;Overman, LE;Horne, DA;Potent Anticancer Effects of Epidithiodiketopiperazine NT1721 in Cutaneous T Cell LymphomaCancers34282785TCC (Manassas, VA, USA), authenticated by STR-profiling at the source and passaged for less than 6 months after receipt or resuscitation. Peripheral blood mononuclear cells (PBMCs) were obtained from ReachBio (Spokane, WA, USA). All cells were grownFull Paper
2021Samuelson, C;Radtke, S;Zhu, H;Llewellyn, M;Fields, E;Cook, S;Huang, MW;Jerome, KR;Kiem, HP;Humbert, O;Multiplex CRISPR/Cas9 genome editing in hematopoietic stem cells for fetal hemoglobin reinduction generates chromosomal translocationsMolecular therapy. Methods & clinical development34853798cation event frequencies was also undertaken on each of these tissues from necropsy as per protocol above. CFU and HbF assays on mouse BM A total of 7 × 104/mL cells were plated in ColonyGEL 1402 (ReachBio, Seattle, WA) in triplicate from each mouseFull Paper
2021Sharifi, S;Sharifi, H;Akbari, A;Chodosh, J;Systematic optimization of visible light-induced crosslinking conditions of gelatin methacryloyl (GelMA)Scientific reports34857867and exposed to photoirradiation for a 4 and 10 min. Those cell-laden gels were immediately washed 3 times with PBS and incubated in 200 μL of an optimized serum-containing medium (catalog # 02,100, Reachbio lab, Spokane, WA) at 37 °C. Cell viabilityFull Paper
2021Haber, L;Olson, K;Kelly, MP;Crawford, A;DiLillo, DJ;Tavaré, R;Ullman, E;Mao, S;Canova, L;Sineshchekova, O;Finney, J;Pawashe, A;Patel, S;McKay, R;Rizvi, S;Damko, E;Chiu, D;Vazzana, K;Ram, P;Mohrs, K;D'Orvilliers, A;Xiao, J;Makonnen, S;Hickey, C;Arnold, C;Giurleo, J;Chen, YP;Thwaites, C;Dudgeon, D;Bray, K;Rafique, A;Huang, T;Delfino, F;Hermann, A;Kirshner, JR;Retter, MW;Babb, R;MacDonald, D;Chen, G;Olson, WC;Thurston, G;Davis, S;Lin, JC;Smith, E;Generation of T-cell-redirecting bispecific antibodies with differentiated profiles of cytokine release and biodistribution by CD3 affinity tuningScientific reports34257348ce with the ARRIVE guidelines. OVCAR-3 bioluminescence imaging (BLI) study Eight-week-old NOD SCID gamma chain knock-out (NSG) mice (Jackson Laboratory) were injected with 5 × 106 human PBMCs (ReachBio) before 1 × 106 ascites cells from the OVCAR-3/Full Paper
2021Patterson, AM;Sellamuthu, R;Plett, PA;Sampson, CH;Chua, HL;Fisher, A;Vemula, S;Feng, H;Katz, BP;Tudor, G;Miller, SJ;MacVittie, TJ;Booth, C;Orschell, CM;Establishing Pediatric Mouse Models of the Hematopoietic Acute Radiation Syndrome and the Delayed Effects of Acute Radiation ExposureRadiation research33577641elsewhere (47). Hematopoietic progenitor cell (HPC) number and function were quantitated from 1.0 × 10e5 low-density bone marrow (LDBM) in 1 ml ColonyGEL™ Mouse Complete Medium (ReachBio Research Labs, Seattle, WA)Full Paper
2021Rethnam, M;Tan, DQ;Suda, T;Myeloma cells self-promote migration by regulating TAB1-driven TIMP-1 expression in mesenchymal stem cellsBiochemical and biophysical research communications33183761Human BM MSCs (#02100, ReachBio) were grown in DMEM low glucose media (Biowest) supplemented with 10% FBS and 1% Antibiotic/Anti-mycotic (Gibco). Cells were passaged upon confluence and cultured at a density of 4.5 × 103 cells/cm2. U266-B1 (TIB-196,Full Paper
2021Andersen, A;Vieira-Brock, PL;Vaughan, B;Vollmer, D;Method development for the analysis of PBMC-mediated killing of K562 cells by bovine colostrumJournal of immunological methods34744024Declaration of Competing Interest Authors and principle investigators are employed by 4Life Research, which sells the test articles commercially. 4Life Research funded all portions of this study. Acknowledgements All testing was performed at ReachBiFull Paper
2021Radtke, S;Enstrom, M;Pande, D;Cui, M;Madhu, R;Perez, A;Kiem, H;Hematopoietic recovery after transplantation is primarily derived from the stochastic contribution of hematopoietic stem cellsbioRxivFor CFC assays, 800-1,200 sort-purified CD34+ cells and CD34-subpopulations were seeded into 3.5 ml ColonyGEL 1402 (ReachBio, Seattle, WA). Colonies were scored after 12 to 14 days, discriminating colony forming unit- (CFU-) granulocyte (CFU-G), macrFull Paper
2020Geoerger, B;Kang, HJ;Yalon-Oren, M;Marshall, LV;Vezina, C;Pappo, A;Laetsch, TW;Petrilli, AS;Ebinger, M;Toporski, J;Glade-Bender, J;Nicholls, W;Fox, E;DuBois, SG;Macy, ME;Cohn, SL;Pathiraja, K;Diede, SJ;Ebbinghaus, S;Pinto, N;Pembrolizumab in paediatric patients with advanced melanoma or a PD-L1-positive, advanced, relapsed, or refractory solid tumour or lymphoma (KEYNOTE-051): interim analysis of an open-label, single-arm, phase 1–2 trialLancet Oncol.31812554In all patients, baseline PD-L1 expression in tumour samples (positivity defined as any staining of the stroma or PD-L1 expression on at least 1% of tumour cells) was assessed centrally at QualTek Molecular Laboratories (Goleta, CA, USA) using a protFull Paper
2020Emens, LA;Esteva, FJ;Beresford, M;Saura, C;De Laurentiis, M;Kim, SB;Im, SA;Wang, Y;Salgado, R;Mani, A;Shah, J;Lambertini, C;Liu, H;de Haas, SL;Patre, M;Loi, S;Trastuzumab emtansine plus atezolizumab versus trastuzumab emtansine plus placebo in previously treated, HER2-positive advanced breast cancer (KATE2): a phase 2, multicentre, randomised, double-blind trialThe Lancet. Oncology33002436The KATE2 study is a randomised, double-blind, placebo-controlled, phase 2 trial at 68 centres from nine countries across Asia, Australia, North America, and western Europe (appendix pp 13–15). Eligible patients were adults (aged ≥18 years) with centFull Paper
2020Powell, SF;Gold, KA;Gitau, MM;Sumey, CJ;Lohr, MM;McGraw, SC;Nowak, RK;Jensen, AW;Blanchard, MJ;Fischer, CD;Bykowski, J;Ellison, CA;Black, LJ;Thompson, PA;Callejas-Valera, JL;Lee, JH;Cohen, EEW;Spanos, WC;Safety and Efficacy of Pembrolizumab With Chemoradiotherapy in Locally Advanced Head and Neck Squamous Cell Carcinoma: A Phase IB StudyJ. Clin. Oncol.32479189Testing was performed centrally by QualTek Laboratories (Santa Barbara, CA) using the PD-L1 IHC 22C3 pharmDx (Dako North America, Carpinteria, CA) IHC assay as previously described. 25 PD-L1 evaluation was performed using the combined proportional scFull Paper
2020Marabelle, A;Cassier, P;Fakih, M;Kao, S;Nielsen, D;Italiano, A;Guren, T;Dongen, M;Spencer, K;Bariani, G;Ascierto, P;Santoro, A;Hiret, S;Ott, P;Piha-Paul, S;Liu, C;Leiby, M;Norwood, K;Delord, J;Pembrolizumab for previously treated advanced anal squamous cell carcinoma: Pooled results from the KEYNOTE-028 and KEYNOTE-158 studies.JCOPD-L1 positivity). Baseline PD-L1 expression was assessed using a prototype IHC assay (QualTek) in KEYNOTE-028 and the PD-L1 IHC 22C3 pharmDx assay (Agilent Technologies) in KEYNOTE-158. Pts received pembroFull Paper
2020Greenstein, A;Munster, P;Sachdev, J;Fleming, G;Grauer, A;Shepherd, S;Impact of relacorilant, a selective glucocorticoid receptor antagonist, on the immunosuppressive effects of endogenous cortisol.JCOTina K. Schlafly of Corcept Therapeutics. Funding for editorial, design, and production support for this poster was provided by Corcept to MedVal Scientific Information Services, LLC, Princeton, NJ. Experiments were conducted at Ardigen SA, QualTek MFull Paper
2020Dudek, AZ;Liu, LC;Gupta, S;Logan, TF;Singer, EA;Joshi, M;Zakharia, YN;Lang, JM;Schwarz, JK;Al-Janadi, A;Alva, AS;Phase Ib/II Clinical Trial of Pembrolizumab With Bevacizumab for Metastatic Renal Cell Carcinoma: BTCRC-GU14-003J. Clin. Oncol.32097091Events (CTCAE; version 4.0). Exploratory Studies. Expression of PD-L1 in archived diagnostic tumor tissue was determined by immunohistochemistry (IHC) using a 22C3 antibody (Qualtek Electronics, Newton, PA). Both a modified ;logy Criteria for AdFull Paper
2020Tolaney, SM;Barroso-Sousa, R;Keenan, T;Li, T;Trippa, L;Vaz-Luis, I;Wulf, G;Spring, L;Sinclair, NF;Andrews, C;Pittenger, J;Richardson, ET;Dillon, D;Lin, NU;Overmoyer, B;Partridge, AH;Van Allen, E;Mittendorf, EA;Winer, EP;Krop, IE;Effect of Eribulin With or Without Pembrolizumab on Progression-Free Survival for Patients With Hormone Receptor-Positive, ERBB2-Negative Metastatic Breast Cancer: A Randomized Clinical TrialJAMA oncology32880602A total of 65 patients (74%) had PD-L1 testing assessed centrally by QualTek using the 22C3 antibody, and results were reported as a modified pro- portion score (MPS), defined as the proportion of cells, includ- ing both tumor and mononuclear inflammFull Paper
2020Zsiros, E;Lynam, S;Attwood, KM;Wang, C;Chilakapati, S;Gomez, EC;Liu, S;Akers, S;Lele, S;Frederick, PJ;Odunsi, K;Efficacy and Safety of Pembrolizumab in Combination With Bevacizumab and Oral Metronomic Cyclophosphamide in the Treatment of Recurrent Ovarian Cancer: A Phase 2 Nonrandomized Clinical TrialJAMA oncology33211063A modified proportion score threshold of at least 1% using the 22C3 antibody (QualTekMolecular Laboratories) was adopted similarly to previously described protocols.6Full Paper
2020Jabbour, SK;Berman, AT;Decker, RH;Lin, Y;Feigenberg, SJ;Gettinger, SN;Aggarwal, C;Langer, CJ;Simone, CB;Bradley, JD;Aisner, J;Malhotra, J;Phase 1 Trial of Pembrolizumab Administered Concurrently With Chemoradiotherapy for Locally Advanced Non-Small Cell Lung Cancer: A Nonrandomized Controlled TrialJAMA Oncol32077891Exploratory analyses included PD-L1 status, by mean proportion score. Immunohistochemical staining for PD-L1 used a mouse monoclonal anti-PD-L1 antibody (clone 22C3).21 Furthermore, TILs were scored on a continuum from 0 to 3 (0 indicates absent TILsFull Paper
2020Kelly, CM;Antonescu, CR;Bowler, T;Munhoz, R;Chi, P;Dickson, MA;Gounder, MM;Keohan, ML;Movva, S;Dholakia, R;Ahmad, H;Biniakewitz, M;Condy, M;Phelan, H;Callahan, M;Wong, P;Singer, S;Ariyan, C;Bartlett, EK;Crago, A;Yoon, S;Hwang, S;Erinjeri, JP;Qin, LX;Tap, WD;D'Angelo, SP;Objective Response Rate Among Patients With Locally Advanced or Metastatic Sarcoma Treated With Talimogene Laherparepvec in Combination With Pembrolizumab: A Phase 2 Clinical TrialJAMA Oncol31971541Paraffin-embedded tumor material taken before and after treatment was examined for TIL immune biomarker expression, including PD-L1, PD-1, CD3, CD4, FOXP3, CD8, CD68, CD163, and MHC1 by Qualtek Laboratory. Programmed death-ligand 1 tumor membranous eFull Paper
2020Mancuso, F;Ogbah, Z;Fasani, R;Lo Giacco, D;Ramos, L;Oaknin, A;Alsina, M;Elez, E;Mercade, T;Saura, C;Capdevila, J;Vieito, M;Felip, E;Dienstmann, R;Gros, A;Seoane, J;Nuciforo, P;Tabernero, J;Garralda, E;Vivancos, A;581P VHIO immune gene expression profiling (VIGex) panel, a tool to explore tumour immune microenvironmentAnnals of Oncologyself), Speaker Bureau/Expert testimony, Research grant/Funding (self), Travel/Accommodation/ Expenses: Novartis; Honoraria (self), Speaker Bureau/Expert testimony, Research grant/Funding (self), Travel/Accommodation/Expenses: Targos Molecular PatholoFull Paper
2020Jotte, R;Cappuzzo, F;Vynnychenko, I;Stroyakovskiy, D;Rodríguez-Abreu, D;Hussein, M;Soo, R;Conter, HJ;Kozuki, T;Huang, KC;Graupner, V;Sun, SW;Hoang, T;Jessop, H;McCleland, M;Ballinger, M;Sandler, A;Socinski, MA;Atezolizumab in Combination With Carboplatin and Nab-Paclitaxel in Advanced Squamous NSCLC (IMpower131): Results From a Randomized Phase III TrialJ Thorac Oncol32302702Skip to Main Content ;This work was supported by F. Hoffmann-La Roche Ltd/Genentech, Inc., a member of the Roche Group. The authors would like to acknowledge Targos Molecular Pathology GmbH (Kassel, Germany) for performing central PD-L1 and T-efFull Paper
2020M.C.Liu, G.R.Oxnard, E.A.Klein, C.Swanton, M.V.SeidenSensitive and specific multi-cancer detection and localization using methylation signatures in cell-free DNAAnnals of OncologyBackground: Early cancer detection could identify tumors at a time when outcomes are superior and treatment is less morbid. This prospective case-control sub-study (from NCT02889978 and NCT03085888) assessed the performance of targeted methylation anFull Paper
2020Taylor, WC;Comment on "Sensitive and specific multi-cancer detection and localization using methylation signatures in cell-free DNA"" by M. C. Liu et al"Ann. Oncol.32371122cfDNA [n = 2628 (1493 cancer; 1135 non-cancer)], formalin fixed paraffin embedded (FFPE) tumor biopsies (n = 242), and WBCs (n = 70) from the first CCGA sub-study; commercial tissue or cells [n = 227; Discovery Life Sciences (formerly Conversant BiolFull Paper
2020Draz, MS;Vasan, A;Muthupandian, A;Kanakasabapathy, MK;Thirumalaraju, P;Sreeram, A;Krishnakumar, S;Yogesh, V;Lin, W;Yu, XG;Chung, RT;Shafiee, H;Virus detection using nanoparticles and deep neural network-enabled smartphone systemScience advances33328239Deidentified HCV-infected and HBV-infected patient plasma/ serum samples were obtained from Discovery Life Sciences IncFull Paper
2020Chung, HC;Piha-Paul, SA;Lopez-Martin, J;Schellens, JHM;Kao, S;Miller, WH;Delord, JP;Gao, B;Planchard, D;Gottfried, M;Zer, A;Jalal, SI;Penel, N;Mehnert, JM;Matos, I;Bennouna, J;Kim, DW;Xu, L;Krishnan, S;Norwood, K;Ott, PA;Pembrolizumab After Two or More Lines of Previous Therapy in Patients With Recurrent or Metastatic SCLC: Results From the KEYNOTE-028 and KEYNOTE-158 StudiesJ Thorac Oncol31870883In KEYNOTE-028, tumor samples were assessed using a laboratory-developed prototype immunohistochemistry assay (QualTek Molecular Laboratories, Goleta, CA) with the 22C3 antibody clone (Merck Sharp & Dohme Corp., a subsidiary of Merck & Co., Inc., KenFull Paper
2020Freeman, ZT;Nirschl, TR;Hovelson, DH;Johnston, RJ;Engelhardt, JJ;Selby, MJ;Kochel, CM;Lan, RY;Zhai, J;Ghasemzadeh, A;Gupta, A;Skaist, AM;Wheelan, SJ;Jiang, H;Pearson, AT;Snyder, LA;Korman, AJ;Tomlins, SA;Yegnasubramanian, S;Drake, CG;A conserved intratumoral regulatory T cell signature identifies 4-1BB as a pan-cancer targetJ. Clin. Invest.32015231Study approval. All human tumors were collected with approval from the Johns Hopkins University IRB with the following protocol IDs: renal clear cell carcinoma (IRB00033839), prostate cancer (NA_00082175), bladder cancer (NA_00026693), and glioblastoFull Paper
2020Weiss, J;Sheth, S;Deal, AM;Grilley Olson, JE;Patel, S;Hackman, TG;Blumberg, JM;Galloway, T;Patel, S;Zanation, AM;Shen, CJ;Hayes, DN;Hilliard, C;Mehra, R;McKinnon, KP;Wang, HH;Weissler, MC;Bauman, JR;Chera, BS;Vincent, BG;Concurrent definitive immunoradiotherapy for patients with Stage III-IV Head and Neck Cancer and Cisplatin contraindicationClin. Cancer Res.32371539withdrawal of permission. Correlative Analysis PDL1 staining was conducted by Qualtek Molecular Laboratories (Newtown, PA) as previously described 5 and required by Merck in supported investigator initiated trials. For bothFull Paper
2020Graff, JN;Beer, TM;Alumkal, JJ;Slottke, RE;Redmond, WL;Thomas, GV;Thompson, RF;Wood, MA;Koguchi, Y;Chen, Y;Latour, E;Bergan, RC;Drake, CG;Moran, AE;A phase II single-arm study of pembrolizumab with enzalutamide in men with metastatic castration-resistant prostate cancer progressing on enzalutamide aloneJ Immunother Cancer32616555retained. Formalin-fixed, paraffin-embedded tumor samples were sent to a commercial vendor (Qualtek) for PD-L1 quantification by immunohistochemistry (clone 22C3). Additional methods details are described elsewhere.30Full Paper
2020Majd, N;Waguespack, S;Janku, F;Fu, S;Penas-Prado, M;Xu, M;Alshawa, A;Kamiya-Matsuoka, C;Raza, S;McCutcheon, I;Naing, A;Efficacy of pembrolizumab in patients with pituitary carcinoma: report of four cases from a phase II studyJournal for ImmunoTherapy of CancerPD-L1 staining was performed by Qualtek using Merck 22C3 antibody for PD-L1Full Paper
2020Lokeshwar, VB;Morera, DS;Hasanali, SL;Yates, TJ;Hupe, MC;Knapp, J;Lokeshwar, SD;Wang, J;Hennig, MJP;Baskar, R;Escudero, DO;Racine, RR;Dhir, N;Jordan, AR;Hoye, K;Azih, I;Manoharan, M;Klaassen, Z;Kavuri, S;Lopez, LE;Ghosh, S;Lokeshwar, BL;A Novel Splice Variant of HYAL-4 Drives Malignant Transformation and Predicts Outcome in Patients with Bladder CancerClin. Cancer Res.32094233Present address: Travis Yates: QualTek Molecular Laboratories, King of Prussia, PA; Diogo Escudero: George Washington University Kelly Hoye: University of North Carolina Lineberger Comprehensive Cancer Center; Ronny Racine: Astellas Institute for RegFull Paper
2020Fong, LY;Taccioli, C;Palamarchuk, A;Tagliazucchi, GM;Jing, R;Smalley, KJ;Fan, S;Altemus, J;Fiehn, O;Huebner, K;Farber, JL;Croce, CM;Abrogation of esophageal carcinoma development in miR-31 knockout ratsProc. Natl. Acad. Sci. U.S.A.32123074lia isolated using the DNeasy Blood & Tissue Kit (Qiagen). WGS. DNA library preparation, library quality control, and nonhuman WGS to yield ∼30× coverage were performed on the Illumina HiSeq X at HudsonAlpha Genomic Services Laboratory. WGS AnalysiFull Paper
2020Rodriguez, CP;Wu, QV;Voutsinas, J;Fromm, JR;Jiang, X;Pillarisetty, VG;Lee, SM;Santana-Davila, R;Goulart, B;Baik, CS;Chow, LQM;Eaton, K;Martins, R;A Phase II Trial of Pembrolizumab and Vorinostat in Recurrent Metastatic Head and Neck Squamous Cell Carcinomas and Salivary Gland CancerClin. Cancer Res.31796519Submission of archived tissue was required prior to study entry. In patient with no available archived tissue, fresh tissue biopsies were recommended. Biopsies were attempted after three cycles of therapy were completed, in patients who consented. PDFull Paper
2020Huetter, J;Gritzan, U;Gutcher, I;Doecke, WD;Luetke-Eversloh, MV;Golfier, S;Roider, HG;Frisk, AL;Hunter, J;Pow, A;Drake, A;Levine, Z;Levy, O;Azulay, M;Barbiro, I;Cojocaru, G;Vaknin, I;Kreft, B;Roese, L;Characterization of BAY 1905254, an immune checkpoint inhibitor targeting the immunoglobulin-like domain containing receptor 2 (ILDR2)Cancer Immunol Res32312711cancer patients, and commercially available cryopreserved human lymph node single- cell preparations from melanoma patients (Folio Conversant, USA) using the PrimeFlow™ RNA Assay technology (Invitrogen, CA, USA). Following enzymaticFull Paper
2020Ozkan-Dagliyan, I;Diehl, JN;George, SD;Schaefer, A;Papke, B;Klotz-Noack, K;Waters, AM;Goodwin, CM;Gautam, P;Pierobon, M;Peng, S;Gilbert, TSK;Lin, KH;Dagliyan, O;Wennerberg, K;Petricoin, EF;Tran, NL;Bhagwat, SV;Tiu, RV;Peng, SB;Herring, LE;Graves, LM;Sers, C;Wood, KC;Cox, AD;Der, CJ;Low-Dose Vertical Inhibition of the RAF-MEK-ERK Cascade Causes Apoptotic Death of KRAS Mutant CancersCell Rep32553168CRISPR sequencing was performed at UNC (High-Throughput Sequencing Facility, Chapel Hill, NC) and Hudson Alpha (HudsonAlpha Genomic Services Laboratory, Huntsville, AL)Full Paper
2020Wang, X;Kelkar, YD;Xiong, X;Martinson, EO;Lynch, J;Zhang, C;Werren, JH;Wang, X;Genome Report: Whole Genome Sequence and Annotation of the Parasitoid Jewel Wasp Nasonia giraulti Laboratory Strain RV2X[u]G3 (Bethesda)32571804and Helen Wisch Professorship. X.X. is supported by the Auburn University Presidential Graduate Research Fellowship and Auburn University College of Veterinary Medicine Dean’s Fellowship. We thank HudsonAlpha Discovery for assistance with Illumina seFull Paper
2020Ulasov, I;Borovjagin, A;Fares, J;Yakushov, S;Malin, D;Timashev, P;Lesniak, MS;MicroRNA 345 (miR345) regulates KISS1-E-cadherin functional interaction in breast cancer brain metastasesCancer Lett.32246957One hundred and eleven tumor samples, representing invasive ductal carcinoma (IDC) were subjected for evaluation as a part of brain tissue microarrays presented by: US Biomax (BR812), Folio Biosciences (AY-HH0137) and biobank at the University of ChiFull Paper
2020Chiang, J;Ahmed, N;Foote, J;Prasad, N;Karri, S;Pagidas, K;Wiltshire, A;Gunn, D;Singh, K;OVARIAN AGING AND REPRODUCTIVE SENESCENCE IN MOUSE MODEL OF MITOCHONDRIAL DYSFUNCTIONFertility and Sterility2 HudsonAlpha Discovery, Huntsville, AL; 3 TCM University, Lincoln, RIFull Paper
2020Ho, AY;Barker, CA;Arnold, BB;Powell, SN;Hu, ZI;Gucalp, A;Lebron-Zapata, L;Wen, HY;Kallman, C;D'Agnolo, A;Zhang, Z;Flynn, J;Dunn, SA;McArthur, HL;A phase 2 clinical trial assessing the efficacy and safety of pembrolizumab and radiotherapy in patients with metastatic triple-negative breast cancerCancer31747077PD‐L1 tumor expression was evaluated in prospectively collected samples of metastatic biopsies by a central laboratory (QualTek Molecular Laboratories, Goleta, California) using a previously described prototype assay using the 22C3 antibody (Merck anFull Paper
2020Kasimir-Bauer, S;Roder, J;Obermayr, E;Mahner, S;Vergote, I;Loverix, L;Braicu, E;Sehouli, J;Concin, N;Kimmig, R;Net, L;Roder, H;Zeillinger, R;Aust, S;On Behalf Of The Ovcad Ovarian Cancer Diagnosis Initiative, ;Definition and Independent Validation of a Proteomic-Classifier in Ovarian CancerCancers32899818These samples were obtained from commercial biobanks (Conversant Bio (Huntsville, AL, USA) and Oncology Metrics (Forth Worth, TX, USA)), under their ethics-approved protocolsFull Paper
2020Jimenez, C;Subbiah, V;Stephen, B;Ma, J;Milton, D;Xu, M;Zarifa, A;Akhmedzhanov, FO;Tsimberidou, A;Habra, MA;Rodon Anhert, J;Fu, S;Naing, A;Phase II Clinical Trial of Pembrolizumab in Patients with Progressive Metastatic Pheochromocytomas and ParagangliomasCancers32824391tissue samples or newly obtained biopsy specimens (if archival tissue was not available) were evaluated by immunohistochemical analysis to determine the expression of PDL-1 in tumor cells and tumor-infiltrating mononuclear inflammatory cells by QualtFull Paper
2020Jordan, AR;Wang, J;Yates, TJ;Hasanali, SL;Lokeshwar, SD;Morera, DS;Shamaladevi, N;Li, CS;Klaassen, Z;Terris, MK;Thangaraju, M;Singh, AB;Soloway, MS;Lokeshwar, VB;Molecular targeting of renal cell carcinoma by an oral combinationOncogenesis32427869Department of Biochemistry and Molecular Biology, Medical College of Georgia, Augusta University, 1410 Laney Walker Blvd., Augusta, GA, 30912, USA.||Sheila and David Fuente Graduate Program in Cancer Biology, University of Miami-Miller School of MediFull Paper
2020Mehnert, JM;Bergsland, E;O'Neil, BH;Santoro, A;Schellens, JHM;Cohen, RB;Doi, T;Ott, PA;Pishvaian, MJ;Puzanov, I;Aung, KL;Hsu, C;Le Tourneau, C;Hollebecque, A;Élez, E;Tamura, K;Gould, M;Yang, P;Stein, K;Piha-Paul, SA;Pembrolizumab for the treatment of programmed death-ligand 1-positive advanced carcinoid or pancreatic neuroendocrine tumors: Results from the KEYNOTE-028 studyCancer32320048PD was confirmed by repeat radiographic imaging ≥4 weeks after the initial scan. Investigators could opt to keep clinically stable patients on treatment until confirmed PD. Safety was monitored through 30 days after the last treatment dose (90 days fFull Paper
2020Wen, X;Ou, Y;Zarick, H;Zhang, X;Hmelo, A;Victor, Q;Paul, E;Slocik, J;Naik, R;Bellan, L;Lin, E;Bardhan, R;PRADA: Portable Reusable Accurate Diagnostics with nanostar Antennas for multiplexed biomarker screeningBioeng Transl Medlabor intensive, and cost prohibitive.39,40 We chose to measure the accuracy of PRADA in commercially available de-identified human patient serum (Discovery Life Sciences Inc.) to recapitulate clinical diagnostics where biomarkers of interest competeFull Paper
2020Gonzalez-Ericsson, PI;Stovgaard, ES;Sua, LF;Reisenbichler, E;Kos, Z;Carter, JM;Michiels, S;Le Quesne, J;Nielsen, TO;Laenkholm, AV;Fox, SB;Adam, J;Bartlett, JM;Rimm, DL;Quinn, C;Peeters, D;Dieci, MV;Vincent-Salomon, A;Cree, I;Hida, AI;Balko, JM;Haynes, HR;Frahm, I;Acosta-Haab, G;Balancin, M;Bellolio, E;Yang, W;Kirtani, P;Sugie, T;Ehinger, A;Castaneda, CA;Kok, M;McArthur, H;Siziopikou, K;Badve, S;Fineberg, S;Gown, A;Viale, G;Schnitt, SJ;Pruneri, G;Penault-Llorca, F;Hewitt, S;Thompson, EA;Allison, KH;Symmans, WF;Bellizzi, AM;Brogi, E;Moore, DA;Larsimont, D;Dillon, DA;Lazar, A;Lien, H;Goetz, MP;Broeckx, G;El Bairi, K;Harbeck, N;Cimino-Mathews, A;Sotiriou, C;Adams, S;Liu, SW;Loibl, S;Chen, IC;Lakhani, SR;Juco, JW;Denkert, C;Blackley, EF;Demaria, S;Leon-Ferre, R;Gluz, O;Zardavas, D;Emancipator, K;Ely, S;Loi, S;Salgado, R;Sanders, M;, ;The path to a better biomarker: application of a risk management framework for the implementation of PD-L1 and TILs as immuno-oncology biomarkers in breast cancer clinical trials and daily practiceJ. Pathol.32129476PANACEA NCT02129556 58 Pembrolizumab + trastuzumab single arm phase Ib/II PreTx LAdv or mHER2+ BC Ib: PD‐L1+ (6) II: PD‐L1+ & PD‐L1‐ (52) PD‐L1 (QualTek/ 22C3) tested prospectively at BTx (58). TILs were evaluated retrospectively (48). II: HFull Paper
2020Lu, H;Molony, RD;Chen, D;Jang, S;Wolf, B;Ewert, S;Flaherty, M;Xu, F;Isim, S;Shim, Y;Dornelas, C;Balke, N;Leber, XC;Scharenberg, M;Koelln, J;Choi, E;Ward, R;Johnson, J;Calzascia, T;Isnardi, I;Williams, JA;Lindenbergh, PL;van de Donk, NWCJ;Mutis, T;Huet, H;Lees, E;Meyer, MJ;Development of anti-CD32b antibodies with enhanced Fc function for the treatment of B and plasma cell malignanciesMol. Cancer Ther.32847974detect CD32b expression on primary cells and cell lines. Patient samples for CD32b expression analysis were purchased from Conversant Bio, now part of Discovery Life Science. 2B6 binding to normal human plasma cells fromFull Paper
2020Hutchins, B;Starling, GC;McCoy, MA;Herzyk, D;Poulet, FM;Dulos, J;Liu, L;Kang, SP;Fayadat-Dilman, L;Hsieh, M;Andrews, CL;Ayanoglu, G;Cullen, C;Malefyt, RW;Kastelein, RA;Saux, SL;Lee, J;Li, S;Malashock, D;Sadekova, S;Soder, G;van Eenennaam, H;Willingham, A;Yu, Y;Streuli, M;Carven, GJ;van Elsas, A;Biophysical and Immunological Characterization and In Vivo Pharmacokinetics and Toxicology in Nonhuman Primates of the Anti-PD-1 Antibody PembrolizumabMolecular cancer therapeutics32229606See Supplementary Data for additional details. Primary tumor cell culture assay Fresh non-small cell lung cancer (NSCLC) tumor tissues were collected and shipped overnight in AQIX media (AQIX) by collection providers (Folio Biosciences, Bio-Options,Full Paper
2020Smith, SD;Till, BG;Shadman, MS;Lynch, RC;Cowan, AJ;Wu, QV;Voutsinas, J;Rasmussen, HA;Blue, K;Ujjani, CS;Shustov, A;Cassaday, RD;Fromm, JR;Gopal, AK;Pembrolizumab with R-CHOP in previously untreated diffuse large B-cell lymphoma: potential for biomarker driven therapyBr. J. Haematol.32030732PD‐L1 immunohistochemistry was performed centrally by QualTek Molecular Laboratories using the mouse monoclonal antibody clone 22c3 by previously described methods (Supplementary Appendix, Section B) (Dolled‐Filhart et al. , 2016). Statistical considFull Paper
2020Vijayvergia, N;Dasari, A;Deng, M;Litwin, S;Al-Toubah, T;Alpaugh, RK;Dotan, E;Hall, MJ;Ross, NM;Runyen, MM;Denlinger, CS;Halperin, DM;Cohen, SJ;Engstrom, PF;Strosberg, JR;Pembrolizumab monotherapy in patients with previously treated metastatic high-grade neuroendocrine neoplasms: joint analysis of two prospective, non-randomised trialsBr. J. Cancer32152503For patients enrolled into FC, PD-L1 immunohistochemistry (IHC) assay was performed at Qualtek Research Laboratories on formalin-fixed, paraffin-embedded tissue sections using anti-PD-L1 monoclonal antibody clone 22C3 [Merck Research Laboratories]Full Paper
2020Schruf, E;Schroeder, V;Le, HQ;Schönberger, T;Raedel, D;Stewart, EL;Fundel-Clemens, K;Bluhmki, T;Weigle, S;Schuler, M;Thomas, MJ;Heilker, R;Webster, MJ;Dass, M;Frick, M;Stierstorfer, B;Quast, K;Garnett, JP;Recapitulating idiopathic pulmonary fibrosis related alveolar epithelial dysfunction in a human iPSC-derived air-liquid interface modelFASEB J.32297676Formalin-fixed and paraffin embedded lung samples from human IPF patients were purchased from Folio Biosciences (Powell, OH, US) under the regulatory conditions of the Boehringer Ingelheim corporate policy regarding the acquisition and use of human bFull Paper
2020Kang, J;Yeom, G;Jang, H;Park, C;Kim, M;Highly sensitive and universal detection strategy based on a colorimetric assay using target-specific heterogeneous sandwich DNA aptamerAnalytica Chimica ActaAll reagent concentrations were the same as those analyzed in the developed method. 2.8. Evaluation of clinical samples. We obtained patient samples containing NPs of influenza A and B viruses from Discovery Life Sciences, Inc (Huntsville, AL, USA)Full Paper
2020Seyger, M;Abramovits, W;Liljedahl, M;Hoejen, MN;Teng, J;Safety and efficacy of fixed-dose combination calcipotriol (50 μg/g) and betamethasone dipropionate (0.5 mg/g) cutaneous foam in adolescent patients (aged 12 to <17 years) with plaque psoriasis: results of a phase II, open-label trialJ Eur Acad Dermatol Venereol32074665W. Abramovits has received honoraria or fees for serving on advisory boards as a speaker and as a consultant, and has received grants as an investigator from AbbVie, Akros, Allergan, Amgen, Anacor Pharm, Aqua Pharma, Celgene, Centocor, Conversant BioFull Paper
2020Piha-Paul, SA;Oh, DY;Ueno, M;Malka, D;Chung, HC;Nagrial, A;Kelley, RK;Ros, W;Italiano, A;Nakagawa, K;Rugo, HS;de Braud, F;Varga, AI;Hansen, A;Wang, H;Krishnan, S;Norwood, KG;Doi, T;Efficacy and safety of pembrolizumab for the treatment of advanced biliary cancer: Results from the KEYNOTE-158 and KEYNOTE-028 studiesInt. J. Cancer32359091In KEYNOTE‐028, a prototype immunohistochemistry assay (QualTek, Goleta, California) was used to prospectively detect PD‐L1 expression, with positivity defined as membranous PD‐L1 expression in ≥1% of tumor and associated inflammatory cells or positiFull Paper
2020Agnello, G;Alters, SE;Rowlinson, SW;Preclinical safety and antitumor activity of the arginine-degrading therapeutic enzyme pegzilarginase, a PEGylated, cobalt-substituted recombinant human arginase 1Transl Res31954097CD8 IHC analysis of FFPE sections was performed by QualTek Molecular Laboratories (Goleta, Calif) and LC3B IHC analysis of FFPE sections was performed by GoPath Laboratories (Buffalo Grove, Ill). Statistical analysesFull Paper
2020Ross, AE;Hurley, PJ;Tran, PT;Rowe, SP;Benzon, B;Neal, TO;Chapman, C;Harb, R;Milman, Y;Trock, BJ;Drake, CG;Antonarakis, ES;A pilot trial of pembrolizumab plus prostatic cryotherapy for men with newly diagnosed oligometastatic hormone-sensitive prostate cancerProstate Cancer Prostatic Dis.31611635pathologist. Post-treatment biopsies were evaluated for PD-L1, CD4, CD8, and FoxP3 proteins by single-stain semiquantitative immunohistochemistry performed by QualTek Molecular and Clinical Laboratories (Santa Barbara, CA) ;re assessed by a geniFull Paper
2020Scheffler, M;Holzem, A;Kron, A;Nogova, L;Ihle, MA;von Levetzow, C;Fassunke, J;Wömpner, C;Bitter, E;Koleczko, S;Abdulla, DSY;Michels, S;Fischer, R;Riedel, R;Weber, JP;Westphal, T;Gerigk, U;Kern, J;Kaminsky, B;Randerath, W;Kambartel, KO;Merkelbach-Bruse, S;Büttner, R;Wolf, J;Co-occurrence of targetable mutations in Non-small cell lung cancer (NSCLC) patients harboring MAP2K1 mutationsLung Cancer32361034Reinhard Büttner: RB has been a consultant for Pfizer and Novartis regarding MET inhibitors and is a co-founder and CSO of Targos Molecular Pathology, Kassel GermanyFull Paper
2020Lee, EK;Xiong, N;Cheng, SC;Barry, WT;Penson, RT;Konstantinopoulos, PA;Hoffman, MA;Horowitz, N;Dizon, DS;Stover, EH;Wright, AA;Campos, SM;Krasner, C;Morrissey, S;Whalen, C;Quinn, R;Matulonis, UA;Liu, JF;Combined pembrolizumab and pegylated liposomal doxorubicin in platinum resistant ovarian cancer: A phase 2 clinical trialGynecol. Oncol.32771276Tumor infiltrating lymphocytes (TILs) were estimated as an overall average of the sample and reported on a scale of 0 (absent TILs) to 3 (profuse infiltration). PD-L1 and TIL analysis was performed at QualTek Molecular Laboraties, PAFull Paper
2020Frumovitz, M;Westin, SN;Salvo, G;Zarifa, A;Xu, M;Yap, TA;Rodon, AJ;Karp, DD;Abonofal, A;Jazaeri, AA;Naing, A;Phase II study of pembrolizumab efficacy and safety in women with recurrent small cell neuroendocrine carcinoma of the lower genital tractGynecol. Oncol.32534809Adverse events were assessed using the National Cancer Institute Common Terminology Criteria for Adverse Events version 4.03. When fresh or archived tissue was available, PD-L1 biomarker analysis was performed by Qualtek assay using Merck 22C3 antiboFull Paper
2020Gaillard, S;Broadwater, G;Andrews, W;Starr, M;Previs, R;Havrilesky, L;Davidson, B;Berchuck, A;Yi, J;Nixon, A;Secord, A;Pembrolizumab window study: Illuminating the immunologic landscape in gynecologic cancersGynecologic Oncologychanges in PD-L1 expression (by immunohistochemistry with monoclonal antibody clone 22C3 on FFPE specimens;l Qualtek, PA) scored using a quantitative modified proportion score (MPS)Full Paper
2020Pillarisetti, K;Powers, G;Luistro, L;Babich, A;Baldwin, E;Li, Y;Zhang, X;Mendonça, M;Majewski, N;Nanjunda, R;Chin, D;Packman, K;Elsayed, Y;Attar, R;Gaudet, F;Teclistamab is an active T cell-redirecting bispecific antibody against B-cell maturation antigen for multiple myelomaBlood Adv32956453Plasma samples were from normal subjects (n = 39) and patients with MM (n = 40); donors were acquired from Conversant Biologics and subjected to proteolysis and subsequent mass spectrometry using a reference multiple reaction monitoring sequence (YCNFull Paper
2020Svrzikapa, N;Longo, K;Prasad, N;Boyanapalli, R;Brown, J;Dorset, D;Yourstone, S;Powers, J;Levy, S;Morris, A;Vargeese, C;Goyal, J;Investigational assay for haplotype phasing of the huntingtin geneMolecular Therapy - Methods & Clinical Development4 1 Wave Life Sciences Ltd., Cambridge, MA, 02138 USA; 2 Department of Paediatrics, Medical 5 Sciences Division, University of Oxford, Oxford, OX3 9DU UK; 3 HudsonAlpha Discovery, 6 Discovery Life Sciences, Huntsville, AL, 35806 USA; 4 Genomic ServicFull Paper
2020Sebest, P;Fojt, L;Ostatna, V;Fojta, M;Danhel, A;Electrodeposited silver amalgam particles on pyrolytic graphite in (spectro)electrochemical detection of 4-nitrophenol, DNA and green fluorescent proteinBioelectrochemistry31855832electrode setup composed of: i) a bPGE or edge-plane PGE (ePGE, both Momentive) working electrode, together with ii) a refillable miniature Ag/AgCl/3M KCl reference electrode (eDAQ) placed into the salt bridge composed of a heat shrink Teflon tube (QFull Paper
2020Xicoy, H;Brouwers, JF;Wieringa, B;Martens, GJM;Explorative Combined Lipid and Transcriptomic Profiling of Substantia Nigra and Putamen in Parkinson's DiseaseCells32858884Total RNA samples were spectrophotometrically analyzed and their 260/280 ratio was typically above 1.9. RNA-seq directionality library preparation and sequencing with Poly (A) selection was performed by HudsonAlpha Genomic Services Laboratory (HuntsvFull Paper
2020Elgharably, H;Okamoto, T;Ayyat, KS;Niikawa, H;Meade, S;Farver, C;Chan, ER;Aldred, MA;McCurry, KR;Human Lungs Airway Epithelium Upregulate MicroRNA-17 and MicroRNA-548b in Response to Cold Ischemia and Ex Vivo ReperfusionTransplantation32590607We thank Tracey Bonfield, PhD from CWRU for performing the cytokines analysis. We thank Gerard J. Nuovo, MD, and Adel Mikhail, PhD from Phylogeny Inc. for performing the in situ hybridization assays of the microRNAFull Paper
2020Grigorieva, J;Asmellash, S;Net, L;Tsypin, M;Roder, H;Roder, J;Mass Spectrometry-Based Multivariate Proteomic Tests for Prediction of Outcomes on Immune Checkpoint Blockade Therapy: The Modern Analytical ApproachInt J Mol Sci3201294150] PSEA reference set NSCLC patients; samples obtained from commercial biobanks Conversant Bio (Huntsville, AL) and Oncology Metrix (Fort Worth, TX) 100 Grigorieva et al., 2019 [51] 3. BDX008 Test and ICB Test BDX008Full Paper
2020Awty-Carroll, D;Ravella, S;Clifton-Brown, J;Robson, P;Using a Taguchi DOE to investigate factors and interactions affecting germination in Miscanthus sinensisSci Rep32005862All dishes were prepared and tested at the same time to limit extraneous sources of variation. The Taguchi design of experiment (DOE) was produced and primarily analysed using Qualtek-4 (Nutek inc., Michigan, USA) with secondary analysis in R34 ;FulFull Paper
2020Noto, PB;Sikorski, TW;Zappacosta, F;Wagner, CD;Montes de Oca, R;Szapacs, ME;Annan, RS;Liu, Y;McHugh, CF;Mohammad, HP;Piccoli, SP;Creasy, CL;Identification of hnRNP-A1 as a pharmacodynamic biomarker of type I PRMT inhibition in blood and tumor tissuesScientific reports33335114nd Treatment of Laboratory Animals and were reviewed by the Institutional Animal Care and Use Committee at GSK. Immunohistochemistry Both total and ADM-R225-hnRNP-A1 IHC assays were developed and at QualTek Molecular Laboratories using anti-hnRNP-A1Full Paper
2020Rüschoff, J;Lebeau, A;Sinn, P;Schildhaus, HU;Decker, T;Ammann, J;Künzel, C;Koch, W;Untch, M;Statistical modelling of HER2-positivity in breast cancer: Final analyses from two large, multicentre, non-interventional studies in GermanyBreast31918324Institut für Pathologie Nordhessen and Targos Molecular Pathology GmbH, Germaniastr. 7, D-34119, Kassel, Germany. Electronic address: rueschoff@patho-nordhessen.de.++Institut für Pathologie, Universitätsklinikum Hamburg-Eppendorf, Martinistr. 52, 202Full Paper
2020Emancipator, K;Keytruda and PD-L1: a Real-World Example of Co-development of a Drug with a Predictive BiomarkerThe AAPS journal33222057two clinical trial assays were used (Table I). The first, described in the literature as the "prototype assay" (4), was developed in-house at Merck & Co., Inc., Kenilworth, NJ, USA, and eventually placed and refined in an accredited clinical laboratoFull Paper
2020Gebauer, F;Krämer, M;Bruns, C;Schlößer, HA;Thelen, M;Lohneis, P;Schröder, W;Zander, T;Alakus, H;Buettner, R;Loeser, H;Quaas, A;Lymphocyte activation gene-3 (LAG3) mRNA and protein expression on tumour infiltrating lymphocytes (TILs) in oesophageal adenocarcinomaJ. Cancer Res. Clin. Oncol.32592066Reinhard Büttner: Co-Founder and Co-Owner of Targos Molecular Pathology Inc. Kassel/Germany. Hans Schlösser: Funding for Research from Astra Zeneca for research outside this study. Thomas Zander: BMS: advisory board, clinical trial; Novartis: advisorFull Paper
2020Wang, X;Jaimes, M;Gu, H;Shults, K;Putta, S;Sharma, V;Chow, W;Gogoi, P;Handique, K;Patterson, BK;Cell by cell immuno- and cancer marker profiling of non-small cell lung cancer tissue: Checkpoint marker expression on CD103+, CD4+ T-cells predicts circulating tumor cellsTranslational oncology33217647of a total of 72 biomarkers that result from using combinations of cellular markers in our algorithm to predict CTCs. Material and methods Samples Fresh tissues were obtained from 10 NSCLC cases by Folio Biosciences [Powell, OH] with paired peripherFull Paper
2020MacCarty, N;Bentson, S;Cushman, K;Au, J;Li, C;Murugan, G;Still, D;Stratification of particulate matter in a kitchen: A comparison of empirical to predicted concentrations and implications for cookstove emissions targetsEnergy for Sustainable Developmentthe top perimeter (Fig. 3). Small computer fans (Qualtek FAD1-06020CSHW11 rated at 1.44 W @12 V and 16 CFM) covered the holes at the top perimeter to force air out of the test kitchen at a constant rate. In Phase 1 of theFull Paper
2020Jia, Y;Liu, L;Shan, B;Future of immune checkpoint inhibitors: focus on tumor immune microenvironmentAnnals of translational medicine33145314The TNBC cohort in KEYNOTE-012 phase Ib trial enrolled 32 cases of heavily pre-treated patients with PD-L1 positivity in the stroma or PD-L1 ≥1% tumor cells using their Qualtek assayFull Paper
2020Sebest, P;Ostatna, V;Fojta, M;Danhel, A;Constant-current chronopotentiometric stripping detection of bovine serum albumin on silver amalgam particlesJournal of Electroanalytical Chemistryin three-electrode setup composed of: i) base plane PGE (bPGE,od 3.0 mm, Momentive) as working electrode, together with ii) refillable miniature Ag/AgCl/3 M KCl reference electrode (eDAQ) placed into the salt bridge composed of heat shrink Teflon tubFull Paper
2020Rehkaemper, J;Korenkov, M;Quaas, A;Rueschoff, J;Pamuk, A;Zander, T;Hillmer, AM;Buettner, R;Hoelscher, AH;Bruns, CJ;Loeser, H;Alakus, H;Schoemig-Markiefka, B;Amplification of KRAS and its heterogeneity in non-Asian gastric adenocarcinomasBMC Cancer32571252Institute of Pathology, University Hospital Cologne, Cologne, Germany. jan.rehkaemper@uk-koeln.de.++Department of General, Visceral and Cancer Surgery, University Hospital Cologne, Cologne, Germany.++Institute of Pathology, University Hospital ColognFull Paper
2020Montalban-Bravo, G;Class, CA;Ganan-Gomez, I;Kanagal-Shamanna, R;Sasaki, K;Richard-Carpentier, G;Naqvi, K;Wei, Y;Yang, H;Soltysiak, KA;Chien, K;Bueso-Ramos, C;Do, KA;Kantarjian, H;Garcia-Manero, G;Transcriptomic analysis implicates necroptosis in disease progression and prognosis in myelodysplastic syndromesLeukemia31719677BM samples from healthy individuals were obtained from AllCells (Emeryville, CA). Patient characteristics are detailed in Supplementary Table S1. Informed consent was obtained SaveFull Paper
2020Arumugam, A;Faron, ML;Yu, P;Markham, C;Wu, M;Wong, S;A Rapid SARS-CoV-2 RT-PCR Assay for Low Resource SettingsDiagnostics (Basel, Switzerland)32987722No. 10006606) were purchased from Integrated DNA Technologies (Coralville, IA, USA). The clinical specimens of Influenza A (DLS16-85584), Influenza B (DLS15-33890), and RSV (KH19-00715) were obtained from Discovery Life Sciences Inc CachedFull Paper
2020Bio, S;Nunes, B;Acute effects of diclofenac on zebrafish: Indications of oxidative effects and damages at environmentally realistic levels of exposureEnviron. Toxicol. Pharmacol.32320907With the increasing awareness about the contamination of the aquatic environment by pharmaceuticals, there is a growing need to study their adverse effects on aquatic organisms. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID), whose wideFull Paper
2020Piedade, F;Bio, S;Nunes, B;Effects of common pharmaceutical drugs (paracetamol and acetylsalicylic acid) short term exposure on biomarkers of the mussel Mytilus sppEnviron. Toxicol. Pharmacol.31704586Pharmaceutical drugs in the wild may pose significant risks to non-target exposed organisms. This situation is even more troublesome for coastal marine or estuarine environments, located in the vicinity of large human conglomerates, for which the putFull Paper
2020Lin, J;Song, AJ;Hoffman-Censits, J;Leiby, BE;Tuluc, M;Shaw, C;Harshyne, L;Kean, R;Bar-Ad, V;Den, RB;Hurwitz, MD;Louie, J;Philipose, S;Deshmukh, SP;Johnson, JM;Dicker, AP;Hooper, DC;Kelly, WK;Lu, B;A Pilot Study of Radiation Therapy in Combination With Pembrolizumab in Patients With Metastatic Renal Cell CancerAm. J. Clin. Oncol.31693508When possible preradiation and post- radiation biopsy material was compared. Biopsy samples were analyzed by a QualTek pathologist (King of Prussia, PA) and Merck 22C3 antibody was used to score PD-L1 membrane expressionFull Paper
2020Johnston, G;Ramsey, HE;Liu, Q;Wang, J;Stengel, KR;Sampathi, S;Acharya, P;Arrate, M;Stubbs, MC;Burn, T;Savona, MR;Hiebert, SW;Nascent transcript and single-cell RNA-seq analysis defines the mechanism of action of the LSD1 inhibitor INCB059872 in myeloid leukemiaGene32422235Samples were submitted to HudsonAlpha Genomic Services Laboratory for library preparation with Nugen Ovation RNA-Seq System V2 kit (cat# 7102-08) and sequencing on Illumina NovaSeq6000. Data analysis was performed as described above. 2.13 Data availaFull Paper
2020Lin, H;Damen, JE;Walasek, MA;Szilvassy, SJ;Turhan, AG;Louis, SA;Eaves, AC;Wognum, AW;Feeder-free and serum-free in vitro assay for measuring the effect of drugs on acute and chronic myeloid leukemia stem/progenitor cellsExp. Hematol.32798646CML. 1, Folio Conversant, 3.64 × 10 6, 4.9%, 81.2%, 15 × 10 3, 84, Male, Pre treatment, 112.2; 1764.4. 2, Folio Conversant, 3.17 × 10 6, 6.8%, 79.3%, 18.5 × 10 3, 70, Male, Pre treatment, 44.3; 2380.1. 3, Folio Conversant, 1.38 × 10 6, 18.8%, 78.7%,Full Paper
2020Barroso-Sousa, R;Krop, IE;Trippa, L;Tan-Wasielewski, Z;Li, T;Osmani, W;Andrews, C;Dillon, D;Richardson, ET;Pastorello, RG;Winer, EP;Mittendorf, EA;Bellon, JR;Schoenfeld, JD;Tolaney, SM;A Phase II Study of Pembrolizumab in Combination With Palliative Radiotherapy for Hormone Receptor-positive Metastatic Breast CancerClin. Breast Cancer32113750Clinical benefit is defined as complete response, partial response, or stable disease ≥ 24 weeks according to RECIST 1.1. Exploratory Biomarkers. Five patients had PD-L1 testing assessed centrally by QualTek using the 22C3 antibodyFull Paper
2020Patel, JJ;Levy, DA;Nguyen, SA;Knochelmann, HM;Day, TA;Impact of PD-L1 expression and human papillomavirus status in anti-PD1/PDL1 immunotherapy for head and neck squamous cell carcinoma-Systematic review and meta-analysisHead Neck31762164Oro Valley, Arizona). One study28 did not specify the assay utilized for PD‐L1 expression, but rather reported the laboratory where analysis occurred (QualTek Molecular Laboratories, Goleta, California). This lab confirmed theFull Paper
2020Adekanmbi, EO;Giduthuri, AT;Srivastava, SK;Dielectric Characterization and Separation Optimization of Infiltrating Ductal Adenocarcinoma via Insulator-DielectrophoresisMicromachines (Basel)32218322The DEP suspending medium (dextrose solution) was prepared and characterized as described in our previous article [38]. The prepared 100 mL suspending medium was divided into five separate beakers. Into each beaker, except the first, calculated volumFull Paper
2020Jasani, B;Bänfer, G;Fish, R;Waelput, W;Sucaet, Y;Barker, C;Whiteley, JL;Walker, J;Hovelinck, R;Diezko, R;Evaluation of an online training tool for scoring programmed cell death ligand-1 (PD-L1) diagnostic tests for lung cancerDiagn Pathol32303234Correspondence: rolf.diezko@targos-gmbh.de 2Advance - Training and Consulting Unit, Targos Molecular Pathology GmbH, Kassel, Germany Full list of author information is available at the end of the article Jasani et al ;Correspondence: rolf.diezkoFull Paper
2020Schöniger, S;Degner, S;Zhang, Q;Schandelmaier, C;Aupperle-Lellbach, H;Jasani, B;Schoon, HA;Tumor Infiltrating Lymphocytes in Pet Rabbit Mammary Carcinomas: A Study with Relevance to Comparative PathologyAnimals : an open access journal from MDPI328245211. Targos Molecular Pathology GmbH, Germaniastrasse 7, 34119 Kassel, Germany. 2. Institute of Veterinary Pathology, University of Leipzig, An den Tierkliniken, 04109 Leipzig, Germany. 3. Institute of Anatomy, Experimental Neurobiology CachedFull Paper
2020Schöniger, S;Schoon, HA;The Healthy and Diseased Equine Endometrium: A Review of Morphological Features and Molecular AnalysesAnimals : an open access journal from MDPI32260515Targos Molecular Pathology GmbH, Germaniastrasse 7, 34119 Kassel, Germany.++Institute of Veterinary Pathology, Faculty of Veterinary Medicine, Leipzig University, An den Tierkliniken 33, 04103 Leipzig, GermanyFull Paper
2020Fish, EJ;Martinez-Romero, EG;DeInnocentes, P;Koehler, JW;Prasad, N;Smith, AN;Bird, RC;Circulating microRNA as biomarkers of canine mammary carcinoma in dogsJ. Vet. Intern. Med.32342546Extracted RNA was stored at −80°C until being shipped on dry ice to the Genomic Services Laboratory at HudsonAlpha Discovery for deep‐sequencing as previously described.14 Briefly, RNA libraries were processed extracted RNA using a NEBNext Small RNAFull Paper
2020Nuovo, G;A broad-based approach to differentiate CIN from its mimics: The utility of in situ hybridization and immunohistochemistryAnn Diagn Pathol32330660study was the review of 100 consecutive cases of formalin fixed, paraffin embedded tissues cervical biopsies done for either an abnormal Pap smear and/or a high risk HPV DNA positive result where the diagnosis was listed as CIN 1 or CIN 2. Folio BiosFull Paper
2020Inceer, H;Ozcan, M;Taxonomic evaluations on the anatomical characters of leaf and achene in Turkish Tripleurospermum with its relative Matricaria (Asteraceae)FloraBesides, both genera have appeared well separated in different and supported clades based on molecular phylogeny (Inceer et al., 2018)Full Paper
2020Roder, J;Net, L;Oliveira, C;Meyer, K;Asmellash, S;Kasimir-Bauer, S;Pass, H;Weber, J;Roder, H;Grigorieva, J;A proposal for score assignment to characterize biological processes from mass spectral analysis of serumClinical Mass SpectrometrySamples were obtained from the commercial biobanks Conversant Bio (Huntsville, AL) and Oncology Metrics (Fort Worth, TX). b They were purchased from commercial biobanks, including Conversant Bio (Huntsville, AL), AdeptBio (Memphis, TN), and ProMedDFull Paper
2020Köhne, M;Mönnig, F;Papin, J;Schöniger, S;Tönissen, A;Rohn, K;Martinsson, G;Schoon, HA;Sieme, H;Effects of Hysteroscopic and Uterine Body Insemination on the Presence of Selected Immune Cells in the Equine EndometriumJ. Equine Vet. Sci.32534786Current affiliation: Targos Molecular Pathology GmbH, 34119 Kassel, GermanyFull Paper
2020Schildhaus, HU;[Immunohistochemistry-based predictive biomarkers for lung cancer]Pathologe31989233Interessenkonflikt. H.-U. Schildhaus erhielt Honorare von MSD, BMS, Abbvie, ZytoVision, Zytomed, Pfizer, Abbott Molecular, Novartis Oncology und Roche. Der Autor ist Board Member bzw. Assessor bei QuIP, NordiQC und UKNEQAS sowie Angestellter der TargFull Paper
2020Tsai, AG;Glass, DR;Juntilla, M;Hartmann, FJ;Oak, JS;Fernandez-Pol, S;Ohgami, RS;Bendall, SC;Multiplexed single-cell morphometry for hematopathology diagnosticsNature medicine32161403Healthy bone marrow samples from AllCells were ordered, delivered and processed the same day. Healthy bone marrow 1 and 2 refer to the AllCells 9878 and 10874 samples, SaveFull Paper
2020Reyes, M;Filbin, MR;Bhattacharyya, RP;Billman, K;Eisenhaure, T;Hung, DT;Levy, BD;Baron, RM;Blainey, PC;Goldberg, MB;Hacohen, N;An immune-cell signature of bacterial sepsisNature medicine32066974De-identified BMMC samples were purchased from AllCells or Stemcell Technologies. This study was approved by the Institutional Review Boards at the Broad Institute of MIT and SaveFull Paper
2020Travaglini, KJ;Nabhan, AN;Penland, L;Sinha, R;Gillich, A;Sit, RV;Chang, S;Conley, SD;Mori, Y;Seita, J;Berry, GJ;Shrager, JB;Metzger, RJ;Kuo, CS;Neff, N;Weissman, IL;Quake, SR;Krasnow, MA;A molecular cell atlas of the human lung from single-cell RNA sequencingNature33208946For bulk RNA-seq of canonical immune populations, whole blood from healthy human donors was obtained commericially (AllCells) in EDTA tubes. Patient tissues were obtained under SaveFull Paper
2020Link, JO;Rhee, MS;Tse, WC;Zheng, J;Somoza, JR;Rowe, W;Begley, R;Chiu, A;Mulato, A;Hansen, D;Singer, E;Tsai, LK;Bam, RA;Chou, CH;Canales, E;Brizgys, G;Zhang, JR;Li, J;Graupe, M;Morganelli, P;Liu, Q;Wu, Q;Halcomb, RL;Saito, RD;Schroeder, SD;Lazerwith, SE;Bondy, S;Jin, D;Hung, M;Novikov, N;Liu, X;Villaseñor, AG;Cannizzaro, CE;Hu, EY;Anderson, RL;Appleby, TC;Lu, B;Mwangi, J;Liclican, A;Niedziela-Majka, A;Papalia, GA;Wong, MH;Leavitt, SA;Xu, Y;Koditek, D;Stepan, GJ;Yu, H;Pagratis, N;Clancy, S;Ahmadyar, S;Cai, TZ;Sellers, S;Wolckenhauer, SA;Ling, J;Callebaut, C;Margot, N;Ram, RR;Liu, YP;Hyland, R;Sinclair, GI;Ruane, PJ;Crofoot, GE;McDonald, CK;Brainard, DM;Lad, L;Swaminathan, S;Sundquist, WI;Sakowicz, R;Chester, AE;Lee, WE;Daar, ES;Yant, SR;Cihlar, T;Clinical targeting of HIV capsid protein with a long-acting small moleculeNature32612233Human peripheral blood mononuclear cells (PBMCs) were collected from healthy volunteers under informed consent; their use was approved by an institutional review board at AllCells SaveFull Paper
2020Ferrari, S;Jacob, A;Beretta, S;Unali, G;Albano, L;Vavassori, V;Cittaro, D;Lazarevic, D;Brombin, C;Cugnata, F;Kajaste-Rudnitski, A;Merelli, I;Genovese, P;Naldini, L;Efficient gene editing of human long-term hematopoietic stem cells validated by clonal trackingNature biotechnology32601433(Biovision) and 50 nM UM171 (STEMCell Technologies), unless otherwise specified. G-CSF mPB CD34+ HSPCs were purified with the CliniMACS CD34 Reagent System (Miltenyi Biotec) from Mobilized Leukopak (AllCells) upon approval by the Ospedale San RaffaeFull Paper
2020Spindler, MJ;Nelson, AL;Wagner, EK;Oppermans, N;Bridgeman, JS;Heather, JM;Adler, AS;Asensio, MA;Edgar, RC;Lim, YW;Meyer, EH;Hawkins, RE;Cobbold, M;Johnson, DS;Massively parallel interrogation and mining of natively paired human TCRαβ repertoiresNature biotechnology32393905novel ACT. Online Methods Sourcing and Processing Human Materials De-identified peripheral blood mononuclear cells (PBMCs) in leukopaks were obtained from HLA-A*02:01 and HLA-A*24:02 healthy donors (AllCells, Alameda, CA, USA), under an InstitutionaFull Paper
2020Dinh, HQ;Eggert, T;Meyer, MA;Zhu, YP;Olingy, CE;Llewellyn, R;Wu, R;Hedrick, CC;Coexpression of CD71 and CD117 Identifies an Early Unipotent Neutrophil Progenitor Population in Human Bone MarrowImmunity32814027Human bone marrow cells Fresh bone marrow samples from anonymous healthy adult donors were obtained from AllCells, Inc. (Alameda, CA). For information on donor characteristics, refer to Supplemental Table 1. Upon arrival, the fresh cells were immediaFull Paper
2020Glass, DR;Tsai, AG;Oliveria, JP;Hartmann, FJ;Kimmey, SC;Calderon, AA;Borges, L;Glass, MC;Wagar, LE;Davis, MM;Bendall, SC;An Integrated Multi-omic Single-Cell Atlas of Human B Cell IdentityImmunity32668225structive sleep apnea stanfordhealthcare.org Human lymph node Stanford Hosptial, biopsy sample of recovered lymphoma patient stanfordhealthcare.org Human bone marrow from healthy donors AllCells allcells.com -------------------------Full Paper
2020Park, HB;Wei, Z;Oh, J;Xu, H;Kim, CS;Wang, R;Wyche, TP;Piizzi, G;Flavell, RA;Crawford, JM;Sulfamethoxazole drug stress upregulates antioxidant immunomodulatory metabolites in Escherichia coliNature microbiology32719505ndors supply Eurofins DiscoverX with primary human cells: Cell Applications, Inc., CellzDirect, Celsis-IVT, Leukolab, Life Technologies, Lonza, ScienCell, Hemacare Corporation, Stemcell Technologies, AllCells, Physician’s Plasma Alliance, Lifeline CeFull Paper
2020Di Genua, C;Valletta, S;Buono, M;Stoilova, B;Sweeney, C;Rodriguez-Meira, A;Grover, A;Drissen, R;Meng, Y;Beveridge, R;Aboukhalil, Z;Karamitros, D;Belderbos, ME;Bystrykh, L;Thongjuea, S;Vyas, P;Nerlov, C;C/EBPα and GATA-2 Mutations Induce Bilineage Acute Erythroid Leukemia through Transformation of a Neomorphic Neutrophil-Erythroid ProgenitorCancer cell32330454derbos et al., 2017) ------------------------- Biological Samples ------------------------- AEL patient samples (OX1164; AYL050; MKH048; STB115) MDSBio NA Normal adult human bone marrow AllCells NA ------------------------- CriticalFull Paper
2020Li, S;Chen, X;Wang, J;Meydan, C;Glass, JL;Shih, AH;Delwel, R;Levine, RL;Mason, CE;Melnick, AM;Somatic Mutations Drive Specific, but Reversible, Epigenetic Heterogeneity States in AMLCancer discovery32938585from our prior study(9), 5 of which were purchased from AllCells (Alameda, CA, USA) and 9 of which were isolated using magnetic bead positive selection for CD34+ (Miltenyi Biotec) from freshly collected bone marrow samples from individuals without knFull Paper
2020Zhou, Y;Han, C;Wang, E;Lorch, AH;Serafin, V;Cho, BK;Gutierrez Diaz, BT;Calvo, J;Fang, C;Khodadadi-Jamayran, A;Tabaglio, T;Marier, C;Kuchmiy, A;Sun, L;Yacu, G;Filip, SK;Jin, Q;Takahashi, YH;Amici, DR;Rendleman, EJ;Rawat, R;Bresolin, S;Paganin, M;Zhang, C;Li, H;Kandela, I;Politanska, Y;Abdala-Valencia, H;Mendillo, ML;Zhu, P;Palhais, B;Van Vlierberghe, P;Taghon, T;Aifantis, I;Goo, YA;Guccione, E;Heguy, A;Tsirigos, A;Wee, KB;Mishra, RK;Pflumio, F;Accordi, B;Basso, G;Ntziachristos, P;Posttranslational Regulation of the Exon Skipping Machinery Controls Aberrant Splicing in LeukemiaCancer discovery32444465Our study provides a new proof-of-principle for posttranslational regulation of splicing factors independently of mutations in aggressive T-cell leukemia. It further suggests a new drug SaveFull Paper
2020Tochigi, T;Miyamoto, T;Hatakeyama, K;Sakoda, T;Ishihara, D;Irifune, H;Shima, T;Kato, K;Maeda, T;Ito, T;Handa, H;Akashi, K;Kikushige, Y;Aromatase is a novel neosubstrate of cereblon responsible for immunomodulatory drug-induced thrombocytopeniaBlood32219443Human adult bone marrow and granulocyte colony-stimulating factor-mobilized peripheral blood samples were obtained from healthy donors or purchased from AllCells. Cord blood SaveFull Paper
2020Montalban Bravo, G;Kanagal-Shamanna, R;Darbaniyan, F;Ganan-Gomez, I;Sasaki, K;Naqvi, K;Wei, Y;Yang, H;Soltysiak, K;Chien, K;Bueso-Ramos, C;Kantarjian, H;Garcia-Manero, G;Genomic and Transcriptomic Differences of Myelodysplastic Syndrome/Myeloproliferative Neoplasm with Ring Sideroblasts and Thrombocytosis (MDS/MPN-RS-T) and Myelodysplastic Syndrome with Ring Sideroblasts (MDS-RS)BloodCD34+ cells from bone marrow samples of 4 pts with MDS/MPN-RS-T, 7 pts with MDS-RS and 17 healthy individuals obtained from AllCells (Emeryville, CA) were isolated using the SaveFull Paper
2020Montalban Bravo, G;Darbaniyan, F;Kanagal-Shamanna, R;Ganan-Gomez, I;Sasaki, K;Naqvi, K;Wei, Y;Yang, H;Soltysiak, K;Chien, K;Bueso-Ramos, C;Kantarjian, H;Garcia-Manero, G;Transcriptomic Features and Deregulation of Genes Involved in Monopoiesis Influence Outcomes of Patients with Chronic Myelomonocytic LeukemiaBloodINTRODUCTION: Chronic myelomonocytic leukemia (CMML) is characterized by TET2, SRSF2, ASXL1 and RAS pathway mutations known to induce myelomonocytic bias. We have previously shown that upregulation of KDM6B, a histone demethylase that acts as an innaFull Paper
2020Walters, M;Chui, D;Farrell, J;Lal, A;Locatelli, F;Kwiatkowski, J;Porter, J;Sauer, M;Thuret, I;Hongeng, S;Kulozik, A;Thrasher, A;Yannaki, E;Yang, J;Whitney, D;Petrusich, A;Colvin, R;Thompson, A;Response of Patients with Transfusion-Dependent β-Thalassemia (TDT) to Betibeglogene Autotemcel (beti-cel; LentiGlobin for β-Thalassemia) Gene Therapy Based on HBB Genotype and Disease Genetic ModifiersBloodIntroduction We investigated the impact of β-thalassemia genotypes and disease genetic modifiers including HBA and KLF1 genotype and sentinel single-nucleotide polymorphism (SNP) genotypes at 3 major HbF quantitative trait loci (QTL) oFull Paper
2020Kanter, J;Tisdale, J;Mapara, M;Kwiatkowski, J;Krishnamurti, L;Chen, R;Gallagher, M;Ding, Y;Goyal, S;Paramore, C;Thompson, A;Walters, M;Improvements in Health-Related Quality of Life for Patients Treated with LentiGlobin for Sickle Cell Disease (bb1111) Gene TherapyBloodBackground In patients with sickle cell disease (SCD), health-related quality of life (HRQoL) is worse than in the general population and comparable or worse than in patients with other chronic or painful diseases such as cystic fibrosFull Paper
2020Thompson, A;Kwiatkowski, J;Porter, J;Hongeng, S;Yannaki, E;Kulozik, A;Sauer, M;Thrasher, A;Thuret, I;Lal, A;Guo, R;Liu, W;Colvin, R;Walters, M;Locatelli, F;Favorable Outcomes in Pediatric Patients in the Phase 3 Hgb-207 (Northstar-2) and Hgb-212 (Northstar-3) Studies of Betibeglogene Autotemcel Gene Therapy for the Treatment of Transfusion-Dependent β-ThalassemiaBloodIntroduction Betibeglogene autotemcel (beti-cel; LentiGlobin for β-thalassemia) gene therapy is being evaluated for the treatment of transfusion-dependent β-thalassemia (TDT). Initial positive results of beti-cel in the phase 3 studiesFull Paper
2020Kwiatkowski, J;Walters, M;Hongeng, S;Locatelli, F;Rasko, J;Cavazzana, M;Chen, Y;Colvin, R;Thompson, A;Long-Term Efficacy and Safety of Betibeglogene Autotemcel Gene Therapy for the Treatment of Transfusion-Dependent β-Thalassemia: Results in Patients with up to 6 Years of Follow-upBloodIntroduction The goal of betibeglogene autotemcel (beti-cel; LentiGlobin for β-thalassemia) gene therapy in patients with transfusion-dependent β-thalassemia (TDT) is lifelong, stable production of functional adult hemoglobin (Hb) suffFull Paper
2020Thompson, A;Walters, M;Mapara, M;Kwiatkowski, J;Krishnamurti, L;Aygun, B;Kasow, K;Rifkin-Zenenberg, S;Schmidt, M;DelCarpini, J;Pierciey, F;Miller, A;Gallagher, M;Chen, R;Goyal, S;Kanter, J;Tisdale, J;Resolution of Serious Vaso-Occlusive Pain Crises and Reduction in Patient-Reported Pain Intensity: Results from the Ongoing Phase 1/2 HGB-206 Group C Study of LentiGlobin for Sickle Cell Disease (bb1111) Gene TherapyBloodBackground Sickle cell disease (SCD) is caused by abnormal sickle hemoglobin (HbS) and results in chronic hemolytic anemia, painful vaso-occlusive events (VOEs), and progressive vasculopathy that lead to significant morbidity. While acFull Paper
2020Rothe, K;Babaian, A;Nakamichi, N;Chen, M;Chafe, SC;Watanabe, A;Forrest, DL;Mager, DL;Eaves, CJ;Dedhar, S;Jiang, X;Integrin-Linked Kinase Mediates Therapeutic Resistance of Quiescent CML Stem Cells to Tyrosine Kinase InhibitorsCell stem cell32413332Full Paper
2020Nakao, S;Arai, Y;Tasaki, M;Yamashita, M;Murakami, R;Kawase, T;Amino, N;Nakatake, M;Kurosaki, H;Mori, M;Takeuchi, M;Nakamura, T;Intratumoral expression of IL-7 and IL-12 using an oncolytic virus increases systemic sensitivity to immune checkpoint blockadeScience translational medicine31941828hIL-7/hIL-12-VV at MOI 1.0 and cultured for 2 days. Then, the supernatant was filtered through 0.1-μm polyvinylidene difluoride membrane (Millipore) and added to 1 × 105 human PBMCs (AllCells) in a 96-well plate. Seven days later, secretion of humanFull Paper
2020Geng, J;Liu, W;Zhou, H;Zhang, T;Wang, L;Zhang, M;Li, Y;Shen, B;Li, X;Xiao, B;A Plug-and-Latch Mechanism for Gating the Mechanosensitive Piezo ChannelNeuron32142647HEK293T Xiao et al., 2011 N/A HEK293T-Piezo1-KO Cahalan et al., 2015 N/A HUVEC Allcells Cat# H-001F-C HeLa Xiao et al., 2011 N/A N2A Coste et al., 2010 N/A C2C12 National Infrastructure of Cell line Source, China Cat# GNM26Full Paper
2020Fang, C;Wang, Z;Han, C;Safgren, SL;Helmin, KA;Adelman, ER;Serafin, V;Basso, G;Eagen, KP;Gaspar-Maia, A;Figueroa, ME;Singer, BD;Ratan, A;Ntziachristos, P;Zang, C;Cancer-specific CTCF binding facilitates oncogenic transcriptional dysregulationGenome biology32933554Human CD4 + T cells were purchased from AllCells. Primary human samples were collected with informed consent and analyzed under the supervision of the Institutional Review Board SaveFull Paper
2020Li, M;Liu, W;Bauch, T;Graviss, EA;Arduino, RC;Kimata, JT;Chen, M;Wang, J;Clearance of HIV infection by selective elimination of host cells capable of producing HIVNature communications32792548pecific-pathogen-free barrier animal facility at the Houston Methodist Research Institute. Newborn male and female mice were injected intrahepatically with CD34+ human stem cells (5 × 104/mouse; AllCells LLC). Three months later, reconstitution of huFull Paper
2020Scharenberg, SG;Poletto, E;Lucot, KL;Colella, P;Sheikali, A;Montine, TJ;Porteus, MH;Gomez-Ospina, N;Engineering monocyte/macrophage-specific glucocerebrosidase expression in human hematopoietic stem cells using genome editingNature communications32620863Human CD34+ HSPCs mobilized from peripheral blood were purchased frozen from AllCells (Almeda, CA, USA) and thawed per manufacturer's instructions. Human Cord blood was SaveFull Paper
2020Wienert, B;Nguyen, DN;Guenther, A;Feng, SJ;Locke, MN;Wyman, SK;Shin, J;Kazane, KR;Gregory, GL;Carter, MAM;Wright, F;Conklin, BR;Marson, A;Richardson, CD;Corn, JE;Timed inhibition of CDC7 increases CRISPR-Cas9 mediated templated repairNature communications32355159Cryopreserved wildtype human mobilized peripheral blood CD34 + HSPCs from volunteer donors were purchased from Allcells, and were cultured in SFEMII + CC110 (StemCell SaveFull Paper
2020Lareau, CA;Ma, S;Duarte, FM;Buenrostro, JD;Inference and effects of barcode multiplets in droplet-based single-cell assaysNature communications32054859lues have been published, these values were approximated from an examination of a plot previously reported2. Profiling PBMCs using 10× scATAC-seq For 10× scATAC-seq experiments with PBMCs (PB003F, Allcells), frozen cells were quickly thawed in a 37Full Paper
2020Mahuron, KM;Moreau, JM;Glasgow, JE;Boda, DP;Pauli, ML;Gouirand, V;Panjabi, L;Grewal, R;Luber, JM;Mathur, AN;Feldman, RM;Shifrut, E;Mehta, P;Lowe, MM;Alvarado, MD;Marson, A;Singer, M;Wells, J;Jupp, R;Daud, AI;Rosenblum, MD;Layilin augments integrin activation to promote antitumor immunityThe Journal of experimental medicine32539073Human peripheral blood mononuclear cells (PBMCs) from two individual donors were purchased from AllCells. CD8 + T cells were enriched from these samples using a negative SaveFull Paper
2020Poran, A;Scherer, J;Bushway, ME;Besada, R;Balogh, KN;Wanamaker, A;Williams, RG;Prabhakara, J;Ott, PA;Hu-Lieskovan, S;Khondker, ZS;Gaynor, RB;Rooney, MS;Srinivasan, L;Combined TCR Repertoire Profiles and Blood Cell Phenotypes Predict Melanoma Patient Response to Personalized Neoantigen Therapy plus Anti-PD-1Cell reports. Medicine33294862Patient PBMCs from NT-001 trial Ott et al., 2020 N/A Healthy Donor PBMCs Precision for Medicine Cat # 93000-10M Healthy Donor PBMCs StemExpress Cat # LE010F Healthy Donor PBMCs AllCells https://www.allcells.com/tissue-products/Full Paper
2020Huang, H;Zhu, H;Xie, Q;Tian, X;Yang, X;Feng, F;Jiang, Q;Sheng, X;Yang, Z;Evaluation of 124I-JS001 for hPD1 immuno-PET imaging using sarcoma cell homografts in humanized miceActa pharmaceutica Sinica. B32874831The human OS-732 cell line was purchased from the Institute of Cancer, Chinese Academy of Medical Sciences (Beijing, China). Normal peripheral blood T cells and CD3+ pan T cells were obtained from AllCells (PB009-1F-C, Emeryville, CA, USA). PhytohemaFull Paper
2020Poran, A;Harjanto, D;Malloy, M;Arieta, CM;Rothenberg, DA;Lenkala, D;van Buuren, MM;Addona, TA;Rooney, MS;Srinivasan, L;Gaynor, RB;Sequence-based prediction of SARS-CoV-2 vaccine targets using a mass spectrometry-based bioinformatics predictor identifies immunogenic T cell epitopesGenome medicine32791978Human PBMCs from HLA-A02:01-positive human donors were isolated using Ficoll separation from apheresis material (AllCells, USA). Twenty-three SARS-CoV-2 peptides predicted to SaveFull Paper
2020Goodwin, M;Lee, E;Lakshmanan, U;Shipp, S;Froessl, L;Barzaghi, F;Passerini, L;Narula, M;Sheikali, A;Lee, CM;Bao, G;Bauer, CS;Miller, HK;Garcia-Lloret, M;Butte, MJ;Bertaina, A;Shah, A;Pavel-Dinu, M;Hendel, A;Porteus, M;Roncarolo, MG;Bacchetta, R;CRISPR-based gene editing enables FOXP3 gene repair in IPEX patient cellsScience advances32494707families. Additional healthy donor HSPCs were isolated from umbilical cord blood donors provided by the Binns Program for Cord Blood Research at the Stanford University or purchased commercially from AllCells or StemCell Technologies. For HSPC isolatFull Paper
2020Grozdanovic, MM;Doyle, CB;Liu, L;Maybruck, BT;Kwatia, MA;Thiyagarajan, N;Acharya, KR;Ackerman, SJ;Charcot-Leyden crystal protein/galectin-10 interacts with cationic ribonucleases and is required for eosinophil granulogenesisThe Journal of allergy and clinical immunology31982451Purified human CD34 + cord blood-derived hematopoietic progenitor cells were purchased from AllCells (Emeryville, Calif) and cultured in Iscove modified Dulbecco medium SaveFull Paper
2020Lundin, V;Sugden, WW;Theodore, LN;Sousa, PM;Han, A;Chou, S;Wrighton, PJ;Cox, AG;Ingber, DE;Goessling, W;Daley, GQ;North, TE;YAP Regulates Hematopoietic Stem Cell Formation in Response to the Biomechanical Forces of Blood FlowDevelopmental cell32032546Cord Blood CD34+ Cells AllCells Cat. CB008F mPB CD34+ Cells AllCells Cat. mPB015F Mouse Embryonic Fibroblasts GlobalStem Cat. 6001G Primary Human Umbilical Vein Endothelial Cells ThermoFisher Cat. C0155CFull Paper
2020Duncan, RM;Reyes, L;Moats, K;Robinson, RM;Murphy, SA;Kaur, B;Stessman, HAF;Dolloff, NG;ATF3 Coordinates Antitumor Synergy between Epigenetic Drugs and Protein Disulfide Isomerase InhibitorsCancer research32561529T cells were expanded from human peripheral blood monoleukocytes purchased from AllCells LLC (PB006F). All cells were maintained at 37C and 5% CO 2 . Experiments were SaveFull Paper
2020Yeung, YA;Krishnamoorthy, V;Dettling, D;Sommer, C;Poulsen, K;Ni, I;Pham, A;Chen, W;Liao-Chan, S;Lindquist, K;Chin, SM;Chunyk, AG;Hu, W;Sasu, B;Chaparro-Riggers, J;Djuretic, I;An Optimized Full-Length FLT3/CD3 Bispecific Antibody Demonstrates Potent Anti-leukemia Activity and Reversible Hematological ToxicityMolecular therapy : the journal of the American Society of Gene Therapy31981494After tumor engraftment (day 6-7), animals were administered 2 × 10 7 expanded human T cells (T cells purchased from Allcells; activated according to Miltenyi manufacturing protocol) SaveFull Paper
2020Morgan, RA;Unti, MJ;Aleshe, B;Brown, D;Osborne, KS;Koziol, C;Ayoub, PG;Smith, OB;O'Brien, R;Tam, C;Miyahira, E;Ruiz, M;Quintos, JP;Senadheera, S;Hollis, RP;Kohn, DB;Improved Titer and Gene Transfer by Lentiviral Vectors Using Novel, Small β-Globin Locus Control Region ElementsMolecular therapy : the journal of the American Society of Gene Therapy31628051All BM aspirates were obtained from voluntary healthy donors supplied by AllCells (Alameda, CA), which obviated the need for Instituional Review Board review. BM mononuclear cells SaveFull Paper
2020Sinnakannu, JR;Lee, KL;Cheng, S;Li, J;Yu, M;Tan, SP;Ong, CCH;Li, H;Than, H;Anczuków-Camarda, O;Krainer, AR;Roca, X;Rozen, SG;Iqbal, J;Yang, H;Chuah, C;Ong, ST;SRSF1 mediates cytokine-induced impaired imatinib sensitivity in chronic myeloid leukemiaLeukemia32051529at the Singapore General Hospital, cord blood samples were obtained from the Singapore Cord Blood Bank, and normal bone marrow cells were obtained commercially from AllCells ( SaveFull Paper
2020Korotchkina, L;Kazyulkin, D;Komarov, PG;Polinsky, A;Andrianova, EL;Joshi, S;Gupta, M;Vujcic, S;Kononov, E;Toshkov, I;Tian, Y;Krasnov, P;Chernov, MV;Veith, J;Antoch, MP;Middlemiss, S;Somers, K;Lock, RB;Norris, MD;Henderson, MJ;Haber, M;Chernova, OB;Gudkov, AV;OT-82, a novel anticancer drug candidate that targets the strong dependence of hematological malignancies on NAD biosynthesisLeukemia31896781Normal human bone marrow mononuclear cells (BM-MNC) were obtained from ALLCELLS, LLC (Almeda CA, USA). Patients’ BM-MNC were procured at the Hematologic Bank of RPCCC and NAMPT monoclonal antibody (clone OMNI 379) was obtained from Cayman Chemicals (Full Paper
2020Kravtsova-Ivantsiv, Y;Goldhirsh, G;Ivantsiv, A;Ben Itzhak, O;Kwon, YT;Pikarsky, E;Ciechanover, A;Excess of the NF-ĸB p50 subunit generated by the ubiquitin ligase KPC1 suppresses tumors via PD-L1- and chemokines-mediated mechanismsProceedings of the National Academy of Sciences of the United States of America33168738Human PBMCs as a source for isolating human NK cells were from AllCells. Mouse anti-CD274 (PD-L1) (29E.2A3) and mouse anti-CD45 (HI30) for mass cytometry were from Bio SaveFull Paper
2020Ojaghi, A;Carrazana, G;Caruso, C;Abbas, A;Myers, DR;Lam, WA;Robles, FE;Label-free hematology analysis using deep-ultraviolet microscopyProceedings of the National Academy of Sciences of the United States of America32561645bone marrow aspirate was collected from healthy donors (AllCells) and added to Na heparin anticoagulant solution. Smears were made on uncoated quartz slides using 10 μL of whole SaveFull Paper
2020Huang, P;Zhao, Y;Zhong, J;Zhang, X;Liu, Q;Qiu, X;Chen, S;Yan, H;Hillyer, C;Mohandas, N;Pan, X;Xu, X;Putative regulators for the continuum of erythroid differentiation revealed by single-cell transcriptome of human BM and UCB cellsProceedings of the National Academy of Sciences of the United States of America32457162CD34 + stem/progenitor cells (AllCells) were obtained from three mobilized BM and three neonate UCB samples from independent donors. Cells were expanded at 37 C and 5% CO 2 SaveFull Paper
2020Belling, JN;Heidenreich, LK;Tian, Z;Mendoza, AM;Chiou, TT;Gong, Y;Chen, NY;Young, TD;Wattanatorn, N;Park, JH;Scarabelli, L;Chiang, N;Takahashi, J;Young, SG;Stieg, AZ;De Oliveira, S;Huang, TJ;Weiss, PS;Jonas, SJ;Acoustofluidic sonoporation for gene delivery to human hematopoietic stem and progenitor cellsProceedings of the National Academy of Sciences of the United States of America32358194Mixed donor umbilical cord CD34+ Hematopoietic stem and progenitor cells (Allcells Inc.) were thawed and prestimulated as described by Hoban et al. (44). Postacoustofluidic treatment, HSPCs were cultured in X-VIVO 15 supplemented with 50 ng/μL recombFull Paper
2020Borodovsky, A;Barbon, CM;Wang, Y;Ye, M;Prickett, L;Chandra, D;Shaw, J;Deng, N;Sachsenmeier, K;Clarke, JD;Linghu, B;Brown, GA;Brown, J;Congreve, M;Cheng, RK;Dore, AS;Hurrell, E;Shao, W;Woessner, R;Reimer, C;Drew, L;Fawell, S;Schuller, AG;Mele, DA;Small molecule AZD4635 inhibitor of A2AR signaling rescues immune cell function including CD103+ dendritic cells enhancing anti-tumor immunityJournal for immunotherapy of cancer3272781001 individuals. As previously described,38 naïve CD8+ T cells were co-cultured with autologous monocyte-derived DCs, both cell populations isolated from PBMC from HLA-A*0201 positive healthy donors (AllCells, Research Blood Components). Monocytes werFull Paper
2020Kotanides, H;Li, Y;Malabunga, M;Carpenito, C;Eastman, SW;Shen, Y;Wang, G;Inigo, I;Surguladze, D;Pennello, AL;Persaud, K;Hindi, S;Topper, M;Chen, X;Zhang, Y;Bulaon, DK;Bailey, T;Lao, Y;Han, B;Torgerson, S;Chin, D;Sonyi, A;Haidar, JN;Novosiadly, RD;Moxham, CM;Plowman, GD;Ludwig, DL;Kalos, M;Bispecific Targeting of PD-1 and PD-L1 Enhances T-cell Activation and Antitumor ImmunityCancer immunology research32873605Monocytes were isolated from frozen normal peripheral blood mononuclear cells (PBMC) purchased from AllCells (PB005F) using Monocyte Isolation Kit (Miltenyi Biotec; 130-091-153). Immature DCs were generated by culturing the monocytes in RPMI1640 mediFull Paper
2020Liu, Y;Lv, S;Liu, D;Song, F;Recent development of amorphous metal coordination polymers for cancer therapyActa biomaterialia32942012e) IC 50 values obtained from cytotoxicity assays against Jurkat human ALLcells after incubating with free MTX, Gd-MTX, [email protected]/DOPE, and [email protected]/DOPE-AA. f) SaveFull Paper
2020Fujita, H;Sasaki, T;Miyamoto, T;Akutsu, SN;Sato, S;Mori, T;Nakabayashi, K;Hata, K;Suzuki, H;Kosaki, K;Matsuura, S;Matsubara, Y;Amagai, M;Kubo, A;Premature aging syndrome showing random chromosome number instabilities with CDC20 mutationAging cell33094908An age-matched normal control bone marrow mononuclear cell sample was obtained from AllCells. Cells were cultured in MethoCult H4034 Optimum (STEMCELL Technologies) at 1 × SaveFull Paper
2020Yao, X;Ding, J;Effects of Microstripe Geometry on Guided Cell MigrationACS applied materials & interfaces32479054Primary rat mesenchymal stem cells (rMSCs) were purchased from Shanghai Allcells Tech. (China) and cultured in minimum essential medium α (MEM α, Gibco). Mouse embryo fibroblast cell line (NIH3T3) and human cervix epithelial carcinoma cell line (HelaFull Paper
2020Yang, H;Qing, K;Keeler, GD;Yin, L;Mietzsch, M;Ling, C;Hoffman, BE;Agbandje-McKenna, M;Tan, M;Wang, W;Srivastava, A;Enhanced Transduction of Human Hematopoietic Stem Cells by AAV6 Vectors: Implications in Gene Therapy and Genome EditingMolecular therapy. Nucleic acids32276210D, USA) supplemented with 10% fetal bovine serum (FBS; Sigma, St. Louis, MO, USA) and 1% penicillin-streptomycin (Invitrogen, Grand Island, NY, USA). Human bone marrow CD34+ cells were purchased from AllCells (AllCells Technologies, Emeryville, CA, UFull Paper
2020Shin, JJ;Schröder, MS;Caiado, F;Wyman, SK;Bray, NL;Bordi, M;Dewitt, MA;Vu, JT;Kim, WT;Hockemeyer, D;Manz, MG;Corn, JE;Controlled Cycling and Quiescence Enables Efficient HDR in Engraftment-Enriched Adult Hematopoietic Stem and Progenitor CellsCell reports32877675RNA-sequencing datasets This paper BioProject ID PRJNA498122 ------------------------- Experimental Models ------------------------- Mobilized peripheral blood CD34+ Stem/Progenitor cells AllCells mPB015F NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzFull Paper
2020Nie, W;Zan, X;Yu, T;Ran, M;Hong, Z;He, Y;Yang, T;Ju, Y;Gao, X;Synergetic therapy of glioma mediated by a dual delivery system loading α-mangostin and doxorubicin through cell cycle arrest and apoptotic pathwaysCell death & disease33116114animals The glioma cell lines C6, Gl261 and U87 and human umbilical vein endothelial cells (HUVECs) were purchased from the American Type Culture Collection (ATCC). Primary HUVECs were purchased from ALLCELLS (Shanghai, China). An EGM-2 BulletKit (LoFull Paper
2020Zhang, XY;Rajagopalan, D;Chung, TH;Hooi, L;Toh, TB;Tian, JS;Rashid, MBMA;Sahib, NRBM;Gu, M;Lim, JJ;Wang, W;Chng, WJ;Jha, S;Chow, EK;Frequent upregulation of G9a promotes RelB-dependent proliferation and survival in multiple myelomaExperimental hematology & oncology32477831e), 1% Pen Strep (Invitrogen). For adherent cell lines, trypsin (Thermo Scientific, cat# 25200-056) was used to dissociate cells each passage. Cryopreserved Peripheral Blood Mononuclear Cells (PBMCs, AllCells) were cultured in RPMI 1640 medium (BioWeFull Paper
2020Qian, Z;Fei, J;Zong, S;Yang, K;Li, L;Liu, R;Wang, Z;Cui, Y;In Situ Visualization and SERS Monitoring of the Interaction between Tumor and Endothelial Cells Using 3D Microfluidic NetworksACS sensors31885254Human umbilical vein endothelial cells (HUVEC) were purchased from Shanghai AllCells Biotech. Co., Ltd. Breast cancer cells (MCF7) were purchased from Nanjing KeyGen Biotech. Co., Ltd. The Roswell Park Memorial Institute (RMPI) 1640 cell culture mediFull Paper
2020Kim, YH;Park, GY;Rabinovitch, N;Tarafder, S;Lee, CH;Effect of local anesthetics on viability and differentiation of various adult stem/progenitor cellsStem cell research & therapy32894184udy that directly compared the effects of LAs across various stem/progenitor cells. Materials and methods Cell isolation Human bone marrow mesenchymal stem/progenitor cells (MSCs) were obtained from AllCells (Alameda, CA). With the Institutional RevFull Paper
2020Xiong, MG;Xu, ZS;Li, YH;Wang, SY;Wang, YY;Ran, Y;RNF152 positively regulates TLR/IL-1R signaling by enhancing MyD88 oligomerizationEMBO reports31930677HEK293T cells were purchased from ATCC. Human PBMCs were purchased from ALLCELLS. HFFs provided by Prof. Min‐Hua Luo (Wuhan Institute of Virology, CAS) were derived from human foreskins (male) 30. These cells were cultured in DMEM (HyClone) supplemenFull Paper
2020Han, Y;Gong, T;Zhang, C;Dissanayaka, WL;HIF-1α Stabilization Enhances Angio-/Vasculogenic Properties of SHEDJournal of dental research32298193SHED were purchased from AllCells at passage 2 and characterized for mesenchymal origin. The results were published in our previous study (Xu et al. 2017). The cells were cultured in α-Modified Eagle’s Medium supplemented with 10% (v/v) fetal bovineFull Paper
2020Maser, IP;Hoves, S;Bayer, C;Heidkamp, G;Nimmerjahn, F;Eckmann, J;Ries, CH;The Tumor Milieu Promotes Functional Human Tumor-Resident Plasmacytoid Dendritic Cells in Humanized Mouse ModelsFrontiers in immunology33013879sulfan (Busilvex ,Pierre Faber) diluted in 0.9% Saline (Braun) was injected intraperitoneally (i.p.). Twenty-four hours later 105 human CD34+ umbilical cord blood-derived HSC (Stem Cell Technologies/Allcells) in 100 μl phosphate-buffered saline (PBS)Full Paper
2020Ghelani, A;Bates, D;Conner, K;Wu, MZ;Lu, J;Hu, YL;Li, CM;Chaudhry, A;Sohn, SJ;Defining the Threshold IL-2 Signal Required for Induction of Selective Treg Cell Responses Using Engineered IL-2 MuteinsFrontiers in immunology32582190CD8+ T cells were purified from PBMCs isolated from healthy human donor derived leukopaks (AllCells) using EasySep CD8+ T cell Negative selection kit (STEMCELL Technologies) SaveFull Paper
2020Shen, S;Sckisel, G;Sahoo, A;Lalani, A;Otter, DD;Pearson, J;DeVoss, J;Cheng, J;Casey, SC;Case, R;Yang, M;Low, R;Daris, M;Fan, B;Agrawal, NJ;Ali, K;Engineered IL-21 Cytokine Muteins Fused to Anti-PD-1 Antibodies Can Improve CD8+ T Cell Function and Anti-tumor ImmunityFrontiers in immunology32457754Mismatched donor pair leukopaks were obtained from AllCells Inc., Donor's T cells were isolated using Pan T-cell Isolation Kit (Miltenyi Biotec, # 130-096-535) and a mismatched donor' SaveFull Paper
2020Porcellini, S;Asperti, C;Corna, S;Cicoria, E;Valtolina, V;Stornaiuolo, A;Valentinis, B;Bordignon, C;Traversari, C;CAR T Cells Redirected to CD44v6 Control Tumor Growth in Lung and Ovary Adenocarcinoma Bearing MiceFrontiers in immunology32117253in of the ΔLNGFr (12). Generation of CD44v6 and CD19 CAR T Cells Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats or leukapheresis of healthy donors (San Raffaele Hospital; AllCells) by density gradient centrifugation (LymphFull Paper
2020Baslan, T;Kendall, J;Volyanskyy, K;McNamara, K;Cox, H;D'Italia, S;Ambrosio, F;Riggs, M;Rodgers, L;Leotta, A;Song, J;Mao, Y;Wu, J;Shah, R;Gularte-Mérida, R;Chadalavada, K;Nanjangud, G;Varadan, V;Gordon, A;Curtis, C;Krasnitz, A;Dimitrova, N;Harris, L;Wigler, M;Hicks, J;Novel insights into breast cancer copy number genetic heterogeneity revealed by single-cell genome sequencingeLife32401198ta (i.e. ploidy) to achieve absolute copy number values. T-cell and B-cell sample processing and analysis Purified CD8+/CD4+ T-cells and CD19+/CD27+ memory B-cells purified cells were purchased from ALLCELLS (California, USA). Cells were thawed on iFull Paper
2020Münchow, EA;da Silva, AF;Piva, E;Cuevas-Suárez, CE;de Albuquerque, MTP;Pinal, R;Gregory, RL;Breschi, L;Bottino, MC;Development of an antibacterial and anti-metalloproteinase dental adhesive for long-lasting resin composite restorationsJournal of materials chemistry. B33169763Human dental pulp stem cells (hDPSCs, AllCells, LLC, Alameda, CA, USA) obtained from permanent third molars were cultured in low glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Invitrogen Corporation, Grand Island, NY, USA) supplemented withFull Paper
2020Warnecke, A;Harre, J;Staecker, H;Prenzler, N;Strunk, D;Couillard-Despres, S;Romanelli, P;Hollerweger, J;Lassacher, T;Auer, D;Pachler, K;Wietzorrek, G;Köhl, U;Lenarz, T;Schallmoser, K;Laner-Plamberger, S;Falk, CS;Rohde, E;Gimona, M;Extracellular vesicles from human multipotent stromal cells protect against hearing loss after noise trauma in vivoClinical and translational medicine33377658Human bone marrow (BM)-derived MSCs for the production of research-grade EV preparations were purchased from AllCells (Alameda, CA). Immunophenotype and viability analysis of SaveFull Paper
2020Pinho, AC;Fonseca, AC;Caseiro, AR;Pedrosa, SS;Amorim, I;Branquinho, MV;Domingos, M;Maurício, AC;Santos, JD;Serra, AC;Coelho, JFJ;Innovative tailor made dextran based membranes with excellent non-inflammatory response: In vivo assessmentMaterials science & engineering. C, Materials for biological applications31761159Human dental pulp stem cells (hDPSCs) were obtained from AllCells, LLC (Cat. DP0037F, Lot No. DPSC090411-01). Minimum Essential Medium (MEM) α, GlutaMAX™ Supplement, no nucleosides, Streptomycin, Amphotericin B and HEPES buffer solution were purchaseFull Paper
2020Wang, J;Ganaie, SS;Cheng, F;Xu, P;Ning, K;Wang, X;Kleiboeker, S;Cheng, S;Qiu, J;RNA Binding Motif Protein RBM45 Regulates Expression of the 11-Kilodalton Protein of Parvovirus B19 through Binding to Novel Intron Splicing EnhancersmBio32156816se conditions are dependent on RBM45. MATERIALS AND METHODS Ethics statement. Primary CD34+ hematopoietic stem cells were isolated from bone marrow of healthy human donors. We purchased the cells at AllCells (AllCells LLC, Alameda, CA). All of the cFull Paper
2020Dubrovsky, L;Ward, A;Choi, SH;Pushkarsky, T;Brichacek, B;Vanpouille, C;Adzhubei, AA;Mukhamedova, N;Sviridov, D;Margolis, L;Jones, RB;Miller, YI;Bukrinsky, M;Inhibition of HIV Replication by Apolipoprotein A-I Binding Protein Targeting the Lipid RaftsmBio31964734PBMCs from donors with the following HLA-B genotypes were purchased from AllCells Inc.: B*35 positive (B*15:17:01/B*35:01:01, B*35:01:01/B*55:01:01, B*35:01:01/B*35:01:01, B*35: SaveFull Paper
2020Han, KH;Arlian, BM;Lin, CW;Jin, HY;Kang, GH;Lee, S;Lee, PC;Lerner, RA;Agonist Antibody Converts Stem Cells into Migrating Brown Adipocyte-Like Cells in HeartCells31968623one, Chicago, IL, USA) and 1% penicillin and streptomycin (Invitrogen, Carlsbad, CA, USA). Expi293F cells were cultured in Expi293 Expression Media (Invitrogen, Carlsbad, CA, USA). Human CD34+ cells (AllCells, Alameda, CA, USA) were purchased and repFull Paper
2020Zimran, E;Papa, L;Djedaini, M;Patel, A;Iancu-Rubin, C;Hoffman, R;Expansion and preservation of the functional activity of adult hematopoietic stem cells cultured ex vivo with a histone deacetylase inhibitorStem cells translational medicine31950644Cryopreserved CD34+ cells from mPB or ABM from healthy adult donors were purchased from AllCells (Alameda, California) and stored in liquid nitrogen. The highly purified (90%-98% SaveFull Paper
2020George, MJ;Prabhakara, K;Toledano-Furman, NE;Gill, BS;Wade, CE;Cotton, BA;Cap, AP;Olson, SD;Cox, CS;Procoagulant in vitro effects of clinical cellular therapeutics in a severely injured trauma populationStem cells translational medicine31903737Bone marrow mononuclear cells (BM MNCs) were isolated from fresh whole bone marrow from a commercial source (AllCells, Emeryville, California) according to common protocols SaveFull Paper
2020Hou, L;Voit, RA;Sankaran, VG;Springer, TA;Yuki, K;CD11c regulates hematopoietic stem and progenitor cells under stressBlood advances33351105Human bone marrow cells and whole blood were purchased from AllCells (Quincy, MA). Lineage marker for human hematopoietic system includes: anti-hCD2 (RPA-2.10), anti-hCD3 ( SaveFull Paper
2020Mascarenhas, JO;Rampal, RK;Kosiorek, HE;Bhave, R;Hexner, E;Wang, ES;Gerds, A;Abboud, CN;Kremyanskaya, M;Berenzon, D;Odenike, O;Farnoud, N;Krishnan, A;Weinberg, RS;McGovern, E;Salama, ME;Najfeld, V;Medina-Martinez, JS;Arango Ossa, JE;Levine, MF;Zhou, Y;Sandy, L;Heaney, ML;Levine, RL;Mesa, RA;Dueck, AC;Hoffman, R;Phase 2 study of ruxolitinib and decitabine in patients with myeloproliferative neoplasm in accelerated and blast phaseBlood advances33104796Six control plasma samples (3 male, 3 female) collected from healthy donors between the ages of 30 and 50 years were procured from Allcells. Samples from 8 chronic-phase MF SaveFull Paper
2020Marion, W;Boettcher, S;Ruiz-Torres, S;Lummertz da Rocha, E;Lundin, V;Morris, V;Chou, S;Zhao, AM;Kubaczka, C;Aumais, O;Zhang, Y;Shimamura, A;Schlaeger, TM;North, TE;Ebert, BL;Wells, SI;Daley, GQ;Rowe, RG;An induced pluripotent stem cell model of Fanconi anemia reveals mechanisms of p53-driven progenitor cell differentiationBlood advances33002135Institutional Review Board at Boston Children’s Hospital, after informed consent was obtained. This study was performed in accordance with the Declaration of Helsinki. Normal healthy BM mononuclear cells were purchased from AllCellsFull Paper
2020Goldstein, RL;Goyos, A;Li, CM;Deegen, P;Bogner, P;Sternjak, A;Thomas, O;Klinger, M;Wahl, J;Friedrich, M;Rattel, B;Lamas, E;Min, X;Sudom, A;Farshbaf, M;Coxon, A;Balazs, M;Arvedson, T;AMG 701 induces cytotoxicity of multiple myeloma cells and depletes plasma cells in cynomolgus monkeysBlood advances32886754For staining of human PCs, human BM (AllCells) was stained with a fluorochrome-labeled antibody cocktail (supplemental Table 5). For analysis, doublets were gated out, and dead SaveFull Paper
2020Walker, ZJ;VanWyngarden, MJ;Stevens, BM;Abbott, D;Hammes, A;Langouët-Astrie, C;Smith, CA;Palmer, BE;Forsberg, PA;Mark, TM;Jordan, CT;Sherbenou, DW;Measurement of ex vivo resistance to proteasome inhibitors, IMiDs, and daratumumab during multiple myeloma progressionBlood advances32311014Normal donor samples were purchased from AllCells. For viability comparison with MM cells in MNC cultures, selection for CD138-positive cells was performed by using magnetic bead SaveFull Paper
2020Romero-Masters, JC;Huebner, SM;Ohashi, M;Bristol, JA;Benner, BE;Barlow, EA;Turk, GL;Nelson, SE;Baiu, DC;Van Sciver, N;Ranheim, EA;Gumperz, J;Sherer, NM;Farrell, PJ;Johannsen, EC;Kenney, SC;B cells infected with Type 2 Epstein-Barr virus (EBV) have increased NFATc1/NFATc2 activity and enhanced lytic gene expression in comparison to Type 1 EBV infectionPLoS pathogens32059024ized NSG mice Immunodeficient NSG (NOD/LtSz-scid/IL2Rγnull) mice were purchased from Jackson labs (catalogue number: 005557). Commercially available CD34-depleted human cord blood mononuclear cells (AllCells, LLC) were infected with various amounts oFull Paper
2020Shao, S;Qin, T;Qian, W;Li, X;Li, W;Han, L;Zhang, D;Wang, Z;Ma, Q;Wu, Z;Wu, E;Lei, J;Cav-1 Ablation in Pancreatic Stellate Cells Promotes Pancreatic Cancer Growth through Nrf2-Induced shh SignalingOxidative medicine and cellular longevity32377291iated Hospital of Xi'an Jiaotong University, China. 2.3. Cell Lines Aspc-1 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), and HUVECs were obtained from ALLCELLS (Emeryville, California, USA). In our expFull Paper
2020Liu, H;Cheng, Q;Xu, DS;Wang, W;Fang, Z;Xue, DD;Zheng, Y;Chang, AH;Lei, YJ;Overexpression of CXCR7 accelerates tumor growth and metastasis of lung cancer cellsRespiratory research33129326Human umbilical vein endothelial cells (HUVECs) and its completed medium were obtained from AllCells biological technology (Shanghai) co., LTD. And all these cell lines were SaveFull Paper
2020Cheng, B;Ren, Y;Cao, H;Chen, J;Discovery of novel resorcinol diphenyl ether-based PROTAC-like molecules as dual inhibitors and degraders of PD-L1European journal of medicinal chemistry32388281CD3 single chain variable fragment) and human PD-L1 (hPD-L1). Fresh PBMCs were purchased from ALLCELLS. Centrifuge at 350g for 10 min, discard the supernatant and resuspend in EasySep buffer at a density of 5 x107/mL. CD3+ T cells were isolated fromFull Paper
2020Zhang, D;Qi, BY;Zhu, WW;Huang, X;Wang, XZ;Crocin alleviates lipopolysaccharide-induced acute respiratory distress syndrome by protecting against glycocalyx damage and suppressing inflammatory signaling pathwaysInflammation research : official journal of the European Histamine Research Society ... [et al.]31925528HUVECs were cultured in complete culture medium (AllCells, Shanghai, China) in an incubator with a humidified atmosphere of 95% air and 5% CO 2 at 37 C. Cells at 80-90% SaveFull Paper
2020Kuang, Z;Jing, H;Wu, Z;Wang, J;Li, Y;Ni, H;Zhang, P;Wu, W;Wu, M;Zhou, S;Qiu, X;Wu, D;Prinz, B;Baruah, H;Chen, B;Yu, M;Liu, J;Development and characterization of a novel anti-OX40 antibody for potent immune activationCancer immunology, immunotherapy : CII32078015Two million LoVo cells suspended in 0.2 ml PBS were mixed with 0.66 million human peripheral blood mononuclear cells (PBMCs, ALLCELLS) and co-implanted subcutaneously in the SaveFull Paper
2020Yao, Y;Yang, J;Qin, Q;Tang, C;Li, Z;Chen, L;Li, K;Ren, C;Chen, L;Rao, S;Functional annotation of genetic associations by transcriptome-wide association analysis provides insights into neutrophil development regulationCommunications biology33340029Human CD34 + HSPCs from mobilized peripheral blood of deidentified healthy donors were purchased from AllCells. CD34 + HSPCs were cultured in StemSpan SFEM medium ( SaveFull Paper
2020Mendes, LP;Rostamizadeh, K;Gollomp, K;Myerson, JW;Marcos-Contreras, OA;Zamora, M;Luther, E;Brenner, JS;Filipczak, N;Li, X;Torchilin, VP;Monoclonal antibody 2C5 specifically targets neutrophil extracellular trapsmAbs33323006Whole blood was purchased from AllCells (AllCells utilizes standardized operating HIPAA compliance and approved protocols are followed by AllCells' collection facilities. The staff SaveFull Paper
2020Zang, L;Song, Y;Yu, F;Liu, X;Emodin relieved lipopolysaccharide-evoked inflammatory damage in WI-38 cells by up-regulating taurine up-regulated gene 1BioFactors (Oxford, England)31912578The human fibroblasts cell line WI-38 (AllCells, Shanghai, China) was hatched in a mixture of Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand Island, NY), endothelial cell development supplement (Sigma, St. Louis, MO) (60 μg/ml), streptomycinFull Paper
2020Subhi, H;Husein, A;Mohamad, D;Nurul, A;Physicochemical, mechanical and cytotoxicity evaluation of chitosan-based accelerated portland cementJournal of Materials Research and TechnologyStem cells from human exfoliated deciduous teeth (SHED) was purchased from AllCells, USA. The cells were cultured in alpha minimum essential medium [Invitrogen, USA (GIBCO)] SaveFull Paper
2020Hu, S;Cavanagh, BL;Harrington, R;Ahmad, M;Kearns, G;Meaney, S;Wynne, C;A Novel Pool of Microparticle Cholesterol Is Elevated in Rheumatoid Arthritis but Not in Systemic Lupus Erythematosus PatientsInternational journal of molecular sciences33287382Microparticles are sub-micron, membrane-bound particles released from virtually allcells and which are present in the circulation. In several autoimmune disorders their amountand SaveFull Paper
2020Wen, W;Song, S;Han, Y;Chen, H;Liu, X;Qian, Q;An efficient Screening System in Yeast to Select a Hyperactive piggyBac Transposase for Mammalian ApplicationsInternational journal of molecular sciences32357554fied eagle medium (DMEM; Corning, Corning, NY, USA) supplemented with 10% fetal calf serum (FBS, Gibco, USA). The human peripheral blood mononuclear cells (PBMC) of healthy donors were purchased from AllCells (AllCells, Silicon Valley, CA, USA) underFull Paper
2020Damodharan, SN;Walker, KL;Forsberg, MH;McDowell, KA;Bouchlaka, MN;Drier, DA;Sondel, PM;DeSantes, KB;Capitini, CM;Analysis of ex vivo expanded and activated clinical-grade human NK cells after cryopreservationCytotherapy32536506All cellular expansions occurred at the WBF under current Good Manufacturing Practice (GMP) quality system guidelines. Fresh leukopacks were commercially obtained (AllCells, Alameda, CA, USA, and Key Biologics, Memphis, TN, USA) from paid human apherFull Paper
2020Chen, Q;Jia, G;Zhao, X;Bao, Y;Zhang, Y;Ozkan, C;Minev, B;Ma, W;Novel Survivin Peptides Screened With Computer Algorithm Induce Cytotoxic T Lymphocytes With Higher Cytotoxic Efficiency to Cancer CellsFrontiers in molecular biosciences33102521PBMCs from five healthy donors were provided by San Diego Blood Bank and Scripps Green Hospital (San Diego, CA, United States). Normal human umbilical cord blood (UCB) CD34+ cells were purchased from AllCells (Alameda, CA, United States). This studyFull Paper
2020Papa, L;Djedaini, M;Martin, TC;Zangui, M;Beaumont, KG;Sebra, R;Parsons, R;Schaniel, C;Hoffman, R;Limited Mitochondrial Activity Coupled With Strong Expression of CD34, CD90 and EPCR Determines the Functional Fitness of ex vivo Expanded Human Hematopoietic Stem CellsFrontiers in cell and developmental biology33384995Cryopreserved CD34 + cells from G-CSF mobilized peripheral blood (PB) or bone marrow (BM) aspirates harvested from healthy adult donors were purchased from AllCells. SaveFull Paper
2020Yao, X;Xie, L;Zeng, Y;MiR-9 Promotes Angiogenesis via Targeting on Sphingosine-1- Phosphate Receptor 1Frontiers in cell and developmental biology32850858and S1P3 in those normal ECs and tumor ECs were compared. The relationships between the significant differentially expressed miR-9 loci and specific S1P receptors were analyzed. Cell Culture HUVECs (Allcells, Shanghai, China) were cultured in HUVECFull Paper
2020Juillerat, A;Tkach, D;Yang, M;Boyne, A;Valton, J;Poirot, L;Duchateau, P;Straightforward Generation of Ultrapure Off-the-Shelf Allogeneic CAR-T CellsFrontiers in bioengineering and biotechnology32671047ndependent T-cell donors. Significance is determined by a standard unpaired t-test, *p ≤ 0.05, **p ≤ 0.01. Materials and Methods T-Cell Proliferation Cryopreserved human PBMCs were acquired from ALLCELLS (cat #PB006F) and used in accordance with CelFull Paper
2020Kuang, Z;Pu, P;Wu, M;Wu, Z;Wang, L;Li, Y;Zhang, S;Jing, H;Wu, W;Chen, B;Liu, J;A Novel Bispecific Antibody with PD-L1-assisted OX40 Activation for Cancer TreatmentMolecular cancer therapeutics32999045Monocyte-derived immature dendrite cells (DC) isolated from human PBMCs (ALLCELLS) were maintained in AIM V medium CTS medium supplemented with GM-CSF (10 ng/mL, R&D SaveFull Paper
2020Kotanides, H;Sattler, RM;Lebron, MB;Carpenito, C;Shen, J;Li, J;Surguladze, D;Haidar, JN;Burns, C;Shen, L;Inigo, I;Pennello, AL;Forest, A;Chen, X;Chin, D;Sonyi, A;Topper, M;Boucher, L;Sharma, P;Zhang, Y;Burtrum, D;Novosiadly, RD;Ludwig, DL;Plowman, GD;Kalos, M;Characterization of 7A5: A Human CD137 (4-1BB) Receptor Binding Monoclonal Antibody with Differential Agonist Properties That Promotes Antitumor ImmunityMolecular cancer therapeutics32241872Human PBMCs were isolated from whole blood or leukopak obtained from NY Blood Center, AllCells, or Biological Specialty using Ficoll density gradient centrifugation (Ficoll-Paque SaveFull Paper
2020Bian, W;Jing, X;Yang, Z;Shi, Z;Chen, R;Xu, A;Wang, N;Jiang, J;Yang, C;Zhang, D;Li, L;Wang, H;Wang, J;Sun, Y;Zhang, C;Downregulation of LncRNA NORAD promotes Ox-LDL-induced vascular endothelial cell injury and atherosclerosisAging32267831(Shanghai, China). The C57BL/6 J mice fed with a normal diet were labeled as the WT control group. Cell culture, RNA interference and Adenovirus infection Primary HUVECs were obtained from Shanghai AllCells Biotech Co., Ltd. (Shanghai, China) and cuFull Paper
2020Karuna, R;Yokokawa, F;Wang, K;Zhang, J;Xu, H;Wang, G;Ding, M;Chan, WL;Abdul Ghafar, N;Leonardi, A;Seh, CC;Seah, PG;Liu, W;Srinivasa, RPS;Lim, SP;Lakshminarayana, SB;Growcott, E;Babu, S;Fenaux, M;Zhong, W;Gu, F;Shi, PY;Blasco, F;Chen, YL;A Cyclic Phosphoramidate Prodrug of 2'-Deoxy-2'-Fluoro-2'-C-Methylguanosine for the Treatment of Dengue Virus InfectionAntimicrobial agents and chemotherapy32958712PBMCs (individual donors) were purchased from AllCells (Alameda, CA) or ReachBio (Seattle, WA). Written consent from the donors was available for all samples. All experiments involving human matrices were approved by the Institutional Review Board ofFull Paper
2020Sebrow, J;Goff, SP;Griffin, DO;Successfully transfected primary peripherally mobilized human CD34+ hematopoietic stem and progenitor cells (HSPCs) demonstrate increased susceptibility to retroviral infectionVirology journal32039735We obtained 293 T cells and Jurkat cells from ATCC, and peripherally mobilized CD34+ HSPCs from individual donors from AllCells (pre-isolated). 293 T cells were cultured in 20 mm X SaveFull Paper
2020Zhong, C;Yu, Q;Jia, W;Yu, X;Yu, D;Yang, M;Wang, L;Ling, C;Zhu, L;Mechanism for enhanced transduction of hematopoietic cells by recombinant adeno-associated virus serotype 6 vectorsFASEB journal : official publication of the Federation of American Societies for Experimental Biology32960474Primary human cord blood-derived CD34 + hematopoietic progenitors (mixed, 80% purity) were purchased from AllCells (Alameda, CA, USA) and cultured in C-IMDM in the presence of 1 ng/mL of recombinant human stem cell factor (rhSCF, BD Bioscience, San DFull Paper
2020Li, L;Wu, Z;Wu, M;Qiu, X;Wu, Y;Kuang, Z;Wang, L;Sun, T;Liu, Y;Yi, S;Jing, H;Zhou, S;Chen, B;Wu, D;Wu, W;Liu, J;IBI112, a selective anti-IL23p19 monoclonal antibody, displays high efficacy in IL-23-induced psoriasiform dermatitisInternational immunopharmacology33069927Mouse (C57BL/6, Beijing Vital River Laboratory Animal Technology) or cynomolgus monkey splenocytes (AllCells, USA) were cultured in the presence of IL-2 (R&D, USA). Different SaveFull Paper
2020Kaneko, Y;Fukahori, H;Yamagami, K;Kawashima, T;Ito, M;Akamatsu, M;Marui, T;Kato, K;Takahashi, F;Morokata, T;Effects of AS2819899, a novel selective PI3Kδ inhibitor, in a NZB/W F1 mouse lupus-like nephritis modelInternational immunopharmacology32736191Peripheral blood-derived frozen normal pan-T cells (AllCells, Alameda, CA, USA) were thawed according to the manufacturer’s instructions. The cell suspension (1 × 105 cells/well) was mixed with AS2819899 at designated concentrations in the anti-CD3 aFull Paper
2020Goydel, RS;Weber, J;Peng, H;Qi, J;Soden, J;Freeth, J;Park, H;Rader, C;Affinity maturation, humanization, and co-crystallization of a rabbit anti-human ROR2 monoclonal antibody for therapeutic applicationsThe Journal of biological chemistry32193207Thr-245 and Ala-245, which arise from an SNP (rs10820900) in the frizzled domain of human ROR2 (hROR2-Fz). Human PBMCs were purchased from AllCells and cultured in X-VIVO 20 medium (Lonza) with 5% (v/v) off-the-clot human AB serum (Gemini Bio-ProductFull Paper
2020Čuperlović-Culf, M;Khieu, NH;Surendra, A;Hewitt, M;Charlebois, C;Sandhu, JK;Analysis and Simulation of Glioblastoma Cell Lines-Derived Extracellular Vesicles MetabolomeMetabolites32131411Normal human astrocytes (NHA, Lonza, Walkersville, MD, USA) were used as normal counterparts and were grown in astrocyte medium-containing supplements (Allcells) and 5% FBS. SaveFull Paper
2020Liu, J;Kozhaya, L;Torres, VJ;Unutmaz, D;Lu, M;Structure-based discovery of a small-molecule inhibitor of methicillin-resistant Staphylococcus aureus virulenceThe Journal of biological chemistry32179646Blood samples were obtained from healthy, consenting donors as buffy coats (New York Blood Center) and leukopaks (AllCells, Alameda, CA). Human PBMCs were isolated from peripheral blood by density gradient centrifugation using Ficoll-Paque Plus (GE LFull Paper
2020Thwin, KKM;Ishida, T;Uemura, S;Yamamoto, N;Lin, KS;Tamura, A;Kozaki, A;Saito, A;Kishimoto, K;Mori, T;Hasegawa, D;Kosaka, Y;Nino, N;Takafuji, S;Iijima, K;Nishimura, N;Level of Seven Neuroblastoma-Associated mRNAs Detected by Droplet Digital PCR Is Associated with Tumor Relapse/Regrowth of High-Risk Neuroblastoma PatientsThe Journal of molecular diagnostics : JMD318374271 sample from BioChain (Newark, CA), 2 samples from STEMCELL (Vancouver, Canada), 56 samples from AllCells (Alameda, CA), 16 samples from ReachBio (Seattle, WA), and 28 samples from Loza (Walkersville, MD) (Supplemental Table S1). All PB samples fromFull Paper
2020Xue, WL;Chen, RQ;Zhang, QQ;Li, XH;Cao, L;Li, MY;Li, Y;Lin, G;Chen, Y;Wang, MJ;Zhu, YC;Hydrogen sulfide rescues high glucose-induced migration dysfunction in HUVECs by upregulating miR-126-3pAmerican journal of physiology. Cell physiology32186933Primary human umbilical vein endothelial cells (HUVECs) were purchased from Allcells (Shanghai, China) (35). These HUVECs were cultured in endothelial complete medium (Allcells, SaveFull Paper
2020Satani, N;Giridhar, K;Cai, C;Wewior, N;Norris, DD;Aronowski, J;Savitz, SI;Medications for Hypertension Change the Secretome Profile from Marrow Stromal Cells and Peripheral Blood MonocytesStem cells international32802081MSCs were isolated from commercially available fresh human bone marrow aspirates (AllCells, Alameda, CA) using density centrifugation and plastic adherence as previously SaveFull Paper
2020Diaz, MF;Horton, PD;Dumbali, SP;Kumar, A;Livingston, M;Skibber, MA;Mohammadalipour, A;Gill, BS;Zhang, S;Cox, CS;Wenzel, PL;Bone marrow stromal cell therapy improves survival after radiation injury but does not restore endogenous hematopoiesisScientific reports33335275t received wet feed on days 4-30 post-exposure. Culture of human MSCs Human MSCs used for cell therapy were derived from whole bone marrow from independent human donors (commercially obtained from AllCells, LLC, Alameda, CA). Cells were isolated andFull Paper
2020Dzimianski, JV;Lorig-Roach, N;O'Rourke, SM;Alexander, DL;Kimmey, JM;DuBois, RM;Rapid and sensitive detection of SARS-CoV-2 antibodies by biolayer interferometryScientific reports33303951dy at UCSC. All participants agreed to sample banking and future research use. The convalescent seropositive (SP) panel comprised 10 de-identified plasma samples from nine individuals, purchased from AllCells (Alameda, CA, USA). To be eligible for plFull Paper
2020Diaz, MF;Horton, PD;Kumar, A;Livingston, M;Mohammadalipour, A;Xue, H;Skibber, MA;Ewere, A;Toledano Furman, NE;Aroom, KR;Zhang, S;Gill, BS;Cox, CS;Wenzel, PL;Injury intensifies T cell mediated graft-versus-host disease in a humanized model of traumatic brain injuryScientific reports32612177Bone marrow stromal cells were derived from whole bone marrow from independent human donors (AllCells, Alameda, CA). Mononuclear cells from whole bone marrow were enriched SaveFull Paper
2020Allen, A;Vaninov, N;Li, M;Nguyen, S;Singh, M;Igo, P;Tilles, AW;O'Rourke, B;Miller, BLK;Parekkadan, B;Barcia, RN;Mesenchymal Stromal Cell Bioreactor for Ex Vivo Reprogramming of Human Immune CellsScientific reports32576889ld times cover the range of expected delivery of the device from cell seeding location to clinical application. PBMC isolation and enrichment Peripheral blood mononuclear cells (PBMCs) obtained from AllCells LLC (AllCells, CA, USA) were freshly isolFull Paper
2020Siew Ching, H;Thirumulu Ponnuraj, K;Luddin, N;Ab Rahman, I;Nik Abdul Ghani, NR;Early Odontogenic Differentiation of Dental Pulp Stem Cells Treated with Nanohydroxyapatite-Silica-Glass Ionomer CementPolymers32957636the present study was principally aimed at evaluating the effect of nanoHA-silica-GIC on the differentiation of DPSCs into odontogenic lineage. 2. Materials and Methods 2.1. Cell Culture DPSCs (AllCells, Alameda, CA, USA; Cat no. DP003F) were grownFull Paper
2020Keskar, V;Sood, A;Loghin, E;Kovacs, E;Duthie, RS;Liu, S;Park, JH;Chadwick, C;Smith, R;Brown, M;Stroncek, DF;Highfill, SL;Novel DNA-based T-Cell Activator Promotes Rapid T-Cell Activation and ExpansionJournal of immunotherapy (Hagerstown, Md. : 1997)32796275Activation studies were conducted in 6-well tissue culture plastic plates using commercially available Pan T cells (AllCells, Alameda, CA). Cultures were diluted as needed (1:3 or 1:4) to SaveFull Paper
2020Shrestha, B;Zhang, Y;Yu, B;Li, G;Boucher, JC;Beatty, NJ;Tsai, HC;Wang, X;Mishra, A;Sweet, K;Lancet, JE;Kelley, L;Davila, ML;Generation of Antitumor T Cells For Adoptive Cell Therapy With Artificial Antigen Presenting CellsJournal of immunotherapy (Hagerstown, Md. : 1997)31834208To investigate the ability of aAPCs to support T-cell expansion we isolated T cells from healthy donor PBMCs (ALLcells) using a Human T-cell isolation Kit (Stem Cells Inc., Cambridge, SaveFull Paper
2020Park, LM;Lannigan, J;Jaimes, MC;OMIP-069: Forty-Color Full Spectrum Flow Cytometry Panel for Deep Immunophenotyping of Major Cell Subsets in Human Peripheral BloodCytometry. Part A : the journal of the International Society for Analytical Cytology32830910All human PBMCs used in this study were obtained from AllCells Alameda. Ethical review and regulatory compliance were conducted by Alpha Independent Review Board under SaveFull Paper
2020Nair, RR;Piktel, D;Hathaway, QA;Rellick, SL;Thomas, P;Saralkar, P;Martin, KH;Geldenhuys, WJ;Hollander, JM;Gibson, LF;Pyrvinium Pamoate Use in a B cell Acute Lymphoblastic Leukemia Model of the Bone Tumor MicroenvironmentPharmaceutical research31989336Primary CD3+ T cells, peripheral blood mononuclear cells (PBMC) and bone marrow mononuclear cells (BMMC) were purchased from AllCells (Allcells.com) and maintained in Lymphocyte Growth Medium-3 (Lonza, Cat No: CC-3211) containing 10% FBS and 1x strepFull Paper
2020Powell, AB;Ren, Y;Korom, M;Saunders, D;Hanley, PJ;Goldstein, H;Nixon, DF;Bollard, CM;Lynch, RM;Jones, RB;Cruz, CRY;Engineered Antigen-Specific T Cells Secreting Broadly Neutralizing Antibodies: Combining Innate and Adaptive Immune Response against HIVMolecular therapy. Methods & clinical development33005704Peripheral blood samples were obtained from deidentified, healthy donor buffy coats from the NIH, through the Department of Transfusion Medicine, or commercially from AllCells. Save;erved. Peripheral Blood Samples Peripheral blood samples were obtFull Paper
2020Fang, Y;Zhang, Y;Guo, C;Chen, C;Gao, H;Zhou, X;Liu, T;Qian, Q;Safety and Efficacy of an Immune Cell-Specific Chimeric Promoter in Regulating Anti-PD-1 Antibody Expression in CAR T CellsMolecular therapy. Methods & clinical development32995356PBMCs were purchased from AllCells (USA) using a protocol approved by the Ethics Committee of the Chinese Peoples' Liberation Army General Hospital (S2019-063-01). In total, 5 × Save;Cell Isolation, Electroporation, and Ex Vivo CAR T Cell ExpansionFull Paper
2020Shapiro, J;Iancu, O;Jacobi, AM;McNeill, MS;Turk, R;Rettig, GR;Amit, I;Tovin-Recht, A;Yakhini, Z;Behlke, MA;Hendel, A;Increasing CRISPR Efficiency and Measuring Its Specificity in HSPCs Using a Clinically Relevant SystemMolecular therapy. Methods & clinical development32478125(5 μL total volume). Complexes were allowed to form for 10-20 min at room temperature before electroporation. Genome Editing by RNP Electroporation in CD34+ HSPCs Mobilized human CD34+ HSPCs (AllCells, Alameda, CA, USA) were thawed and cultured forFull Paper
2020Morgan, RA;Ma, F;Unti, MJ;Brown, D;Ayoub, PG;Tam, C;Lathrop, L;Aleshe, B;Kurita, R;Nakamura, Y;Senadheera, S;Wong, RL;Hollis, RP;Pellegrini, M;Kohn, DB;Creating New β-Globin-Expressing Lentiviral Vectors by High-Resolution Mapping of Locus Control Region Enhancer SequencesMolecular therapy. Methods & clinical development32426415BM CD34+ Cell Culture and Transduction All BM aspirates were obtained from voluntary healthy donors supplied by AllCells (Alameda, CA, USA). BM mononuclear cells were isolated SaveFull Paper
2020Mehler, VJ;Burns, CJ;Stauss, H;Francis, RJ;Moore, ML;Human iPSC-Derived Neural Crest Stem Cells Exhibit Low ImmunogenicityMolecular therapy. Methods & clinical development32055644utamine, 2 mM L-glutamine, 50 U/mL penicillin/streptomycin, 20 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF), and 20 ng/mL IL-4. BM-MSCs were derived from bone marrow aspirates (AllCells, Alameda, CA, USA) in-house as previously desFull Paper
2020Elnaggar, M;Al-Mohannadi, A;Kizhakayil, D;Raynaud, CM;Al-Mannai, S;Gentilcore, G;Pavlovski, I;Sathappan, A;Van Panhuys, N;Borsotti, C;Follenzi, A;Grivel, JC;Deola, S;Flow-Cytometry Platform for Intracellular Detection of FVIII in Blood Cells: A New Tool to Assess Gene Therapy Efficiency for Hemophilia AMolecular therapy. Methods & clinical development31886317ar endothelial cells) and U937 (pre-monocytic cells) cell lines were kindly provided by Antonia Follenzi (UPO, Italy). HeLa (cervical cancer cells) were purchased from ATCC. PBMCs were purchased from AllCells (Alameda, CA, USA). Cells were cultured iFull Paper
2020Ning, K;Wang, MJ;Lin, G;Zhang, YL;Li, MY;Yang, BF;Chen, Y;Huang, Y;Li, ZM;Huang, YJ;Zhu, L;Liang, K;Yu, B;Zhu, YZ;Zhu, YC;eNOS-Nitric Oxide System Contributes to a Novel Antiatherogenic Effect of Leonurine via Inflammation Inhibition and Plaque StabilizationThe Journal of pharmacology and experimental therapeutics32238453Primary human umbilical vein endothelial cells (HUVECs) were purchased from Allcells (H-001F-C; China) and cultured in HUVEC Growth Medium (H-004; Allcells), and 100 U/ml of SaveFull Paper
2020Zhaorigetu, S;Bair, H;Jin, D;Gupta, VS;Pandit, LM;Bryan, RM;Lally, KP;Olson, SD;Cox, CS;Harting, MT;Extracellular Vesicles Attenuate Nitrofen-Mediated Human Pulmonary Artery Endothelial Dysfunction: Implications for Congenital Diaphragmatic HerniaStem cells and development32475301Human MSCs were isolated from commercially available fresh human bone marrow aspirates of a 34-year-old female (AllCells, Alameda, CA) using density centrifugation and plastic SaveFull Paper
2020Baumgartner, JM;Riviere, P;Lanman, RB;Kelly, KJ;Veerapong, J;Lowy, AM;Kurzrock, R;Prognostic Utility of Pre- and Postoperative Circulating Tumor DNA Liquid Biopsies in Patients with Peritoneal MetastasesAnnals of surgical oncology32767050Background Circulating tumor DNA (ctDNA) is a promising technology for treatment selection, prognostication, and surveillance after definitive therapy. Its use in the perioperative SaveFull Paper
2020Hamburger, AE;DiAndreth, B;Cui, J;Daris, ME;Munguia, ML;Deshmukh, K;Mock, JY;Asuelime, GE;Lim, ED;Kreke, MR;Tokatlian, T;Kamb, A;Engineered T cells directed at tumors with defined allelic lossMolecular immunology33012527Leukopaks were purchased from AllCells®. Collection protocols and donor informed consent were approved by an Institutional Review Board (IRB), with strict oversight. HIPAA compliance and approved protocols were also followed. Frozen PBMCs were thawedFull Paper
2020Xu, H;Hamburger, AE;Mock, JY;Wang, X;Martin, AD;Tokatlian, T;Oh, J;Daris, ME;Negri, KR;Gabrelow, GB;Wu, ML;Nampe, DP;Asuelime, GE;McElvain, ME;Sandberg, ML;Kamb, A;Structure-function relationships of chimeric antigen receptors in acute T cell responses to antigenMolecular immunology32768859Collection protocols and donor informed consent were approved by an Institutional Review Board (IRB) at Allcells . Allcells also followed HIPAA compliance and approved protocols SaveFull Paper
2020Wang, Z;Zhou, G;Risu, N;Fu, J;Zou, Y;Tang, J;Li, L;Liu, H;Liu, Q;Zhu, X;Lenalidomide Enhances CAR-T Cell Activity Against Solid Tumor CellsCell transplantation32967454line U251 CD133-OE luc. Similarly, the tumor cell line U251 WT luc, MDA-MB-453 luc, and MDA-MB-468 luc were also obtained by nucleofection. Peripheral blood mononuclear cells (PBMCs) were bought from ALLCELLS (PB005F, Alameda, CA, USA). Following theFull Paper
2020Zhao, C;Zhao, Z;Wang, Z;Hu, L;Wang, H;Fang, Z;Supervillin promotes tumor angiogenesis in liver cancerOncology reports32468064Human umbilical vein endothelial cells (HUVECs) were purchased from AllCells LLC (cat. H-004; AllCells LLC) in a 0.25% gelatin-coated culture flask. HepG2, Bel7405 and MHCC- SaveFull Paper
2020Lee, KS;Lee, J;Lee, P;Kim, CU;Kim, DJ;Jeong, YJ;Park, YJ;Tesh, VL;Lee, MS;Exosomes released from Shiga toxin 2a-treated human macrophages modulate inflammatory responses and induce cell death in toxin receptor expressing human cellsCellular microbiology32772454Human CD14 + monocytes were purchased from AllCells LLC and maintained in RPMI 1640 medium containing 10% FBS, 5.0 μg/ml streptomycin and 5.0 U/ml penicillin. Cells (1.0 × SaveFull Paper
2020Monroe, MN;Zhaorigetu, S;Gupta, VS;Jin, D;Givan, KD;Curylo, AL;Olson, SD;Cox, CS;Segura, A;Buja, LM;Grande-Allen, KJ;Harting, MT;Extracellular vesicles influence the pulmonary arterial extracellular matrix in congenital diaphragmatic herniaPediatric pulmonology32568428Human mesenchymal stromal cells (hMSCs) were isolated from commercially available fresh human bone marrow aspirates of a 34-year-old female (AllCells, Alameda, CA) using SaveFull Paper
2020Zaw, SYM;Kaneko, T;Zaw, ZCT;Sone, PP;Murano, H;Gu, B;Okada, Y;Han, P;Katsube, KI;Okiji, T;Crosstalk between dental pulp stem cells and endothelial cells augments angiogenic factor expressionOral diseases32248596Stem cells from human exfoliated deciduous teeth (SHEDs; AllCells) were cultured with a stem cell growth medium (Dulbecco's modified Eagle's medium (DMEM)/F12; Gibco) containing 15% fetal bovine serum (Gibco-BRL, Grand Island, NY), 10,000 units penicFull Paper
2020Huang, GL;Nampe, DP;Yi, J;Gabrelow, GB;Negri, KR;Kamb, A;Xu, H;A multivariate, quantitative assay that disentangles key kinetic parameters of primary human T cell function in vitroPloS one33166305Collection protocols and donor informed consent were approved by an Institutional Review Board (IRB) at Allcells . Allcells also followed HIPAA compliance and approved protocols SaveFull Paper
2020Wang, X;Chacon, LI;Derakhshandeh, R;Rodriguez, HJ;Han, DD;Kostyushev, DS;Henry, TD;Traverse, JH;Moyé, L;Simari, RD;Taylor, DA;Springer, ML;Impaired therapeutic efficacy of bone marrow cells from post-myocardial infarction patients in the TIME and LateTIME clinical trialsPloS one32841277Healthy de-identified donor BM MNCs were purchased from AllCells (Alameda, CA). These MNCs were manually isolated at AllCells using Ficoll conditions like that in the Sepax SaveFull Paper
2020Schönherz, AA;Bødker, JS;Schmitz, A;Brøndum, RF;Jakobsen, LH;Roug, AS;Severinsen, MT;El-Galaly, TC;Jensen, P;Johnsen, HE;Bøgsted, M;Dybkær, K;Normal myeloid progenitor cell subset-associated gene signatures for acute myeloid leukaemia subtyping with prognostic impactPloS one32324791[18] GSE42519, [19] GSE19599, [20] GSE17054, [21] and GSE19429 [22] cohorts. For GSE63270, [18] and GSE17054, [21] human bone marrow mononuclear cells (BMMCs) from healthy donors were purchased from ALLCELLS (Emeryville, CA) where collection protocolFull Paper
2020Tani, J;Ito, Y;Tatemichi, S;Yamakami, M;Fukui, T;Hatano, Y;Kakimoto, S;Kotani, A;Sugimura, A;Mihara, K;Yamamoto, R;Tanaka, N;Minami, K;Takahashi, K;Hirato, T;Physicochemical and biological evaluation of JR-131 as a biosimilar to a long-acting erythropoiesis-stimulating agent darbepoetin alfaPloS one32302352fects of the test substances on colony-forming unit-erythroid (CFU-E)- and burst-forming unit-erythroid (BFU-E)-derived colony formation in human bone-marrow-derived mononuclear cells (purchased from AllCells, CA) were examined. The cells were obtainFull Paper
2020Steinberg, L;The Effects of P. Gingivalis Ceramide Lipids on Platelet Size, Agglutination, Aggregation, and Vascular Surface Adhesion MarkersThesisBackground: Increased bleeding on probing has been proven to be correlated with the progression of periodontal disease. Gingival bleeding in sites with periodontitis has often been attributed to chronic inflammation. Previous research has documentedFull Paper
2020Kim, DH;Kim, DH;Heck, BE;Shaffer, M;Yoo, KH;Hur, J;PPAR-δ agonist affects adipo-chondrogenic differentiation of human mesenchymal stem cells through the expression of PPAR-γRegenerative therapy33426208In this experimental study, frozen human bone marrow mononuclear cells were used for isolation (AllCells, Alameda, CA, USA) [25]. Cells were resuspended in α-minimum essential Save;mation condition and its correlation with PPAR-δ. 2 Methods 2.1 IsFull Paper
2020Zhang, E;Xie, L;Qin, P;Lu, L;Xu, Y;Gao, W;Wang, L;Xie, MH;Jiang, W;Liu, S;Quality by Design-Based Assessment for Analytical Similarity of Adalimumab Biosimilar HLX03 to Humira®The AAPS journal32385732PMBC cells (Allcells) were incubated with mAbs with a 2-fold serial dilution for 30 min followed by TNFα-Biotin (Sinobio) incubation. After labeled by Streptavidin-PE (eBioscience), SaveFull Paper
2020Dai, R;Heid, B;Xu, X;Xie, H;Reilly, CM;Ahmed, SA;EGR2 is elevated and positively regulates inflammatory IFNγ production in lupus CD4+ T cellsBMC immunology32646370ethods Human peripheral blood mononuclear cells (PBMCs) The PBMCs of human patients of lupus (n = 4, all female) and healthy controls (n = 4, 2 male and 2 female) were purchased directly from AllCells LLC (Alameda, CA, USA). Based on the informationFull Paper
2020Dong, W;Zhang, X;Lu, Z;Effect of 532nm photodynamic therapy with hemoporfin on the expression of vascular endothelial growth factor in cultured human vascular endothelial cellsPhotodiagnosis and photodynamic therapy32344194Working drug solutions (0-8 μg/ml) were prepared by diluting the stock solution with RPMI-1640 medium (AllCells). A 532 nm neodymium-doped yttrium orthovanadate (Nd:YVO 4 ) SaveFull Paper
2020Pieles, O;Reck, A;Reichert, TE;Morsczeck, C;p53 inhibits the osteogenic differentiation but does not induce senescence in human dental follicle cellsDifferentiation; research in biological diversity32473528Human dental follicle cells (DFCs) were obtained from AllCells. DFCs were cultivated as described previously (Morsczeck et al., 2016). Cells were analyzed before and after the SaveFull Paper
2020Lafleur, MA;Werner, J;Fort, M;Lobenhofer, EK;Balazs, M;Goyos, A;MRGPRX2 activation as a rapid, high-throughput mechanistic-based approach for detecting peptide-mediated human mast cell degranulation liabilitiesJournal of immunotoxicology32525431Human mobilized peripheral blood CD34+ cells (derived from healthy donors treated with G-CSF to mobilize CD34+ progenitor cells from the bone marrow to the peripheral blood, then isolated using anti-CD34 magnetic beads) (#mPB016F, AllCells, Alameda,Full Paper
2020Yu, Z;Yin, S;Zhang, W;Jiang, X;Hu, J;Picosecond laser texturing on titanium alloy for biomedical implants in cell proliferation and vascularizationJournal of biomedical materials research. Part B, Applied biomaterials31692202Human umbilical vein endothelial cells (HUVECs) were purchased from ALLCells Biological Technology Limited company and cultured at 1 × 105 on plates with Dulbecco's Modified Eagle's medium supplemented with 10% fetal bovine serum, 100 U/ml streptomycFull Paper
2020Bhargav, A;Min, KS;Wen Feng, L;Fuh, JYH;Rosa, V;Taguchi's methods to optimize the properties and bioactivity of 3D printed polycaprolactone/mineral trioxide aggregate scaffold: Theoretical predictions and experimental validationJournal of biomedical materials research. Part B, Applied biomaterials31112004The use of human dental pulp stem cells (DPSC) from single donor (DPF003, Allcells, Alameda) was approved by NUS Institutional Review Board (Approval Number: NUS 2094). The characterization and expressions of CD34, CD73, CD90, CD105 are available elsFull Paper
2020Al-Amoodi, AS;Sakashita, K;Ali, AJ;Zhou, R;Lee, JM;Tehseen, M;Li, M;Belmonte, JCI;Kusakabe, T;Merzaban, JS;Using Eukaryotic Expression Systems to Generate Human α1,3-Fucosyltransferases That Effectively Create Selectin-Binding Glycans on Stem CellsBiochemistry32901486leukemia cell line), THP1 (human acute monocytic leukemia), HL60 (human acute promyelocytic leukemia) (ATCC), and MSCs (primary mesenchymal stromal cells) (AllCells) were SaveFull Paper
2020Behbehani, GK;Finck, R;Samusik, N;Sridhar, K;Fantl, WJ;Greenberg, PL;Nolan, GP;Profiling myelodysplastic syndromes by mass cytometry demonstrates abnormal progenitor cell phenotype and differentiationCytometry. Part B, Clinical cytometry31917512in Table S2, with the risk‐based clinical status of MDS patients indicated by IPSS category and morphologic characteristics (Greenberg et al., 1997). Five healthy control samples were obtained from Allcells, Inc. using the same protocol. Normal boneFull Paper
2020Kim, DH;Kim, DH;Heck, BE;Shaffer, M;Hur, J;Yoo, KH;A natural supplement formula reduces anti-oxidative stress and enhances osteo-chondrogenic differentiation potential in mesenchymal stem cellsJournal of clinical biochemistry and nutrition32523247rozen mononuclear cells from human bone marrow were purchased (AllCells, Emeryville, CA) and used to isolate human bone marrow-mesenchymal stem cells (hBM-MSCs). Briefly, thawed mononuclear cells were cultured in Dulbecco’s modified Eagle medium (DMEFull Paper
2020Wang, P;Qin, W;Liu, T;Jiang, D;Cui, L;Liu, X;Fang, Y;Tang, X;Jin, H;Qian, Q;PiggyBac-engineered T cells expressing a glypican-3-specific chimeric antigen receptor show potent activities against hepatocellular carcinomaImmunobiology31522780Human peripheral blood mononuclear cells (PBMCs) from healthy donors were purchased from AllCells (AllCells, Silicon, USA). 5 × 106−1 × 107 PBMCs were electroporated with 6 μg of GPC3CAR plasmid or an equal quantity of MOCK plasmid in an electroporatFull Paper
2020Liu, H;Gemmell, L;Lin, R;Zuo, F;Balfour, HH;Woo, JC;Hayes, GM;Development of an Improved Epstein-Barr Virus (EBV) Neutralizing Antibody Assay to Facilitate Development of a Prophylactic gp350-Subunit EBV VaccineMediterranean journal of hematology and infectious diseases32180911Healthy human donor serum samples were purchased from AllCells, LLC and Bioreclamation, LLC (n=39). Samples were heated at 56 oC for 30 minutes to inactivate complement, and SaveFull Paper
2020Chien, KS;Class, CA;Montalban-Bravo, G;Wei, Y;Sasaki, K;Naqvi, K;Ganan-Gomez, I;Yang, H;Soltysiak, KA;Kanagal-Shamanna, R;Do, KA;Kantarjian, HM;Garcia-Manero, G;LILRB4 expression in chronic myelomonocytic leukemia and myelodysplastic syndrome based on response to hypomethylating agentsLeukemia & lymphoma32036728BM samples from healthy individuals were obtained from AllCells (Emeryville, CA, USA). CD34+ cells were isolated using the CD34 MicroBead Kit (Miltenyi Biotec, Bergisch Gladback, SaveFull Paper
2020Wu, T;The mean ± 1 SD was calculated for triplicate cultures. The laboratory (ReachBio LLC, Seattle, Washington) was blinded to the identify of the test compounds and docetaxel served as the positive control, with blank and vehicle as negative controls.ThesisThe surviving mice of the “young adult” group at day 35 post-TBI were sacrificed and 5×104 BM cells acquired from femurs were plated in ColonyGEL Mouse Complete Medium (Reach Bio, Seattle, WA) as previously described [131, 135]. After 7 days of incubFull Paper
2020White, CM;Haidekker, MA;Kisaalita, WS;Ratiometric Nanoviscometers: Applications for Measuring Cellular Physical Properties in 3D CulturesSLAS technology31997709Human bone marrow derived (Tulane Center for Gene Therapy) 3.2 ± 1.4 AFM indentation Spread morphology on glass coverslips; cytoplasm measured; spherical AFM tip 76 Human bone marrow derived (AllCells) 33 ± 7 AFM indentation Spread morphology on TherFull Paper
2020Chen, Y;NOVEL SIGNALS IN STRESS ERYTHROPOIESIS: COORDINATED CONTROL OF WNT, PGE2 AND PERK SIGNALING PATHWAYS REGULATES EXPANSION AND DIFFERENTIATION OF STRESS ERYTHROID PROGENITORSThesisHuman bone marrow mononuclear cells (MNCs) (ReachBio) were thawed at 37°C water according to the ReachBio instructions. MNCs were enumerated and cell concentrations were adjusted to 5  105 cells/mL. MNCs were cultured in Gibco RPMI-1640 (InvitrogenFull Paper
2020Wu, JL;McIntyre, PW;Hong, JM;Yassen, GH;Bruzzaniti, A;Effects of radiopaque double antibiotic pastes on the proliferation, alkaline phosphatase activity and mineral deposition of dental pulp stem cellsArchives of oral biology32485262Human DPSC were purchased from ALLCells (Alameda, CA, USA), passaged once and aliquots stored in liquid nitrogen. For each experiment, DPSC were thawed and seeded into 10-cm2 dishes and cultured in α-MEM (HyClone Laboratories Inc., South Logan, UT, UFull Paper
2020Madanagopal, TT;Franco-Obregón, A;Rosa, V;Comparative study of xeno-free induction protocols for neural differentiation of human dental pulp stem cells in vitroArchives of oral biology31600663The DPSC were isolated from the third molar from single donor (DPF003, AllCells, USA). Due to ethical requirements, the age, gender and ethnic group of the donor cannot be disclosed SaveFull Paper
2020Pieles, O;Reck, A;Morsczeck, C;High endogenous expression of parathyroid hormone-related protein (PTHrP) supports osteogenic differentiation in human dental follicle cellsHistochemistry and cell biology32710187Human dental follicle cells (DFCs), which were purchased from AllCells, were cultivated in DMEM (Dulbecco's modified Eagle medium) supplemented with 10% fetal bovine serum and SaveFull Paper
2020Fujishiro, A;Iwasa, M;Fujii, S;Maekawa, T;Andoh, A;Tohyama, K;Takaori-Kondo, A;Miura, Y;Menatetrenone facilitates hematopoietic cell generation in a manner that is dependent on human bone marrow mesenchymal stromal/stem cellsInternational journal of hematology32572826Normal human BM samples were purchased from AllCells (Alameda, CA). To confirm consistency among donors, multiple batches of BM-MSCs were isolated as described previously [ SaveFull Paper
2020Yu, CI;Marches, F;Wu, TC;Martinek, J;Palucka, K;Techniques for the generation of humanized mouse models for immuno-oncologyMethods in enzymology32178826Adult CD34 + HPCs from G-CSF mobilized peripheral blood or bone marrow may be obtained from Allcells (Alameda, CA, USA) or Lonza (Basel, Switzerland). Cord blood CD34 + SaveFull Paper
2020Enezei, H;Qabbani, A;Ahmad, A;Khamis, M;Hassani, A;Hamad, H;The Effect of Strontium on Osteoblastogenesis and Osteoclastogenesis in Dental Stem Cells-induced Epidermal Growth Factor at Molecular Level: In Vitro StudyJournal of Hard Tissue BiologyAllCells, LLC Company, Emeryville, CA, USA Dental Stem Cells (DSCs) Invitrogen, (GIBCO), Faraday Ave, Carlsbad, CA, USA Dulbecco’s modified Eagles medium (DMEM) high glucose(4.5g/l) Invitrogen, (GIBCO), Faraday Ave, Carlsbad, CA, USA Fetal bovine serFull Paper
2020Kuang, Z;Li, L;Zhang, P;Chen, B;Wu, M;Ni, H;Yi, S;Zou, J;Liu, J;A novel antibody targeting TIM-3 resulting in receptor internalization for cancer immunotherapyAntibody therapeutics33928230The antibody was purified in-house (Innovent Biologics Co., Ltd., Suzhou, China) from HEK293 cells with either transient or stable expression unless indicated otherwise. Cell culture Human PBMCs (AllCells, Alameda, CA, USA) were cultured in AIM V MFull Paper
2020Moussi, K;Abusamra, DB;Yassine, O;Merzaban, J;Kosel, J;Strain-induced Differentiation of Mesenchymal Stem CellsAnnual International Conference of the IEEE Engineering in Medicine and Biology Society. IEEE Engineering in Medicine and Biology Society. Annual International Conference33018453Human bone marrow derived mesenchymal stem/stromal cells (hMSCs) were purchased from AllCells. All the experiments were performed using MSCs in their 3-5th passage. An SaveFull Paper
2020Yang, Z;Wang, T;Wu, D;Min, Z;Tan, J;Yu, B;RNA N6-methyladenosine reader IGF2BP3 regulates cell cycle and angiogenesis in colon cancerJournal of experimental & clinical cancer research : CR32993738lls were cultured in RPMI 1640 medium supplemented with 10% FBS (Invitrogen, Carlsbad, CA, USA) at 37 °C in a 5% CO2 atmosphere. Human Umbilical Vein Endothelial Cells (HUVECs) were purchased from Allcells, Inc. (Alameda, CA, USA) and cultured in EndFull Paper
2020MacGlashan, D;Modulating the Human Basophil Phenotype During Its Development and Maturation: Basophils Derived from In Vitro Cultures of CD34+ Progenitor CellsMethods in molecular biology (Clifton, N.J.)32766967CD34+ progenitor stems (commercially prepared, multiple sources, e.g., AllCells (Quincy, MA, USA), or Fred Hutchinson Cancer Research Center (Seattle, WA, USA)). 12. FBS (fetal bovine serum) (multiple sources, heat-inactivated). 13. Penicillin/streFull Paper
2020Urkasemsin, G;Rungarunlert, S;Ferreira, JN;Bioprinting Strategies for Secretory Epithelial OrganoidsMethods in molecular biology (Clifton, N.J.)32207117hDPSC lines are commercially available through AllCells (Alameda, CA, USA) and should be used at lower passage to guarantee that their proliferation rate and phenotype are stable. 2. The same lot of FBS should be utilized during the all experiments.Full Paper
2020Han, SS;Kang, SW;Metabolic Labeling of Live Stem Cell for In Vitro Imaging and In Vivo TrackingMethods in molecular biology (Clifton, N.J.)30997638Stem cell therapy offers promising solutions to diseases and injuries that traditional medicines and therapies can't effectively cure. To get and explain their full therapeutic potentials, the SaveFull Paper
2020Al-Mohannadi, A;Deola, S;Malki, A;Visualization of Factor Viii with Flow-Cytometry as a tool for Novel Gene Therapy Approach in Hemophilia AUniversity of the Future: Re-Imagining Research and Higher Educationreceived as a kind gift from Antonia Follenzi, Health Sciences Department in Piemonte Orientale University in Novara-Italy. HELA cells (cervical cancer) were purchased from American Type Culture Collection (ATCC™), USA. PBMCs purchased by AllCells (CFull Paper
2020Romito, M;Juillerat, A;Kok, Y;HIldenbeutel, M;Rhiel, M;Andrieux, G;Geiger, J;Rudolph, C;Mussolino, C;Duclert, A;Metzner, K;Duchateau, P;Cathomen, T;Cornu, T;Clinically relevant CCR5 editing in primary CD4+ T cells with TALEN confers resistance to HIV-1 infectionAuthorea, Inc.For oligonucleotide capture assay (OCA), human PBMCs (ALLCELLS, USA) were plated at a density of 1x106 cells/ml in X-vivo-15 media (Lonza, Switzerland) supplemented with 5% SaveFull Paper
2020Turchiano, G;Andrieux, G;Blattner, G;Pennucci, V;Klermund, J;Monaco, G;Poddar, S;Mussolino, C;Cornu, T;Boerries, M;Cathomen, T;Quantitative Evaluation of Chromosomal Rearrangements in Primary Gene-Edited Human Stem Cells by Preclinical CAST-SeqSSRN Electronic JournalCell culture and transfection. Cryopreserved human CD34+ HSPCs derived from cord blood (AllCells, Cat.# CB008F; StemCell-Technologies, Cat.# 70008.3) were thawed and cultivated in a density range of 0.5-1 x 106 /ml at 37°C, 5% CO2 in GMP-grade CellGFull Paper
2020Lu, B;Yang, H;Liu, F;Sun, Y;He, H;Ding, X;Hu, S;xia, l;Escherichia coli Nissle 1917 secreting functional interleukin 2 targets tumours and enhances the immune response to suppress tumoursResearch SquareCT26 colon carcinoma lines were maintained by our laboratory, and peripheral blood mononuclear cells (PBMCs) were purchased from Allcells Biotechnology (Shanghai) Co., Ltd. SaveFull Paper
2020Zhang, Y;Wang, P;wang, t;Fang, Y;Ding, Y;Qian, Q;Chimeric Antigen Receptor T Cells Engineered to Secrete CD40 Agonist Antibodies Enhance Antitumor EfficacyResearch SquareHuman peripheral blood mononuclear cells (PBMC) from healthy donors were purchased from AllCells (Shanghai, China) and cryopreserved in our laboratory. SaveFull Paper
2020Mangiras, D;Mattheakis, P;Ribet, P;Dimitrakopoulos, G;Soft-Clustering Driven Flip-flop Placement Targeting Clock-induced OCVProceedings of the 2020 International Symposium on Physical DesignIn this way, the cluster initialization of clock net n is done on AllCells that includes both the cells connected to n and the pre-defined cluster centers of the hierarchically lower clock sub- SaveFull Paper
2020Li, W;Yang, S;Xu, P;Zhang, D;Tong, Y;Chen, L;Jia, B;Li, A;Ru, D;Zhang, B;Liu, M;Lian, C;Chen, C;Fu, W;Yuan, S;Ren, X;Liang, Y;Yang, Z;Li, W;Wang, S;Zhang, X;Lu, H;Xu, J;Wang, H;Yu, W;Human Identical Sequences of SARS-CoV-2 Promote Clinical Progression of COVID-19 by Upregulating Hyaluronan via NamiRNA-Enhancer NetworkbioRxivHUVEC (human umbilical vein endothelial cell, bought from AllCells) was cultured in the commercial culture medium (AllCells, H-004) according to the manufacturer's guidelines. SaveFull Paper
2020Fiskin, E;Lareau, C;Eraslan, G;Ludwig, L;Regev, A;Single-cell multimodal profiling of proteins and chromatin accessibility using PHAGE-ATACbioRxivFor PBMC and CD8 T cell experiments, cryopreserved PBMCs or CD8 T cells (AllCells) were thawed, washed in PBS and resuspended in cold Flow cytometry buffer (FC buffer; PBS containing 2% FBS). All centrifugation steps were carried out at 350g, 4min, 4Full Paper
2020Mimitou, E;Lareau, C;Chen, K;Zorzetto-Fernandes, A;Takeshima, Y;Luo, W;Huang, T;Yeung, B;Thakore, P;Wing, J;Nazor, K;Sakaguchi, S;Ludwig, L;Sankaran, V;Regev, A;Smibert, P;Scalable, multimodal profiling of chromatin accessibility and protein levels in single cellsbioRxivCryopreserved healthy donor peripheral blood mononuclear cells (PBMCs) and bone marrow cells (BM) were obtained from AllCells (USA) or Cellular Technology Limited (CTL) and processed immediately after thawing. NIH-3T3 and HEK293FT cells were maintainFull Paper
2020Steinbuck, M;Seenappa, L;Jakubowski, A;McNeil, L;Haqq, C;DeMuth, P;A Lymph Node Targeted Amphiphile Vaccine Induces Potent Cellular and Humoral Immunity to SARS-CoV-2bioRxivSARS-CoV-2 infection (COVID-19) were obtained from US Biolab (Rockville, MD) and ALLCELLS (Alameda, CA), respectively. All samples were received and stored frozen at -80°C until analysisFull Paper
2020Keating, S;Mizrahi, R;Adams, M;Asensio, M;Benzie, E;Carter, K;Chiang, Y;Edgar, R;Gautam, B;Gras, A;Leong, J;Leong, R;Lim, Y;Manickam, V;Medina-Cucurella, A;Niedecken, A;Saini, J;Simons, J;Spindler, M;Stadtmiller, K;Tinsley, B;Wagner, E;Wayham, N;Tracy, L;Lundberg, C;Büscher, D;Terencio, J;Roalfe, L;Pearce, E;Richardson, H;Goldblatt, D;Ramjag, A;Carrington, C;Simmons, G;Muench, M;Chamow, S;Monroe, B;Olson, C;Oguin, T;Lynch, H;Jeanfreau, R;Meyer, E;Adler, A;Johnson, D;Capturing and Recreating Diverse Antibody Repertoires as Multivalent Recombinant Polyclonal Antibody DrugsbioRxivPlasma-derived polyclonal antibodies are polyvalent drugs used for many important clinical indications that require modulation of multiple drug targets simultaneously, including SaveFull Paper
2020Sharma, R;Dever, D;Lee, C;Azizi, A;Pan, Y;Camarena, J;Köhnke, T;Bao, G;Porteus, M;Majeti, R;TRACE-Seq Reveals Clonal Reconstitution Dynamics of Gene Targeted Human Hematopoietic Stem CellsbioRxivFor in vivo studies presented, cord blood-derived CD34 + cells were purchased from AllCells or Stemcell Technologies and were thawed according to the manufacturer's SaveFull Paper
2020Miller, I;Sun, L;Harris, A;Gamboa, L;Zamat, A;Kwong, G;Remote control of CAR T cell therapies by thermal targetingbioRxivPrimary Human CD3+ cells were obtained from an anonymous donor blood after apheresis (AllCells) and were cryopreserved in 90% FBS and 10% DMSO until subsequent use. After SaveFull Paper
2020Mandal, S;Sunagawa, S;Prathipati, P;Belshan, M;Shibata, A;Destache, C;Targeted immuno-antiretroviral HIV therapeutic approach to provide dual protection and boosts cellular immunity: A proof-of-concept studybioRxivHuman immunodeficiency virus (HIV)-infected active and latent CCR5 expressing long-lived T-cells are the primary barrier to HIV/AIDS eradication. Broadly neutralizing antibodies and SaveFull Paper
2020Burley, D;Campagna, C;Harte, A;Kelly, S;Spiegelhoff, M;Effects of Erythrocyte Aggregation on Blood Rheology in Regard to Future Sepsis Diagnosis ApplicationThesisThe preparation of the blood dextran solutions for the micro-ESR, capillary fill, and vibration syllectometry were all done as one big batch. Blood was obtained from AllCells, LLC, a reputable blood and marrow cell supplier from Quincy, MassachusettsFull Paper
2020Fleischer, LC;Engineering Novel Chimeric Antigen Receptors (CARs) for T-cell Malignancies Using Innate Immune CellsThesisMethods and Materials γδ T-cell expansion. gd T cells were expanded from cryopreserved PBMCs purchased from AllCells (Alameda, California) or from fresh PBMCs isolated from 30-50 mL consented, healthy adult blood. PBMCs were isolated from blood usingFull Paper
2020O'Brien, G;Genetic and epigenetic consequences of radiation exposure in human and mouse leukaemogenesisThesisGreece with informed consent from each patient. Bone marrow aspirates were obtained from 5 normal donors (ALLCELLS, Alameda, CA) with informed consent and ethical approval from the Alpha Independent Review Board. Bone marrow aspirates from 7 AML patiFull Paper
2020Kimmey, SC;Mapping Single Cell Protein & Biosynthesis Dynamics Across Human Embryonic & Adult Stem Cell SpecificationThesisFresh bone marrow aspirates from two independent donors were obtained from AllCells (Alameda, CA) on the same day of collection, and immediately after receiving was placed in 37C 5% CO2 incubator for 30 minutes prior to SOM3B labeling. A mixture of aFull Paper
2020Davis-Marcisak, E;Fitzgerald, A;Kessler, M;Danilova, L;Jaffee, E;Zaidi, N;Weiner, L;Fertig, E;Transfer learning between preclinical models and human tumors identifies conserved NK cell activation signature in anti-CTLA-4 responsive tumorsbioRxivFresh healthy donor NK cells were purchased from AllCells (PB012-P). These NK cells were positively selected from donor peripheral blood using CD56 positivity. Donor NK cell purity SaveFull Paper
2020Burgenson, D;Development of a Cell-Free Protein Expression System Derived from Human Blood CellsThesisA comparison between methods used to produce leukapheresis products purchased from Allcells and the New York Blood Center. From the experiments performed, the Allcells SaveFull Paper
2020Yun, ZX;Identification of G9a as a Therapeutically Targetable Driver of Multiple Myeloma TumorigenesisThesisdissociate cells each passage. Cryopreserved Peripheral Blood Mononuclear Cells (PBMC, AllCells) were cultured in RPMI 1640 medium (BioWest, Kansas City, MO) with supplement of 10% FBS (HyClone) and 1% penicillin/streptomycin (Invitrogen) one day befFull Paper
2020Lindgren, A;Mohidin, D;Applying Digital Marketing Methods in the Healthcare Industry: A Case Study at ImmuneedThesisImmuneed Volume Immuneed Traffic Celentyx Volume Celentyx Traffic Reachbio Volume Reachbio Traffic Eurofins Volume Eurofins Traffic Immundnz Volume Immundnz Traffic Nexelis Volume Nexelis Traffic ImmuneCarta Volume ImmuneCarta TrafficFull Paper
2020Su, R;Dong, L;Li, Y;Gao, M;Han, L;Wunderlich, M;Deng, X;Li, H;Huang, Y;Gao, L;Li, C;Zhao, Z;Robinson, S;Tan, B;Qing, Y;Qin, X;Prince, E;Xie, J;Qin, H;Li, W;Shen, C;Sun, J;Kulkarni, P;Weng, H;Huang, H;Chen, Z;Zhang, B;Wu, X;Olsen, MJ;Müschen, M;Marcucci, G;Salgia, R;Li, L;Fathi, AT;Li, Z;Mulloy, JC;Wei, M;Horne, D;Chen, J;Targeting FTO Suppresses Cancer Stem Cell Maintenance and Immune EvasionCancer cell32531268After 7 days of selection with 0.5mg/ml G418 Sulfate (10131027, Thermo Fisher Scientific) in ColonyGEL (1201, ReachBio Research Lab), the cells were collected and injected into lethally irradiated (960 rads) 8- to 10-week-old B6.SJL (CD45.1, RRID: IMFull Paper
2020Young, TM;Reyes, C;Pasnikowski, E;Castanaro, C;Wong, C;Decker, CE;Chiu, J;Song, H;Wei, Y;Bai, Y;Zambrowicz, B;Thurston, G;Daly, C;Autophagy protects tumors from T cell-mediated cytotoxicity via inhibition of TNFα-induced apoptosisScience immunology33443027For human tumor cell killing experiments using CD3 bispecific antibody, human T cells were isolated from peripheral blood mononuclear cells (PBMCs) (ReachBio) using Dynabeads Untouched Human T Cells Kit (Thermo Fisher Scientific)Full Paper
2020Shen, C;Sheng, Y;Zhu, AC;Robinson, S;Jiang, X;Dong, L;Chen, H;Su, R;Yin, Z;Li, W;Deng, X;Chen, Y;Hu, YC;Weng, H;Huang, H;Prince, E;Cogle, CR;Sun, M;Zhang, B;Chen, CW;Marcucci, G;He, C;Qian, Z;Chen, J;RNA Demethylase ALKBH5 Selectively Promotes Tumorigenesis and Cancer Stem Cell Self-Renewal in Acute Myeloid LeukemiaCell stem cell32402250Thereafter, the transduced cells were then plated into ColonyGEL methylcellulose medium (ReachBio, Seattle, WA) supplied with 10 ng/ml of murine recombinant IL-3, IL-6, GM-CSF and 30 ng/ml of murine recombinant SCF, along with 1.0 mg/ml of G418 (GibcFull Paper
2020Chiu, D;Tavaré, R;Haber, L;Aina, OH;Vazzana, K;Ram, P;Danton, M;Finney, J;Jalal, S;Krueger, P;Giurleo, JT;Ma, D;Smith, E;Thurston, G;Kirshner, JR;Crawford, A;A PSMA-Targeting CD3 Bispecific Antibody Induces Antitumor Responses that Are Enhanced by 4-1BB CostimulationCancer immunology research32184296PBMCs were obtained from ReachBio (WA) for in vivo (ReachBio). C4-2 tumor cells were subcutaneously injected with 5 × 10 6 tumor cells and 1 × 10 6 human PBMCs (ReachBio). SaveFull Paper
2020Patterson, AM;Liu, L;Sampson, CH;Plett, PA;Li, H;Singh, P;Mohammad, KS;Hoggatt, J;Capitano, ML;Orschell, CM;Pelus, LM;A Single Radioprotective Dose of Prostaglandin E2 Blocks Irradiation-Induced Apoptotic Signaling and Early Cycling of Hematopoietic Stem CellsStem cell reports32735825CFCs were quantitated as described by Hoggatt et al. (2013a). TNCs from non-IR mice were plated at 2 × 104 per 35-mm dish in triplicate in ColonyGEL Mouse Complete Medium (Reach Bio, Seattle, WA). Cells from IR mice were plated at 0.5-1 × 106 per disFull Paper
2020Paulson, RF;Hariharan, S;Little, JA;Stress erythropoiesis: definitions and models for its studyExperimental hematology32750404Control PBMCs were purchased from ReachBio. PBMCs obtained were plated at 1 x 10 6 cells/ml stress erythropoiesis differentiation media containing human growth factors. The cells SaveFull Paper
2020Patterson, AM;Plett, PA;Chua, HL;Sampson, CH;Fisher, A;Feng, H;Unthank, JL;Miller, SJ;Katz, BP;MacVittie, TJ;Orschell, CM;Development of a Model of the Acute and Delayed Effects of High Dose Radiation Exposure in Jackson Diversity Outbred Mice; Comparison to Inbred C57BL/6 MiceHealth physics32932286Colony-forming unit cell (CFU-C) analyses Functional BM progenitor number was analyzed utilizing methylcellulose colony assays as per manufacturer instructions (Colony Gel 1202, ReachBio, Seattle, WA)Full Paper
2020Radtke, S;Colonna, L;Perez, AM;Hoffman, M;Kean, LS;Kiem, HP;Isolation of a Highly Purified HSC-enriched CD34+CD90+CD45RA- Cell Subset for Allogeneic Transplantation in the Nonhuman Primate Large-animal ModelTransplantation direct33134503CFC) assays were sorted in purity mode to prevent crosscontamination by different subsets. Colony-forming Cell Assay For CFC assays, 1000 to 1200 sorted cells were seeded into 3.5 mL ColonyGEL 1402 (ReachBio, Seattle, WA). Hematopoietic colonies werFull Paper
2019Bonner, M;Kanter, J;Macari, E;Lane, R;Lewis, G;Coles, P;Kassenaar, S;Mynampati, S;Schulze, R;Hebert, M;Walters, M;Thompson, A;Asmal, M;Tisdale, J;Pierciey, F;The Relationships between Target Gene Transduction, Engraftment of HSCs and RBC Physiology in Sickle Cell Disease Gene TherapyBloodBackground LentiGlobin for Sickle Cell Disease (SCD) gene therapy contains ex-vivo lentiviral vector (LVV)-mediated addition of a modified β-globin gene (βA-T87Q) into autologous CD34+ hematopoietic stem cells (HSCs). The safety and efFull Paper
2019Kanter, J;Tisdale, J;Mapara, M;Kwiatkowski, J;Krishnamurti, L;Schmidt, M;Miller, A;Pierciey, F;Huang, W;Ribeil, J;Thompson, A;Walters, M;Resolution of Sickle Cell Disease Manifestations in Patients Treated with Lentiglobin Gene Therapy: Updated Results from the Phase 1/2 Hgb-206 Group C StudyBloodBackground β-globin gene transfer into hematopoietic stem cells (HSCs) could reduce or eliminate sickle cell disease (SCD)-related manifestations. LentiGlobin for SCD gene therapy contains autologous CD34+ cells transduced with the BB3Full Paper
2019Walters, M;Tisdale, J;Kwiatkowski, J;Krishnamurti, L;Mapara, M;Schmidt, M;Miller, A;Pierciey, F;Huang, W;Ribeil, J;Kanter, J;Thompson, A;Exploring the Drivers of Potential Clinical Benefit in Initial Patients Treated in the Hgb-206 Study of Lentiglobin for Sickle Cell Disease (SCD) Gene TherapyBloodBackground LentiGlobin for SCD gene therapy contains autologous CD34+ hematopoietic stem cells (HSCs) transduced with the BB305 lentiviral vector (LVV) encoding β-globin with an anti-sickling substitution (T87Q). Its safety and efficacFull Paper
2019Eapen, M;Neuberg, D;Mendizabal, A;Stevenson, K;Antin, J;DiFronzo, N;El Rassi, F;Lulla, P;Waller, E;Garrison, J;Smith, S;Sullivan, K;Walters, M;Krishnamurti, L;A Phase II Trial to Compare Allogeneic Transplant Vs. Standard of Care for Severe Sickle Cell Disease: Blood and Marrow Transplant Clinical Trials Network (BMT CTN) Protocol 1503BloodBackground: Allogeneic hematopoietic cell transplantation (HCT) is a curative treatment for sickle cell disease (SCD). A pilot trial confirmed the suitability of a myeloablative conditioning regimen (busulfan/fludarabine/r-ATG) for HLA-matched siblinFull Paper
2019Loi, S;Giobbie-Hurder, A;Gombos, A;Bachelot, T;Hui, R;Curigliano, G;Campone, M;Biganzoli, L;Bonnefoi, H;Jerusalem, G;Bartsch, R;Rabaglio-Poretti, M;Kammler, R;Maibach, R;Smyth, M;Di Leo, A;Colleoni, M;Viale, G;Regan, M;André, F;Fumagalli, D;Gelber, R;Goulioti, T;Hiltbrunner, A;Hui, R;Roschitzki, H;Ruepp, B;Boyle, F;Stahel, R;Aebi, S;Coates, A;Goldhirsch, A;Karlsson, P;Kössler, I;Fournarakou, S;Gasca, A;Pfister, R;Ribeli-Hofmann, S;Weber, M;Celotto, D;Comune, C;Frapolli, M;Sánchez-Hohl, M;Huang, H;Mahoney, C;Price, K;Scott, K;Shaw, H;Fischer, S;Greco, M;King, C;Andrighetto, S;Piccart-Gebhart, M;Findlay, H;Jenkins, M;Karantza, V;Mejia, J;Schneier, P;Pembrolizumab plus trastuzumab in trastuzumab-resistant, advanced, HER2-positive breast cancer (PANACEA): a single-arm, multicentre, phase 1b–2 trialThe Lancet OncologyPD-L1 status for the first 79 patients was assessed with the QualTek immunohistochemistry assay (QualtTek Molecular Laboratories, Santa Barbara, CA, USA) in which PD-L1 staining in at least 1% of tumour cells or any staining in stroma were defined asFull Paper
2019Kassim, A;Walters, M;Eapen, M;Allison, B;Mendizabal, A;Brodsky, R;DeBaun, M;Reduced Intensity Conditioning for Haploidentical Bone Marrow Transplantation in Patients with Symptomatic Sickle Cell Disease: BMT CTN Protocol 1507BloodBackground: Hematopoietic cell transplantation (HCT) has curative potential in sickle cell disease (SCD). A reduced intensity haploidentical bone marrow transplant (haplo-BMT) platform piloted by investigators at Johns Hopkins, addressed key barriersFull Paper
2019Nghiem, P;Bhatia, S;Lipson, EJ;Sharfman, WH;Kudchadkar, RR;Brohl, AS;Friedlander, PA;Daud, A;Kluger, HM;Reddy, SA;Boulmay, BC;Riker, AI;Burgess, MA;Hanks, BA;Olencki, T;Margolin, K;Lundgren, LM;Soni, A;Ramchurren, N;Church, C;Park, SY;Shinohara, MM;Salim, B;Taube, JM;Bird, SR;Ibrahim, N;Fling, SP;Homet Moreno, B;Sharon, E;Cheever, MA;Topalian, SL;Durable Tumor Regression and Overall Survival in Patients With Advanced Merkel Cell Carcinoma Receiving Pembrolizumab as First-Line TherapyJ. Clin. Oncol.3072617521,22. PD-L1 IHC. PD-L1 staining (anti-PD-L1 clone 22C3; Merck Research Laboratories, Kenilworth, NJ) was performed at QualTek Molecular Laboratories (Newtown, PA) on formalin-fixed paraffin-embedded sections from pretreatment MCC biopsies, as previoFull Paper
2019Fedoriw, A;Rajapurkar, SR;O'Brien, S;Gerhart, SV;Mitchell, LH;Adams, ND;Rioux, N;Lingaraj, T;Ribich, SA;Pappalardi, MB;Shah, N;Laraio, J;Liu, Y;Butticello, M;Carpenter, CL;Creasy, C;Korenchuk, S;McCabe, MT;McHugh, CF;Nagarajan, R;Wagner, C;Zappacosta, F;Annan, R;Concha, NO;Thomas, RA;Hart, TK;Smith, JJ;Copeland, RA;Moyer, MP;Campbell, J;Stickland, K;Mills, J;Jacques-O'Hagan, S;Allain, C;Johnston, D;Raimondi, A;Porter Scott, M;Waters, N;Swinger, K;Boriack-Sjodin, A;Riera, T;Shapiro, G;Chesworth, R;Prinjha, RK;Kruger, RG;Barbash, O;Mohammad, HP;Anti-tumor Activity of the Type I PRMT Inhibitor, GSK3368715, Synergizes with PRMT5 Inhibition through MTAP LossCancer Cell31257072GSK3368715 was evaluated at 20, 5, 1.25, 0.3125 and 0.078 mM in a total of 10 patient samples. DLBCL patient cells from 10 unique donors were received as frozen samples from Conversant Bio. The human biological samples were sourced ethically and theiFull Paper
2019Leighl, NB;Hellmann, MD;Hui, R;Carcereny, E;Felip, E;Ahn, MJ;Eder, JP;Balmanoukian, AS;Aggarwal, C;Horn, L;Patnaik, A;Gubens, M;Ramalingam, SS;Lubiniecki, GM;Zhang, J;Piperdi, B;Garon, EB;Pembrolizumab in patients with advanced non-small-cell lung cancer (KEYNOTE-001): 3-year results from an open-label, phase 1 studyLancet Respir Med30876831NR=not reached. PD-L1=programmed death ligand 1. TPS=tumour proportion score. *PD-L1 TPS 1% on the basis of the QualTek assay (Molecular Laboratories, GoletaFull Paper
2019Melamed, Z;López-Erauskin, J;Baughn, MW;Zhang, O;Drenner, K;Sun, Y;Freyermuth, F;McMahon, MA;Beccari, MS;Artates, JW;Ohkubo, T;Rodriguez, M;Lin, N;Wu, D;Bennett, CF;Rigo, F;Da Cruz, S;Ravits, J;Lagier-Tourenne, C;Cleveland, DW;Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegenerationNat. Neurosci.30643298... titute for the kind contribution of the SIN18 vector. We thank B. Ren for providing the Illumina sequencing platform. We thank A. Goginashvili for valued input on the manuscript. We thank J. Nuovo at Phylogeny Inc. (Columbus, OH) for performing tFull Paper
2019Thompson, A;Walters, M;Kwiatkowski, J;Hongeng, S;Porter, J;Sauer, M;Thrasher, A;Thuret, I;Elliot, H;Tao, G;Colvin, R;Locatelli, F;Northstar-2: Updated Safety and Efficacy Analysis of Lentiglobin Gene Therapy in Patients with Transfusion-Dependent β-Thalassemia and Non-β0/β0 GenotypesBloodBackground Transfusion-dependent β-thalassemia (TDT) is treated with regular, lifelong red blood cell (RBC) transfusions and despite iron-chelating therapy, carries a risk of serious organ damage from iron overload and other complicatiFull Paper
2019Petermann, F;Pękowska, A;Johnson, CA;Jankovic, D;Shih, HY;Jiang, K;Hudson, WH;Brooks, SR;Sun, HW;Villarino, AV;Yao, C;Singleton, K;Akondy, RS;Kanno, Y;Sher, A;Casellas, R;Ahmed, R;O'Shea, JJ;The Magnitude of IFN-γ Responses Is Fine-Tuned by DNA Architecture and the Non-coding Transcript of Ifng-as1Mol. CellFor LCMV experiments RNA was isolated from sorted cells of LCMV-infected mice with the QIAGEN AllPrep Micro Kit. Libraries were prepared and sequenced by the HudsonAlpha Genomic Services Lab (paired-end, 150 bp reads). For all other experiments totalFull Paper
2019Kwiatkowski, J;Thompson, A;Rasko, J;Hongeng, S;Schiller, G;Anurathapan, U;Cavazzana, M;Ho, P;Schmidt, M;Kletzel, M;Vichinsky, E;Deary, B;Chen, Y;Petrusich, A;Walters, M;Long-Term Clinical Outcomes of Lentiglobin Gene Therapy for Transfusion-Dependent β-Thalassemia in the Northstar (HGB-204) StudyBloodBackground Patients with transfusion-dependent β-thalassemia (TDT) may experience transfusional iron overload and end-organ damage. While potentially curative, allogeneic hematopoietic stem cell (HSC) transplantation is limited by tranFull Paper
2019Furie, R;Werth, VP;Merola, JF;Stevenson, L;Reynolds, TL;Naik, H;Wang, W;Christmann, R;Gardet, A;Pellerin, A;Hamann, S;Auluck, P;Barbey, C;Gulati, P;Rabah, D;Franchimont, N;Monoclonal antibody targeting BDCA2 ameliorates skin lesions in systemic lupus erythematosusJ. Clin. Invest.30645203... un-exposed skin of HVs matched approximately by age and ethnicity to the BIIB059-treated cohort (mean age = 34; range, 28–37; White, 6/8; Asian, 1/8; Black or African American, 1/8; female, 8/8) by Folio Biosciences, then processed into paraffinFull Paper
2019Hudson, WH;Prokhnevska, N;Gensheimer, J;Akondy, R;McGuire, DJ;Ahmed, R;Kissick, HT;Expression of novel long noncoding RNAs defines virus-specific effector and memory CD8+ T cellsNat Commun30643116... of Emory University. RNA Isolation and sequencing RNA was isolated from sorted cells of LCMV-infected mice with the Qiagen AllPrep Micro Kit. Library preparation and sequencing were performed by the HudsonAlpha Genomic Services Laboratory via thFull Paper
2019Ma, X;Shao, Y;Tian, L;Flasch, DA;Mulder, HL;Edmonson, MN;Liu, Y;Chen, X;Newman, S;Nakitandwe, J;Li, Y;Li, B;Shen, S;Wang, Z;Shurtleff, S;Robison, LL;Levy, S;Easton, J;Zhang, J;Analysis of error profiles in deep next-generation sequencing dataGenome Biol.30867008Department of Computational Biology, St. Jude Children's Research Hospital, Memphis, TN, 38105, USA. Xiaotu.Ma@stjude.org.++Department of Computational Biology, St. Jude Children's Research Hospital, Memphis, TN, 38105, USA.++Department of ComputatioFull Paper
2019Zeng, Q;Liao, C;Terhune, J;Wang, L;Impacts of florfenicol on the microbiota landscape and resistome as revealed by metagenomic analysisMicrobiome31818316Carlsbad, CA) according to the manufacturer's instructions. The library construction and sequencing were conducted at the HudsonAlpha Genomic Services Lab (Huntsville, AL, USA). Genomic libraries were prepared with theFull Paper
2019Lee, CR;Yonk, AJ;Wiskerke, J;Paradiso, KG;Tepper, JM;Margolis, DJ;Opposing Influence of Sensory and Motor Cortical Input on Striatal Circuitry and Choice BehaviorCurr. Biol.30982651Light was delivered to the cortical afferents and PV interneurons in the striatum through an optical fiber patchcord (Thorlabs; length 1 m; 0.50 nA; 200 mm diameter) connected to an optical cannula (described above) via a mating sleeve (Thorlabs). AFull Paper
2019Ramachandran, I;Lowther, DE;Dryer-Minnerly, R;Wang, R;Fayngerts, S;Nunez, D;Betts, G;Bath, N;Tipping, AJ;Melchiori, L;Navenot, JM;Glod, J;Mackall, CL;D'Angelo, SP;Araujo, DM;Chow, WA;Demetri, GD;Druta, M;Van Tine, BA;Grupp, SA;Abdul Razak, AR;Wilky, B;Iyengar, M;Trivedi, T;Winkle, EV;Chagin, K;Amado, R;Binder, GK;Basu, S;Systemic and local immunity following adoptive transfer of NY-ESO-1 SPEAR T cells in synovial sarcomaJ Immunother Cancer31651363d Cross (Philadelphia, PA). NY-ESO-1 testing was performed via IHC at a Clinical Laboratory Improvement Amendments certified pathology laboratory at the National Cancer Institute (Bethesda, MD) or at QualTek Labs (Goleta, CA). Disease response was clFull Paper
2019Spino, M;Kurz, SC;Chiriboga, L;Serrano, J;Zeck, B;Sen, N;Patel, S;Shen, G;Vasudevaraja, V;Tsirigos, A;Suryadevara, CM;Frenster, JD;Tateishi, K;Wakimoto, H;Jain, R;Riina, HA;Nicolaides, TP;Sulman, EP;Cahill, DP;Golfinos, JG;Isse, K;Saunders, LR;Zagzag, D;Placantonakis, DG;Snuderl, M;Chi, AS;Cell Surface Notch Ligand DLL3 is a Therapeutic Target in Isocitrate Dehydrogenase-mutant GliomaClin. Cancer Res.30397180For the discovery set, 20 nontumor brain tissue samples and 63 glioma tumor samples were obtained from Cooperative Human Tumor Network (CHTN), Conversant Bio, and RS Diagnostics. This set of tumors included the following diagnoses: glioblastoma, WHOFull Paper
2019Habra, MA;Stephen, B;Campbell, M;Hess, K;Tapia, C;Xu, M;Rodon Ahnert, J;Jimenez, C;Lee, JE;Perrier, ND;Boraddus, RR;Pant, S;Subbiah, V;Hong, DS;Zarifa, A;Fu, S;Karp, DD;Meric-Bernstam, F;Naing, A;Phase II clinical trial of pembrolizumab efficacy and safety in advanced adrenocortical carcinomaJ Immunother Cancer31533818PD-L1 staining was performed by Qualtek using Merck 22C3 antibody for PD-L1 and scored by a board-certified pathologist. Based on the percentage and intensity of membrane staining, H-score, ranging from 0 to 300, was assigned to tumor samples ;iFull Paper
2019Lv, JW;Li, JY;Luo, LN;Wang, ZX;Chen, YP;Comparative safety and efficacy of anti-PD-1 monotherapy, chemotherapy alone, and their combination therapy in advanced nasopharyngeal carcinoma: findings from recent advances in landmark trialsJ Immunother Cancer31238988D-L1 expression was assessed baseline on an archived formalin-fixed, paraffin-embedded tumor sample or a newly obtained biopsy sample using a laboratory-developed prototype immunohistochemical assay (QualTek Molecular Laboratories, Goleta, CA). PD-L1Full Paper
2019Clouthier, DL;Lien, SC;Yang, SYC;Nguyen, LT;Manem, VSK;Gray, D;Ryczko, M;Razak, ARA;Lewin, J;Lheureux, S;Colombo, I;Bedard, PL;Cescon, D;Spreafico, A;Butler, MO;Hansen, AR;Jang, RW;Ghai, S;Weinreb, I;Sotov, V;Gadalla, R;Noamani, B;Guo, M;Elston, S;Giesler, A;Hakgor, S;Jiang, H;McGaha, T;Brooks, DG;Haibe-Kains, B;Pugh, TJ;Ohashi, PS;Siu, LL;An interim report on the investigator-initiated phase 2 study of pembrolizumab immunological response evaluation (INSPIRE)J Immunother Cancer30867072IHC. For screening biopsies only, the FFPE blocks were used for PD-L1 IHC (clone 22C3) on 4-5 μm sections mounted on positively charged ProbeOn slides (QualTek, Goleta, CA). QualTek provided a modified proportion score ;from the same site as theFull Paper
2019Rowley, MJ;Lyu, X;Rana, V;Ando-Kuri, M;Karns, R;Bosco, G;Corces, VG;Condensin II Counteracts Cohesin and RNA Polymerase II in the Establishment of 3D Chromatin OrganizationCell Rep30865881We would like to thank the HudsonAlpha Institute for Biotechnology Genomic Services Lab for their help with Illumina sequencing. This work was supported by NIH Pathway to Independence Award K99/R00 GM127671 (M.J.R.) and U.S. Public Health Service AwaFull Paper
2019Wu, T;Dejanovic, B;Gandham, VD;Gogineni, A;Edmonds, R;Schauer, S;Srinivasan, K;Huntley, MA;Wang, Y;Wang, TM;Hedehus, M;Barck, KH;Stark, M;Ngu, H;Foreman, O;Meilandt, WJ;Elstrott, J;Chang, MC;Hansen, DV;Carano, RAD;Sheng, M;Hanson, JE;Complement C3 Is Activated in Human AD Brain and Is Required for Neurodegeneration in Mouse Models of Amyloidosis and TauopathyCell Rep31433986Human CSF cohort 1 Folio Biosciences n/a Human CSF cohort 2 PrecisionMed n/a Frozen human brain tissue Folio Biosciences n/Full Paper
2019Angelova, E;Audette, C;Kovtun, Y;Daver, N;Wang, SA;Pierce, S;Konoplev, SN;Khogeer, H;Jorgensen, JL;Konopleva, M;Zweidler-McKay, PA;Medeiros, LJ;Kantarjian, HM;Jabbour, EJ;Khoury, JD;CD123 expression patterns and selective targeting with a CD123-targeted antibody-drug conjugate (IMGN632) in acute lymphoblastic leukemiaHaematologica30361418... In vitro evaluation of primary B-cell acute lymphoblastic leukemia samples Bone marrow mononuclear cells from 11 newly diagnosed and 10 relapsed/refractory B-ALL patients were obtained from MDACC or ConversantBio. The number of CD123 antibody-biFull Paper
2019Bao, L;Tian, C;Liu, S;Zhang, Y;Elaswad, A;Yuan, Z;Khalil, K;Sun, F;Yang, Y;Zhou, T;Li, N;Tan, S;Zeng, Q;Liu, Y;Li, Y;Li, Y;Gao, D;Dunham, R;Davis, K;Waldbieser, G;Liu, Z;The Y chromosome sequence of the channel catfish suggests novel sex determination mechanisms in teleost fishBMC Biol.30683095;... Bioanalyzer. Equal amounts of RNA from each 5-day period were pooled from 10 to 14 dpf and 15 to 19 dpf for male and female, respectively. These four pooled samples were outsourced for RNA-Seq at the HudsonAlpha Genomic Services Lab (Huntsville,Full Paper
2019Rieker, C;Migliavacca, E;Vaucher, A;Mayer, FC;Baud, G;Marquis, J;Charpagne, A;Hegde, N;Guignard, L;McLachlan, M;Pooler, AM;Apolipoprotein E4 Expression Causes Gain of Toxic Function in Isogenic Human Induced Pluripotent Stem Cell-Derived Endothelial CellsArterioscler. Thromb. Vasc. Biol.31315437Immunohistochemistry Analysis of Postmortem Human Brain Tissue Human hippocampal brain tissue from AD (Braak stage V-VI; both male and female) individuals was purchased from Folio Biosciences, genotyped for ApoE, and processed for cryo- sectioningFull Paper
2019Smith, A;Schiller, G;Vercellotti, G;Kwiatkowski, J;Krishnamurti, L;Esrick, E;Williams, D;Miller, W;Woolfson, A;Walters, M;Preliminary Results of a Phase 1/2 Clinical Study of Zinc Finger Nuclease-Mediated Editing of BCL11A in Autologous Hematopoietic Stem Cells for Transfusion-Dependent Beta ThalassemiaBloodIntroduction: Persistently high fetal hemoglobin (HbF) expression can ameliorate severe transfusion-dependent beta thalassemia (TDT). BCL11A, a master regulator of the fetal-to-adult hemoglobin switch, is a rational gene-editing target in beta globinFull Paper
2019Kang, J;Yeom, G;Jang, H;Oh, J;Park, CJ;Kim, MG;Development of Replication Protein A-Conjugated Gold Nanoparticles for Highly Sensitive Detection of Disease BiomarkersAnal. Chem.31269392Patient samples for NP and cTnI were obtained from Discovery Life Sciences, Inc. The study protocol was thoroughly explained to the patients, and signed written informed consent forms were obtained in accordance with the approved guidelines and relevFull Paper
2019Planes-Laine, G;Rochigneux, P;Bertucci, F;Chrétien, AS;Viens, P;Sabatier, R;Gonçalves, A;PD-1/PD-L1 Targeting in Breast Cancer: The First Clinical Evidences Are Emerging. A Literature ReviewCancers (Basel)31336685ts included locally advanced or metastatic disease, after a failure of or inability to receive standard therapy, ECOG PS 0 or 1, ≥ 1 measurable lesion and PD-L1 positivity, using a prototype assay (QualTek Molecular Laboratories, Goleta, CA, USA) andFull Paper
2019Bernard-Gauthier, V;Mossine, AV;Knight, A;Patnaik, D;Zhao, WN;Cheng, C;Krishnan, HS;Xuan, LL;Chindavong, PS;Reis, SA;Chen, JM;Shao, X;Stauff, J;Arteaga, J;Sherman, P;Salem, N;Bonsall, D;Amaral, B;Varlow, C;Wells, L;Martarello, L;Patel, S;Liang, SH;Kurumbail, RG;Haggarty, SJ;Scott, PJH;Vasdev, N;Structural Basis for Achieving GSK-3β Inhibition with High Potency, Selectivity, and Brain Exposure for Positron Emission Tomography Imaging and Drug DiscoveryJ. Med. Chem.31535859For autoradiography experiments, fresh-frozen postmortem human brain tissue blocks were acquired from Folio-Conversant and the University of California at San Francisco NDBB. In vitro autoradiography studies were performed as described in the SupportFull Paper
2019McCoy, CR;Glover, ME;Flynn, LT;Simmons, RK;Cohen, JL;Ptacek, T;Lefkowitz, EJ;Jackson, NL;Akil, H;Wu, X;Clinton, SM;Altered DNA Methylation in the Developing Brains of Rats Genetically Prone to High versus Low AnxietyJ. Neurosci.30683683Starting material for the enrichment protocol was 1g of sonicated DNA, and captured fragments were eluted using 2500 mM NaCl per the manufacturer’s instructions and as described previously (Brinkman et al., 2010). Captured material was purified usingFull Paper
2019Chiu, H;Trisal, P;Bjorklund, C;Carrancio, S;Toraño, EG;Guarinos, C;Papazoglou, D;Hagner, PR;Beldi-Ferchiou, A;Tarte, K;Delfau-Larue, MH;Morschhauser, F;Ramsay, AG;Gandhi, AK;Combination lenalidomide-rituximab immunotherapy activates anti-tumour immunity and induces tumour cell death by complementary mechanisms of action in follicular lymphomaBr. J. Haematol.30767211Viably‐frozen PBMC from naive and relapsed/refractory FL and MZL patients were purchased from ConversantBio (Huntsville, AL, USA), ProteoGenex, (Inglewood, CA, USA) and BioreclammationIVT (Hicksville, NY, USA). Cell lines and cell cultureFull Paper
2019Liang, X;Zhuang, J;Löffler, FE;Zhang, Y;DeBruyn, JM;Wilhelm, SW;Schaeffer, SM;Radosevich, M;Viral and bacterial community responses to stimulated Fe(III)-bioreduction during simulated subsurface bioremediationEnviron. Microbiol.30773777Whole soil DNA was obtained by extracting both soil aggregates and associated pore water (Cápiro et al., 2014) using PowerLyser PowerSoil DNA isolation kit (MoBio Laboratories Inv. Carlsbad, CA) following the manufacturer’s instructions. The extracteFull Paper
2019Nowinski, B;Motard-Côté, J;Landa, M;Preston, CM;Scholin, CA;Birch, JM;Kiene, RP;Moran, MA;Microdiversity and temporal dynamics of marine bacterial dimethylsulfoniopropionate genesEnviron. Microbiol.30761723This article is protected by copyright. All rights reserved. Page 23. HiSeq Rapid Run at HudsonAlpha Genomic Services Laboratory (Huntsville, AL, USA). Metagenomic data are deposited in the NCBI SRA under project number PRJNA505827. Single AmplifiedFull Paper
2019Xu, H;Muise, ES;Javaid, S;Chen, L;Cristescu, R;Mansueto, MS;Follmer, N;Cho, J;Kerr, K;Altura, R;Machacek, M;Nicholson, B;Addona, G;Kariv, I;Chen, H;Identification of predictive genetic signatures of Cytarabine responsiveness using a 3D acute myeloid leukaemia modelJ. Cell. Mol. Med.314493472 METHODS. 2.1 Cells and reagents. Normal and AML patient BMMCs were purchased from Folio Conversant and ProteoGenex. Recombinant human fibronectin was purchased from Millipore. Rat tail collagen type 1 and matrigel were purchased from Corning IncFull Paper
2019Kim, YJ;Keam, B;Ock, CY;Song, S;Kim, M;Kim, SH;Kim, KH;Kim, JS;Kim, TM;Kim, DW;Lee, JS;Heo, DS;A phase II study of pembrolizumab and paclitaxel in patients with relapsed or refractory small-cell lung cancerLung Cancer31494530Informed consent for specimens be obtained during screening for protocol enrollment from all subjects or legally acceptable representative, at a trial visit by the investigator or designate. Pretreatment blood sampling and tumor biopsies will be doneFull Paper
2019Yang, X;Saito, Y;Rao, A;Kim, HJ;Singh, P;Scott, E;Larson, M;Pan, W;Desai, M;Hubbell, E;Alignment-free filtering for cfNA fusion fragmentsBioinformatics31510681We have obtained 40 ml of whole blood collected in Streck tubes, separated into plasma and extracted cfRNA samples from two Stage IV Prostate cancer patients and three healthy controls from Conversant Bio and generated cfRNA sequencing data with UMIsFull Paper
2019Qi, Z;Wang, L;Desai, K;Cogswell, J;Stern, M;Lawson, B;Kerkar, SP;Vitazka, P;Reliable Gene Expression Profiling from Small and Hematoxylin and Eosin-Stained Clinical Formalin-Fixed, Paraffin-Embedded Specimens Using the HTG EdgeSeq PlatformJ Mol Diagn31255795Rockville, MD). Small-cell lung cancer (SCLC) samples (n = 4) were purchased from Conversant Biologics, Inc. (Huntsville, AL) or Proteogenex (Inglewood, CA). FFPE muscle tissue was obtained from Proteogenex. RNA samplesFull Paper
2019Dietz, L;Dömel, JS;Leese, F;Mahon, AR;Mayer, C;Phylogenomics of the longitarsal Colossendeidae: The evolutionary history of an Antarctic sea spider radiationMol. Phylogenet. Evol.31002869Sea spiders (Pycnogonida) constitute a group of marine benthic arthropods that has a particularly high species diversity in the Southern Ocean. The "longitarsal" group of the sea spider family Colossendeidae is especially abundant in this region. HowFull Paper
2019Varga, A;Piha-Paul, S;Ott, PA;Mehnert, JM;Berton-Rigaud, D;Morosky, A;Yang, P;Ruman, J;Matei, D;Pembrolizumab in patients with programmed death ligand 1-positive advanced ovarian cancer: Analysis of KEYNOTE-028Gynecol. Oncol.30522700disease based on Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST v1.1), PD-L1 positivity, determined immunohistochemically and defined as membranous staining on ≥1% modified proportion score or interface pattern (QualTek Molecular LaFull Paper
2019Lee, MJ;Miller, Z;Park, JE;Bhattarai, D;Lee, W;Kim, KB;H727 cells are inherently resistant to the proteasome inhibitor carfilzomib, yet require proteasome activity for cell survival and growthSci Rep30858500... on-linear regression based on n = 3 replicates per compound per concentration. (d) Heat map showing proteasome catalytic subunit activity profiles of 6 PI-naïve patient MM samples purchased from Conversant Biologics and AllCells (left). The numbeFull Paper
2019Liang, X;Radosevich, M;Löffler, F;Schaeffer, SM;Zhuang, J;Impact of microbial iron oxide reduction on the transport of diffusible tracers and non-diffusible nanoparticles in soilsChemosphere30597359Inc. Carlsbad, California, USA). The DNA samples were quantified using PicoGreen Assay Kit (Carlsbad, California, USA) and sent out for sequencing at HudsonAlpha Genomic Services Lab (Huntsville, Alabama, USA). TheFull Paper
2019Nicolini, F;Bocchini, M;Bronte, G;Delmonte, A;Guidoboni, M;Crinò, L;Mazza, M;Malignant Pleural Mesothelioma: State-of-the-Art on Current Therapies and Promises for the FutureFront Oncol32039010With a centrally-assessed 22C3 antibody-based immunohistochemistry assay (Qualtek laboratory), PDL1 expression was available in 62 patients: 45% were found negative (Full Paper
2019Gani, AW;Wei, W;Shi, RZ;Ng, E;Nguyen, M;Chua, MS;So, S;Wang, SX;An Automated, Quantitative, and Multiplexed Assay Suitable for Point-of-Care Hepatitis B Virus DiagnosticsSci Rep31666635HBV DNA levels). As controls, we recruited 5 healthy volunteers who had no prior history of HBV and who were vaccinated against HBV. Serum samples from healthy Asian donors were also purchased from Conversant Biologics (Huntsville, AL). SupplementaFull Paper
2019Li, Y;Kocot, KM;Tassia, MG;Cannon, JT;Bernt, M;Halanych, KM;Mitogenomics Reveals a Novel Genetic Code in HemichordataGenome Biol Evol30476024Variant codes in mitochondrial genomes within deuterostomes and photos from representatives of hemichordates. (A) Phylogenetic relationships according to the current understanding of deuterostome phylogeny based on multiple studies, red bars show codFull Paper
2019Juttukonda, LJ;Green, ER;Lonergan, ZR;Heffern, MC;Chang, CJ;Skaar, EP;Acinetobacter baumannii OxyR Regulates the Transcriptional Response to Hydrogen PeroxideInfect. Immun.30297527RNA-seq library construction and sequencing were performed by HudsonAlpha (Huntsville, AL). The concentration and integrity of the total RNA were estimated with a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, CA) and an Agilent 2100 bioanalyzer (AppliFull Paper
2019Patel, S;Knight, A;Krause, S;Teceno, T;Tresse, C;Li, S;Cai, Z;Gouasmat, A;Carroll, VM;Barret, O;Gottmukkala, V;Zhang, W;Xiang, X;Morley, T;Huang, Y;Passchier, J;Preclinical In Vitro and In Vivo Characterization of Synaptic Vesicle 2A-Targeting Compounds Amenable to F-18 Labeling as Potential PET Radioligands for Imaging of Synapse IntegrityMol Imaging Biol31728839The same procedure was used for human post-mortem tissue (Folio Biosciences, Miami Brain Bank, and UCSF Memory and Aging Center, USA). In Vitro Homogenate Binding. All homogenate studies were carried out in 96-well format as previously described [14]Full Paper
2019Gao, L;Yuan, Z;Zhou, T;Yang, Y;Gao, D;Dunham, R;Liu, Z;FOXO genes in channel catfish and their response after bacterial infectionDev. Comp. Immunol.30905685; Plus Kit (Qiagen). RNA-seq library was prepared and sequenced by HudsonAlpha Genomic Services Lab (Huntsville, AL, USA) using an Illumina HiSeq 2000 instrument with 100 bp paired end (PE) reads. The trimmed highFull Paper
2019Havird, JC;Meyer, E;Fujita, Y;Vaught, RC;Henry, RP;Santos, SR;Disparate responses to salinity across species and organizational levels in anchialine shrimpsJ. Exp. Biol.31727759Assembly of reference transcriptomes was previously described for H. rubra (Havird and Santos, 2016a) and the four species from Japan (Havird et al., 2014b). Briefly, total RNA was extracted from whole animals 1 month after preservation in RNAlater vFull Paper
2019Rey, EG;Finkelstein, JL;Erickson, D;Fluorescence lateral flow competitive protein binding assay for the assessment of serum folate concentrationsPLoS ONE31166978Serum sample preparation. Calibration curves made with human serum spiked with FA and 5-MTHF were performed as part of a previous work[26]. Human serum samples of varying folate concentration were purchased from Discovery Life Sciences Inc. (Los OsosFull Paper
2019Mehnert, JM;Varga, A;Brose, MS;Aggarwal, RR;Lin, CC;Prawira, A;de Braud, F;Tamura, K;Doi, T;Piha-Paul, SA;Gilbert, J;Saraf, S;Thanigaimani, P;Cheng, JD;Keam, B;Safety and antitumor activity of the anti-PD-1 antibody pembrolizumab in patients with advanced, PD-L1-positive papillary or follicular thyroid cancerBMC Cancer30832606biopsy sample. PD-L1 expression was assessed using a prototype immunohistochemistry assay (QualTek Molecular Laboratories, Goleta, California) [22] and the 22C3 antibody (Merck & Co., Inc., Kenilworth, New Jersey). PD ;screening period using eiFull Paper
2019Huang, RSP;Holmes, BF;Powell, C;Marati, RV;Tyree, D;Admire, B;Streator, A;Newell, AEH;Perez, J;Dalvi, D;ElGabry, EA;Delta-like Protein 3 Prevalence in Small Cell Lung Cancer and DLL3 (SP347) Assay CharacteristicsArch. Pathol. Lab. Med.30958693formalin), paraffin-embedded SCLC whole-section samples was procured from an internal tissue bank at Ventana Medical Systems, Inc, and the following commercial tissue banks: Asterand Bioscience; Avaden BioSciences; Boca Biolistics; Conversant Bio; GLFull Paper
2019Tsypin, M;Asmellash, S;Meyer, K;Touchet, B;Roder, H;Extending the information content of the MALDI analysis of biological fluids via multi-million shot analysisPLoS ONE31815946100 serum samples were purchased from the commercial biobanks Conversant Bio (Huntsville, AL) and Oncology Metrics (Fort Worth, TX). Samples were collected under ethics-approved protocols according to the requirements of Conversant Bio and Oncology MFull Paper
2019Li, S;Song, C;Yang, S;Yu, W;Zhang, W;Zhang, G;Xi, Z;Lu, E;Supercritical CO2 foamed composite scaffolds incorporating bioactive lipids promote vascularized bone regeneration via Hif-1α upregulation and enhanced type H vessel formationActa biomaterialia31154054Upon reaching 80-90% confluency, the rBMSCs were passaged with passages 2-4 being used for further experiments. HUVECs (AllCells, Shanghai, China) were cultured in endothelial cell medium (ECM, ScienCell, USA) under the same conditions and used for iFull Paper
2019Desai, SP;Coston, A;Berlin, A;Micro-Electrical Impedance Spectroscopy and Identification of Patient-Derived, Dissociated Tumor CellsIEEE Trans Nanobioscience31180894Stored waveforms are further analyzed using statistical data analysis techniques. C. Dissociated Tumor Cells and Cell Culture Dissociated tumor cells (DTCs) were acquired directly from Conversant Bio (Huntsville, AL) for a range of indications and caFull Paper
2019Lee, JS;Rosoff, D;Luo, A;Longley, M;Phillips, M;Charlet, K;Muench, C;Jung, J;Lohoff, FW;PCSK9 is Increased in Cerebrospinal Fluid of Individuals With Alcohol Use DisorderAlcohol. Clin. Exp. Res.30933362the NIH Institutional Review Board (IRB). All participants provided written informed consent before participation. CSF of deidentified controls was purchased from Discovery Life Sciences, Inc. (Research Biospecimen Sample Bank, Los Osos, CA, USA)Full Paper
2019Burbelo, PD;Chaturvedi, A;Notkins, AL;Gunti, S;Luciferase-Based Detection of Antibodies for the Diagnosis of HPV-Associated Head and Neck Squamous Cell CarcinomaDiagnostics (Basel)31390810The serum samples from colon cancer (CC), systemic lupus erythematosus (SLE), and HNSCC patients used in this report were obtained from Conversant Bio (601 Genome Way Suite 1200, Huntsville, Alabama 35806). SubjectsFull Paper
2019Kao, JH;Lin, CY;Chuang, WL;Cheng, YY;Hu, JY;Liang, WK;Friebe, P;Palmer, S;Huang, CS;Clinical evaluation of IntelliPlexTM HCV genotyping kit for hepatitis C virus genotypingDiagn. Microbiol. Infect. Dis.30975461as certified by the commercial supplier in the accompanying Certificate of Analysis (CoA)), including genotypes 3, 4 and 5 were spiked into the sample pool (samples were obtained from SeraCare Life Sciences Inc., [Cambridge, MA United States]; DiscovFull Paper
2019Lagatie, O;Verheyen, A;Nijs, E;Batsa Debrah, L;Debrah, YA;Stuyver, LJ;Performance evaluation of 3 serodiagnostic peptide epitopes and the derived multi-epitope peptide OvNMP-48 for detection of Onchocerca volvulus infectionParasitol. Res.31089811and informed consent, which was signed by all subjects. For samples obtained from Tissue Solutions Ltd. (Glasgow, Scotland), Discovery Life Sciences, Inc. (Los Osos, USA), Bioreclamation IVT (Baltimore, USA), Mayo ClinicFull Paper
2019Montazeri, M;Marbut, C;Huitink, D;Interconnect Fatigue Failure Parameter Isolation for Power Device Reliability Prediction in Alternative Accelerated Mechanical Cycling TestJournal of Electronic PackagingIEEE Forth Workshop on Wide Bandgap Power Devices and Applications ( WiPDA), Fayetteville, AR, Nov. 7-9, pp. 194– 199. 19. Qualitek, 2014, “Technical Data Sheet: Sn42/Bi58 Solder Wire,” Qualtek Electronics Corporation, Addison, IL, Accessed MaFull Paper
2019Mohan, S;Lawton, R;Palmer, C;Rojas, AC;Competitive ELISA method for novel estrogen-negative breast cancer biomarker quantitationJ. Immunol. Methods31533022system) (Rakha et al., 2008), and categorized based on estrogen-hormone-receptor orientation (viz., ER − versus ER + , n = 50), were obtained from cooperative human tissue network (Philadelphia, PA), Tissue-for-Research (Atlanta, GA), and ConversantFull Paper
2019Nicol, AF;de Andrade, CV;Gomes, SC;Brusadelli, MG;Lodin, HM;Wells, SI;Nuovo, GJ;The distribution of novel biomarkers in carcinoma-in-situ, microinvasive, and squamous cell carcinoma of the uterine cervixAnn Diagn Pathol30579259National Institute of Infectious Diseases Evandro Chagas - INI-Fiocruz, Rio de Janeiro, Brazil.++National Institute of Health of Women, Children, and Adolescents, Fernandes Figueira - IFF-FIOCRUZ, Rio de Janeiro, Brazil.++National Institute of HealthFull Paper
2019Mimitou, EP;Cheng, A;Montalbano, A;Hao, S;Stoeckius, M;Legut, M;Roush, T;Herrera, A;Papalexi, E;Ouyang, Z;Satija, R;Sanjana, NE;Koralov, SB;Smibert, P;Multiplexed detection of proteins, transcriptomes, clonotypes and CRISPR perturbations in single cellsNature methods31011186FBS 10% DMSO and aliquots of 1-1.5 million cells were thawed on the day of the experiment. PBMCs were obtained cryopreserved from AllCells (USA) and used immediately after thawing. NIH-3T3 and HEK293FT cells expressing non-targeting sgRNAs were maintFull Paper
2019Symeonides, S;Choice of Law in the American Courts in 2018: Thirty-Second Annual SurveyThe American Journal of Comparative LawIn re EP Floors Corp., No. 14-18-00610-CV, 2018 WL 4354688 (Tex. App. Sept. 13, 2018); In re Rosewood Private Invs., Inc., No. 05-18-00166-CV, 2018 WL 4403749 (Tex. App. Sept. 17, 2018); Bundy v. Adesa Houston D/B/A Adesa, Inc., No. 01-17-00863-CV, 2Full Paper
2019Yant, SR;Mulato, A;Hansen, D;Tse, WC;Niedziela-Majka, A;Zhang, JR;Stepan, GJ;Jin, D;Wong, MH;Perreira, JM;Singer, E;Papalia, GA;Hu, EY;Zheng, J;Lu, B;Schroeder, SD;Chou, K;Ahmadyar, S;Liclican, A;Yu, H;Novikov, N;Paoli, E;Gonik, D;Ram, RR;Hung, M;McDougall, WM;Brass, AL;Sundquist, WI;Cihlar, T;Link, JO;A highly potent long-acting small-molecule HIV-1 capsid inhibitor with efficacy in a humanized mouse modelNature medicine31501601Human PBMCs were collected from consenting healthy volunteers under informed consent; their use was approved by an institutional review board at AllCells. Human PBMCs, CD4 + T SaveFull Paper
2019Qu, L;Yi, Z;Zhu, S;Wang, C;Cao, Z;Zhou, Z;Yuan, P;Yu, Y;Tian, F;Liu, Z;Bao, Y;Zhao, Y;Wei, W;Programmable RNA editing by recruiting endogenous ADAR using engineered RNAsNature biotechnology3130854010% FBS and IL2 (1,000 U ml-1) and stimulated with CD3/CD28 DynaBeads (ThermoFisher, 11131D) for 2 d. Leukapheresis products from healthy donors were acquired from AllCells LLC China. All healthy donors provided informed consentFull Paper
2019Granja, JM;Klemm, S;McGinnis, LM;Kathiria, AS;Mezger, A;Corces, MR;Parks, B;Gars, E;Liedtke, M;Zheng, GXY;Chang, HY;Majeti, R;Greenleaf, WJ;Single-cell multiomic analysis identifies regulatory programs in mixed-phenotype acute leukemiaNature biotechnology31792411Description of healthy donors. PBMCs, BMMCs and CD34+ bone marrow cells were obtained from healthy donors with informed consent and compliance with relevant ethical regulations (AllCells). Individual information for each donor is provided in SupplemeFull Paper
2019Satpathy, AT;Granja, JM;Yost, KE;Qi, Y;Meschi, F;McDermott, GP;Olsen, BN;Mumbach, MR;Pierce, SE;Corces, MR;Shah, P;Bell, JC;Jhutty, D;Nemec, CM;Wang, J;Wang, L;Yin, Y;Giresi, PG;Chang, ALS;Zheng, GXY;Greenleaf, WJ;Chang, HY;Massively parallel single-cell chromatin landscapes of human immune cell development and intratumoral T cell exhaustionNature biotechnology31375813obtained from AllCells or the AllCells and isolated per manufacturer recommendations (as outlined in Supplementary Table 4). FACS-isolated populations were obtained from AllCells SaveFull Paper
2019Miller, JC;Patil, DP;Xia, DF;Paine, CB;Fauser, F;Richards, HW;Shivak, DA;Bendaña, YR;Hinkley, SJ;Scarlott, NA;Lam, SC;Reik, A;Zhou, Y;Paschon, DE;Li, P;Wangzor, T;Lee, G;Zhang, L;Rebar, EJ;Enhancing gene editing specificity by attenuating DNA cleavage kineticsNature biotechnology31359006CD34 + stem and progenitor cells were purified from mobilized peripheral blood leukapheresis products obtained from AllCells. Platelet depletion was performed, CD34 + cells were SaveFull Paper
2019Kinney, MA;Vo, LT;Frame, JM;Barragan, J;Conway, AJ;Li, S;Wong, KK;Collins, JJ;Cahan, P;North, TE;Lauffenburger, DA;Daley, GQ;A systems biology pipeline identifies regulatory networks for stem cell engineeringNature biotechnology31267104Human CD34 + progenitors derived from mobilized peripheral blood (AllCells) were expanded for 4 d in StemSpan SFEM (StemCell Technologies) with the addition of interleukin (IL)-3 ( SaveFull Paper
2019Lareau, CA;Duarte, FM;Chew, JG;Kartha, VK;Burkett, ZD;Kohlway, AS;Pokholok, D;Aryee, MJ;Steemers, FJ;Lebofsky, R;Buenrostro, JD;Droplet-based combinatorial indexing for massive-scale single-cell chromatin accessibilityNature biotechnology31235917CD34+ stem/progenitor cells, peripheral blood mononuclear cells (PBMC), and isolated peripheral blood CD4+, CD8+, CD14+, CD19+ and CD56+ cells were purchased from Allcells ( Save;BMMCs, isolated bone marrow CD34 + stem/progenitor cells, PBMCs, and iFull Paper
2019Setty, M;Kiseliovas, V;Levine, J;Gayoso, A;Mazutis, L;Pe'er, D;Characterization of cell fate probabilities in single-cell data with PalantirNature biotechnology30899105incorporate lineage information to model cell fate decisions. scRNA-seq of CD34+ human bone marrow cells Cryopreserved bone marrow stem/progenitor CD34+ cells from healthy donors were purchased from AllCells, LLC. (Cat. No. ABM022F) and stored in vaFull Paper
2019Shah, NJ;Mao, AS;Shih, TY;Kerr, MD;Sharda, A;Raimondo, TM;Weaver, JC;Vrbanac, VD;Deruaz, M;Tager, AM;Mooney, DJ;Scadden, DT;An injectable bone marrow-like scaffold enhances T cell immunity after hematopoietic stem cell transplantationNature biotechnology30742125t-specific antibodies. We isolated hematopoietic cells (Lin−Sca-1hic-kithi) using a FacsAria cell sorter (BD). Sorted cells were ≥ 95% pure. Human cord-blood derived CD34+ cells were purchased (Allcells) and expanded for seven days using expansion suFull Paper
2019Maun, HR;Jackman, JK;Choy, DF;Loyet, KM;Staton, TL;Jia, G;Dressen, A;Hackney, JA;Bremer, M;Walters, BT;Vij, R;Chen, X;Trivedi, NN;Morando, A;Lipari, MT;Franke, Y;Wu, X;Zhang, J;Liu, J;Wu, P;Chang, D;Orozco, LD;Christensen, E;Wong, M;Corpuz, R;Hang, JQ;Lutman, J;Sukumaran, S;Wu, Y;Ubhayakar, S;Liang, X;Schwartz, LB;Babina, M;Woodruff, PG;Fahy, JV;Ahuja, R;Caughey, GH;Kusi, A;Dennis, MS;Eigenbrot, C;Kirchhofer, D;Austin, CD;Wu, LC;Koerber, JT;Lee, WP;Yaspan, BL;Alatsis, KR;Arron, JR;Lazarus, RA;Yi, T;An Allosteric Anti-tryptase Antibody for the Treatment of Mast Cell-Mediated Severe AsthmaCell31585081Enriched CD34+ human cord blood stem cells were obtained from AllCells with more than 80% purity validated by flow cytometry analysis. CHO DKO cell line (Macaraeg et al., 2013) was a derivative of the CHO-K1 cell line (ATCC number CCL-61) was grown aFull Paper
2019Stuart, T;Butler, A;Hoffman, P;Hafemeister, C;Papalexi, E;Mauck, WM;Hao, Y;Stoeckius, M;Smibert, P;Satija, R;Comprehensive Integration of Single-Cell DataCell31178118Hashtag 9 Cell Hashing antibody BioLegend Cat# 394617 Hashtag 10 Cell Hashing antibody BioLegend Cat# 394619 Biological Samples Human bone marrow cells AllCells Cat# ABM007F, lot 3008803 Critical Commercial Assays 3′ scRNA-seq kit 10x Genomics V2 cheFull Paper
2019Abelin, JG;Harjanto, D;Malloy, M;Suri, P;Colson, T;Goulding, SP;Creech, AL;Serrano, LR;Nasir, G;Nasrullah, Y;McGann, CD;Velez, D;Ting, YS;Poran, A;Rothenberg, DA;Chhangawala, S;Rubinsteyn, A;Hammerbacher, J;Gaynor, RB;Fritsch, EF;Greshock, J;Oslund, RC;Barthelme, D;Addona, TA;Arieta, CM;Rooney, MS;Defining HLA-II Ligand Processing and Binding Rules with Mass Spectrometry Enhances Cancer Epitope PredictionImmunity31495665Human Healthy Donor Leukapheresis Material AllCells NA Human Healthy Donor Leukapheresis Material PPA Research NA Human Healthy Donor Leukapheresis Material StemExpress NA Human Healthy Donor Leukapheresis Material StemCell Technologies NAFull Paper
2019Lindner, JM;Cornacchione, V;Sathe, A;Be, C;Srinivas, H;Riquet, E;Leber, XC;Hein, A;Wrobel, MB;Scharenberg, M;Pietzonka, T;Wiesmann, C;Abend, J;Traggiai, E;Human Memory B Cells Harbor Diverse Cross-Neutralizing Antibodies against BK and JC PolyomavirusesImmunity30824324Purified peripheral blood mononuclear cells from leukapharesis AllCells, Inc. N/A leukapharesis and matched serum samples were obtained from AllCells LLC (Alameda, CA, USA). SaveFull Paper
2019Li, R;Wang, Y;Zhang, X;Feng, M;Ma, J;Li, J;Yang, X;Fang, F;Xia, Q;Zhang, Z;Shang, M;Jiang, S;Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasisMolecular cancer30704479HUVECs were purchased from ATCC and cultivated in endothelial cell complete medium containing endothelial cell growth supplement (Allcells, USA). For hypoxic culture, HCC cells SaveFull Paper
2019Jiang, Q;Isquith, J;Zipeto, MA;Diep, RH;Pham, J;Delos Santos, N;Reynoso, E;Chau, J;Leu, H;Lazzari, E;Melese, E;Ma, W;Fang, R;Minden, M;Morris, S;Ren, B;Pineda, G;Holm, F;Jamieson, C;Hyper-Editing of Cell-Cycle Regulatory and Tumor Suppressor RNA Promotes Malignant Progenitor PropagationCancer cell30612940Institutional Review Board approved protocol (#131550) that meets the requirements as stated in 45 CFR 46.404 and 21 CFR 50.51. De-identified (IRB exempt) human cord blood and normal aged-match samples were purchased as purified CD34+ cells from AllCFull Paper
2019Adelman, ER;Huang, HT;Roisman, A;Olsson, A;Colaprico, A;Qin, T;Lindsley, RC;Bejar, R;Salomonis, N;Grimes, HL;Figueroa, ME;Aging Human Hematopoietic Stem Cells Manifest Profound Epigenetic Reprogramming of Enhancers That May Predispose to LeukemiaCancer discovery31085557AML, which is more frequent in the elderly, is characterized by epigenetic deregulation. We demonstrate that epigenetic reprogramming of human HSCs occurs with age, affecting SaveFull Paper
2019Gong, X;Du, J;Parsons, SH;Merzoug, FF;Webster, Y;Iversen, PW;Chio, LC;Van Horn, RD;Lin, X;Blosser, W;Han, B;Jin, S;Yao, S;Bian, H;Ficklin, C;Fan, L;Kapoor, A;Antonysamy, S;Mc Nulty, AM;Froning, K;Manglicmot, D;Pustilnik, A;Weichert, K;Wasserman, SR;Dowless, M;Marugán, C;Baquero, C;Lallena, MJ;Eastman, SW;Hui, YH;Dieter, MZ;Doman, T;Chu, S;Qian, HR;Ye, XS;Barda, DA;Plowman, GD;Reinhard, C;Campbell, RM;Henry, JR;Buchanan, SG;Aurora A Kinase Inhibition Is Synthetic Lethal with Loss of the RB1 Tumor Suppressor GeneCancer discovery30373917The identification of a synthetic lethal interaction between RB1 and AURKA inhibition, and the discovery of a drug that can be dosed continuously to achieve uninterrupted inhibition of SaveFull Paper
2019Mascarenhas, J;Lu, M;Kosiorek, H;Virtgaym, E;Xia, L;Sandy, L;Mesa, R;Petersen, B;Farnoud, N;Najfeld, V;Rampal, R;Dueck, A;Hoffman, R;Oral idasanutlin in patients with polycythemia veraBlood31167802Baseline MDM2 protein levels in the enrolled PV/ET patients and 7 normal samples (peripheral blood, n = 4; bone marrow, n = 3) purchased from ALLcells (Alameda, CA) were evaluated using monoclonal antibody staining and flow cytometric analysis.24 BriFull Paper
2019Drissen, R;Thongjuea, S;Theilgaard-Mönch, K;Nerlov, C;Identification of two distinct pathways of human myelopoiesisScience immunology31126997Bone marrow samples were from AllCells or taken from healthy male volunteers at the age of 21 to 29 years old, who provided written informed consent in accordance with local SaveFull Paper
2019Hu, CW;Qiu, Y;Ligeralde, A;Raybon, AY;Yoo, SY;Coombes, KR;Qutub, AA;Kornblau, SM;A quantitative analysis of heterogeneities and hallmarks in acute myelogenous leukaemiaNature biomedical engineering30988472was prepared as described in publications11,21. In addition to AML patient samples, each array includes the same ten cryopreserved normal bone marrow CD34+ samples (NLBM CD34+) from healthy subjects (AllCells, Alameda, CA). Mutation Analysis All mutFull Paper
2019Maekawa, T;Kato, S;Kawamura, T;Takada, K;Sone, T;Ogata, H;Saito, K;Izumi, T;Nagao, S;Takano, K;Okada, Y;Tachi, N;Teramoto, M;Horiuchi, T;Hikota-Saga, R;Endo-Umeda, K;Uno, S;Osawa, Y;Kobayashi, A;Kobayashi, S;Sato, K;Hashimoto, M;Suzu, S;Usuki, K;Morishita, S;Araki, M;Makishima, M;Komatsu, N;Kimura, F;Increased SLAMF7high monocytes in myelofibrosis patients harboring JAK2V617F provide a therapeutic target of elotuzumabBlood31270105The hNOG mouse was created by transplanting human cord blood (Allcells, Alameda, CA) into the NOG mouse established by backcrossing an interleukin-2R (IL-2R) γ-chain knockout SaveFull Paper
2019Pang, WW;Czechowicz, A;Logan, AC;Bhardwaj, R;Poyser, J;Park, CY;Weissman, IL;Shizuru, JA;Anti-CD117 antibody depletes normal and myelodysplastic syndrome human hematopoietic stem cells in xenografted miceBlood30745302Normal human BM samples were purchased from AllCells (Alameda, CA). Human umbilical cord blood (UCB) samples and human BM samples from MDS patients were obtained SaveFull Paper
2019Abdel-Azim, H;Dvorak, C;Bunin, N;Walters, M;Talano, J;Anderson, E;Malvar, J;Al Jassani, M;Chaudhury, S;Cairo, M;Kitko, C;Jacob, A;Monos, D;Wing, L;Pulsipher, M;Next Generation Sequence Minimal Residual Disease (NGS-MRD) Predicts Outstanding Event Free Survival (EFS) Regardless of Hematopoietic Cell Transplantation (HCT) Preparative Approach or Graft Alpha/Beta Depletion in Children with Acute Lymphoblastic Leukemia (ALL)BloodMRD detected by flow cytometry (FC) or PCR has been associated with key outcomes after HCT for ALL. In a prospective multicenter trial (NCT02646839; Pediatric Blood and Marrow Transplant Consortium [PBMTC] ONC1401), we performed a planned sub-study oFull Paper
2019Dunbar, A;Kosiorek, H;Krishnan, A;McGovern, E;Park, Y;Patel, M;Weinberg, R;Yacoub, A;Dueck, A;Mascarenhas, J;Levine, R;Hoffman, R;Rampal, R;Identifying Cytokine Biomarkers of Response to Pegylated-Interferon Therapy in Polycythemia Vera and Essential Thrombocythemia: Correlative Analysis from the MPN-RC 111/112 TrialsBloodAge-matched serum from healthy individuals (N=6) was obtained from AllCells TM for use as wild-type (WT) controls. Baseline cytokine samples were compared between groups of Save;Background: Pegylated Interferon-alpha (PEG-IFNa) improves hematologicFull Paper
2019Park, SH;Lee, CM;Dever, DP;Davis, TH;Camarena, J;Srifa, W;Zhang, Y;Paikari, A;Chang, AK;Porteus, MH;Sheehan, VA;Bao, G;Highly efficient editing of the β-globin gene in patient-derived hematopoietic stem and progenitor cells to treat sickle cell diseaseNucleic acids research31147717K562 cells were cultured in RPMI1640 (ATCC, Cat No. 30-2001) supplemented with 10% FBS and L-glutamine. Frozen CD34+ cells from mobilized peripheral blood of normal individuals were purchased from AllCells. Peripheral blood CD34+ cells were acquiredFull Paper
2019Shortridge, MD;Wille, PT;Jones, AN;Davidson, A;Bogdanovic, J;Arts, E;Karn, J;Robinson, JA;Varani, G;An ultra-high affinity ligand of HIV-1 TAR reveals the RNA structure recognized by P-TEFbNucleic acids research30481318stimulate HIV-1 transcription. Twenty-four hours later, the percentage of cells expressing GFP was determined by flow cytometry as described above. Peptide uptake Frozen, de-identified human PBMCs (Allcells, Alameda, CA) were thawed and stimulated wFull Paper
2019McGrath, E;Shin, H;Zhang, L;Phue, JN;Wu, WW;Shen, RF;Jang, YY;Revollo, J;Ye, Z;Targeting specificity of APOBEC-based cytosine base editor in human iPSCs determined by whole genome sequencingNature communications31767844Briefly, CD34+ cells from a healthy male donor were purchased from AllCells (Alameda, CA, USA) and were cultured in StemSpan medium (STEMCELL Technologies, Vancouver, BC, SaveFull Paper
2019Sachdeva, M;Busser, BW;Temburni, S;Jahangiri, B;Gautron, AS;Maréchal, A;Juillerat, A;Williams, A;Depil, S;Duchateau, P;Poirot, L;Valton, J;Repurposing endogenous immune pathways to tailor and control chimeric antigen receptor T cell functionalityNature communications31723132are able to integrate complex environmental inputs and to generate custom outputs in a highly regulated and specific manner. Methods Biological materials Cryopreserved human PBMCs were acquired from ALLCELLS (cat # PB006F) and used in accordance witFull Paper
2019Gomez-Ospina, N;Scharenberg, SG;Mostrel, N;Bak, RO;Mantri, S;Quadros, RM;Gurumurthy, CB;Lee, C;Bao, G;Suarez, CJ;Khan, S;Sawamoto, K;Tomatsu, S;Raj, N;Attardi, LD;Aurelian, L;Porteus, MH;Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type INature communications31492863ck-treated samples, and 50% modification control were included. Data was analyzed using QuantaSoft (Bio-Rad). HSPC selection and culturing Human CD34+ HSPCs mobilized peripheral blood purchased from AllCells (Alameda, CA, USA) and thawed per manufacFull Paper
2019Zhang, Y;Roos, M;Himburg, H;Termini, CM;Quarmyne, M;Li, M;Zhao, L;Kan, J;Fang, T;Yan, X;Pohl, K;Diers, E;Jin Gim, H;Damoiseaux, R;Whitelegge, J;McBride, W;Jung, ME;Chute, JP;PTPσ inhibitors promote hematopoietic stem cell regenerationNature communications31413255collected from the recipient mice and were analyzed for percentages of DsRed+ cells in the BM17. Human BM cultures and human BM transplantation assays Human BM mononuclear cells were purchased from AllCells. Cryopreserved human BM cells were recoverFull Paper
2019Pellin, D;Loperfido, M;Baricordi, C;Wolock, SL;Montepeloso, A;Weinberg, OK;Biffi, A;Klein, AM;Biasco, L;A comprehensive single cell transcriptional landscape of human hematopoietic progenitorsNature communications31160568from MNCs with the human anti-CD34 MicroBeads Isolation Kit (Miltenyi Biotec) according to the manufacturer's specifications or were purchased from commercial sources (AllCells). SaveFull Paper
2019Pavel-Dinu, M;Wiebking, V;Dejene, BT;Srifa, W;Mantri, S;Nicolas, CE;Lee, C;Bao, G;Kildebeck, EJ;Punjya, N;Sindhu, C;Inlay, MA;Saxena, N;DeRavin, SS;Malech, H;Roncarolo, MG;Weinberg, KI;Porteus, MH;Gene correction for SCID-X1 in long-term hematopoietic stem cellsNature communications30967552d to the purified AAV6 at a final concentration of 0.001%, aliquot and stored at −80 °C. CD34+ HSPCs Mobilized peripheral blood  (mPB) and bone marow (BM) CD34+ HSPCs cells were purchased from AllCells (Alameda, CA, USA). Cells were thawed using pubFull Paper
2019Kimmey, SC;Borges, L;Baskar, R;Bendall, SC;Parallel analysis of tri-molecular biosynthesis with cell identity and function in single cellsNature communications30862852Fresh bone marrow aspirates from two independent donors were obtained from AllCells (Alameda, CA) on the same day of collection, and immediately after receiving was placed in 37 SaveFull Paper
2019Paschon, DE;Lussier, S;Wangzor, T;Xia, DF;Li, PW;Hinkley, SJ;Scarlott, NA;Lam, SC;Waite, AJ;Truong, LN;Gandhi, N;Kadam, BN;Patil, DP;Shivak, DA;Lee, GK;Holmes, MC;Zhang, L;Miller, JC;Rebar, EJ;Diversifying the structure of zinc finger nucleases for high-precision genome editingNature communications30850604rer’s instructions. Target loci were then analyzed by PCR amplification followed by deep sequencing (MiSeq). Studies performed in T-cells Peripheral blood CD3 + Pan T-cells were purchased from AllCells (Alameda, CA). Transfections into activated T-cFull Paper
2019Czechowicz, A;Palchaudhuri, R;Scheck, A;Hu, Y;Hoggatt, J;Saez, B;Pang, WW;Mansour, MK;Tate, TA;Chan, YY;Walck, E;Wernig, G;Shizuru, JA;Winau, F;Scadden, DT;Rossi, DJ;Selective hematopoietic stem cell ablation using CD117-antibody-drug-conjugates enables safe and effective transplantation with immunity preservationNature communications30728354als into 9 Gy, lethally irradiated, C57BL/6J (CD45.2+) wild-type recipients as previously described16. Human cord blood transplantation Single donor-derived cord blood CD34+ cells were obtained from AllCells (Alameda, CA) under local IRB-approved prFull Paper
2019Zeng, Y;Yao, X;Liu, X;He, X;Li, L;Liu, X;Yan, Z;Wu, J;Fu, BM;Anti-angiogenesis triggers exosomes release from endothelial cells to promote tumor vasculogenesisJournal of extracellular vesicles31258881o inhibit tumor vasculogenesis may serve as a novel strategy to augment the long-term efficacy of anti-angiogenic and anti-autophagic therapies for tumors. Materials and methods Cell culture HUVECs (Allcells, Shanghai, China) were cultured in HUVECFull Paper
2019Mu, Q;Cabana-Puig, X;Mao, J;Swartwout, B;Abdelhamid, L;Cecere, TE;Wang, H;Reilly, CM;Luo, XM;Pregnancy and lactation interfere with the response of autoimmunity to modulation of gut microbiotaMicrobiome31311609Human plasma samples were purchased from AllCells (Alameda, CA). For measuring anti-DNA IgG, anti-LPS IgG, and anti-flagellin IgG, high-binding plates were coated overnight at 4 SaveFull Paper
2019Li, W;Wu, D;Zhu, S;Liu, Z;Luo, B;Lu, L;Zhou, C;Sustained release of plasmid DNA from PLLA/POSS nanofibers for angiogenic therapyChemical Engineering JournalHuman umbilical vein endothelial cells (HUVECs, purchased from Allcells, shanghai, China) were cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (P/S, Gibco) at 37 °C in 5% CO2Full Paper
2019Wu, HW;Sheard, MA;Malvar, J;Fernandez, GE;DeClerck, YA;Blavier, L;Shimada, H;Theuer, CP;Sposto, R;Seeger, RC;Anti-CD105 Antibody Eliminates Tumor Microenvironment Cells and Enhances Anti-GD2 Antibody Immunotherapy of Neuroblastoma with Activated Natural Killer CellsClinical cancer research : an official journal of the American Association for Cancer Research31068371Human umbilical vein endothelial cells (HUVEC) were purchased from AllCells, LLC and maintained in HUVEC Basal Medium containing 10% Stimulatory Supplement from AllCells in SaveFull Paper
2019Zuch de Zafra, CL;Fajardo, F;Zhong, W;Bernett, MJ;Muchhal, US;Moore, GL;Stevens, J;Case, R;Pearson, JT;Liu, S;McElroy, PL;Canon, J;Desjarlais, JR;Coxon, A;Balazs, M;Nolan-Stevaux, O;Targeting Multiple Myeloma with AMG 424, a Novel Anti-CD38/CD3 Bispecific T-cell-recruiting Antibody Optimized for Cytotoxicity and Cytokine ReleaseClinical cancer research : an official journal of the American Association for Cancer Research30918018Frozen human T cells (AllCells) or frozen peripheral blood mononuclear cells (PBMC) from humans or cynomolgus (CepheusBio) were cocultured with target cells at an effector cell (E) SaveFull Paper
2019Jin, Q;Martinez, CA;Arcipowski, KM;Zhu, Y;Gutierrez-Diaz, BT;Wang, KK;Johnson, MR;Volk, AG;Wang, F;Wu, J;Grove, C;Wang, H;Sokirniy, I;Thomas, PM;Goo, YA;Abshiru, NA;Hijiya, N;Peirs, S;Vandamme, N;Berx, G;Goosens, S;Marshall, SA;Rendleman, EJ;Takahashi, YH;Wang, L;Rawat, R;Bartom, ET;Collings, CK;Van Vlierberghe, P;Strikoudis, A;Kelly, S;Ueberheide, B;Mantis, C;Kandela, I;Bourquin, JP;Bornhauser, B;Serafin, V;Bresolin, S;Paganin, M;Accordi, B;Basso, G;Kelleher, NL;Weinstock, J;Kumar, S;Crispino, JD;Shilatifard, A;Ntziachristos, P;USP7 Cooperates with NOTCH1 to Drive the Oncogenic Transcriptional Program in T-Cell LeukemiaClinical cancer research : an official journal of the American Association for Cancer Research30224337were maintained in DMEM medium supplemented with 10% heat-inactivated FBS, 2% penicillin/streptomycin, and 1% GlutaMAX. Human pan T cells were purchased from AllCells.com (Alameda, CA). Primary human samples were collected by collaborating institutioFull Paper
2019Zheng, B;Yu, SF;Del Rosario, G;Leong, SR;Lee, GY;Vij, R;Chiu, C;Liang, WC;Wu, Y;Chalouni, C;Sadowsky, J;Clark, V;Hendricks, A;Poon, KA;Chu, W;Pillow, T;Schutten, MM;Flygare, J;Polson, AG;An Anti-CLL-1 Antibody-Drug Conjugate for the Treatment of Acute Myeloid LeukemiaClinical cancer research : an official journal of the American Association for Cancer Research29959143Bone marrow mononuclear cells (BM-MNC) from healthy human donors (AllCells) were prepared by density gradient centrifugation with Ficoll-Paque PLUS (GE Healthcare). CD34 + SaveFull Paper
2019Castillo, J;Wu, E;Lowe, C;Srinivasan, S;McCord, R;Wagle, MC;Jayakar, S;Edick, MG;Eastham-Anderson, J;Liu, B;Hutchinson, KE;Jones, W;Stokes, MP;Tarighat, SS;Holcomb, T;Glibicky, A;Romero, FA;Magnuson, S;Huang, SA;Plaks, V;Giltnane, JM;Lackner, MR;Mounir, Z;CBP/p300 Drives the Differentiation of Regulatory T Cells through Transcriptional and Non-Transcriptional MechanismsCancer research31182547Normal human peripheral blood CD4+/CD45RA+/CD25− naïve T cells were procured from Allcells (PB009-5). Cells were isolated using Immunomagnetic CD4+ Isolation Kit, CD45RO microbeads to deplete CD45RO+ cells, and cultured using Dynabeads human T activaFull Paper
2019Levi, J;Lam, T;Goth, SR;Yaghoubi, S;Bates, J;Ren, G;Jivan, S;Huynh, TL;Blecha, JE;Khattri, R;Schmidt, KF;Jennings, D;VanBrocklin, H;Imaging of Activated T Cells as an Early Predictor of Immune Response to Anti-PD-1 TherapyCancer research31064845Neutrophils and eosinophils were isolated from human whole blood (AllCells, Alameda CA). Human neutrophil and eosinophil enrichment kit (StemCell Technologies) was used to purify the cells. Neutrophils were either treated with 1uM N-formyl- L-methionFull Paper
2019Boudreaux, SP;Duren, RP;Call, SG;Nguyen, L;Freire, PR;Narayanan, P;Redell, MS;Conneely, OM;Drug targeting of NR4A nuclear receptors for treatment of acute myeloid leukemiaLeukemia29884904rmed consent at Texas Children’s Hospital in accordance with the Declaration of Helsinki and institutional review board regulations. Normal cord blood CD34+ stem/progenitor cells were obtained from AllCells. Connectivity Map (CMAP) Analysis The NR4AFull Paper
2019Shen, JC;Kamath-Loeb, AS;Kohrn, BF;Loeb, KR;Preston, BD;Loeb, LA;A high-resolution landscape of mutations in the BCL6 super-enhancer in normal human B cellsProceedings of the National Academy of Sciences of the United States of America31748270Human B Cells. The CD19+ B cells were purchased from AllCells and ReachBio. Peripheral blood mononuclear cells (PBMCs) were purified from whole blood drawn from 10 healthy donors (SI Appendix, Table S2). CD19+ B cells were purified by positive selectFull Paper
2019Zhang, L;Dong, X;Lee, M;Maslov, AY;Wang, T;Vijg, J;Single-cell whole-genome sequencing reveals the functional landscape of somatic mutations in B lymphocytes across the human lifespanProceedings of the National Academy of Sciences of the United States of America30992375Two frozen human umbilical cord blood mononuclear cell samples were obtained from AllCells and STEMCELL Technologies. Informed consent was obtained from all the donors. The SaveFull Paper
2019Ye, S;Cohen, D;Belmar, NA;Choi, D;Tan, SS;Sho, M;Akamatsu, Y;Kim, H;Iyer, R;Cabel, J;Lake, M;Song, D;Harlan, J;Zhang, C;Fang, Y;Wahl, AF;Culp, P;Hollenbaugh, D;Chao, DT;A Bispecific Molecule Targeting CD40 and Tumor Antigen Mesothelin Enhances Tumor-Specific ImmunityCancer immunology research31462409than 10 passages from master cell banking. Fresh human peripheral blood mononuclear cells (PBMC) from healthy donors (about 109 per donor) were purchased from AllCells. Donor virus testing results of human immunodeficiency virus, hepatitis B virus, aFull Paper
2019Gui, X;Deng, M;Song, H;Chen, Y;Xie, J;Li, Z;He, L;Huang, F;Xu, Y;Anami, Y;Yu, H;Yu, C;Li, L;Yuan, Z;Xu, X;Wang, Q;Chai, Y;Huang, T;Shi, Y;Tsuchikama, K;Liao, XC;Xia, N;Gao, GF;Zhang, N;Zhang, CC;An, Z;Disrupting LILRB4/APOE Interaction by an Efficacious Humanized Antibody Reverses T-cell Suppression and Blocks AML DevelopmentCancer immunology research31213474In the coculture assay, human T cells (5 × 10 4 cells per well) isolated from health donor peripheral blood (AllCells) were placed in the lower chambers of a 96-well transwell plate. SaveFull Paper
2019Newman, M;Abstract B178: Development and preclinical efficacy characterization of a systemically administered multiple Toll-like receptor (TLR) agonist for antitumor immunotherapyCancer Immunology ResearchPBMCs from fresh normal peripheral blood leukapheresis paks (ALLCells, Alameda, CA) were isolated using a Ficoll gradient. Ten-fold increments of 1x10/mL to 1x10^8/mL untreated SaveFull Paper
2019Sun, Y;Xiao, Y;Sun, H;Zhao, Z;Zhu, J;Zhang, L;Dong, J;Han, T;Jing, Q;Zhou, J;Jing, Z;miR-27a regulates vascular remodeling by targeting endothelial cells' apoptosis and interaction with vascular smooth muscle cells in aortic dissectionTheranostics31695809Prime HUVECs were purchased from ALLCELLS and cultured in endothelial cell media (ALLCELLS, Emeryville, California) at 37℃ in a humidified atmosphere with 5% CO 2 . HEK 293 SaveFull Paper
2019Varricchio, L;Planutis, A;Manwani, D;Jaffray, J;Mitchell, WB;Migliaccio, AR;Bieker, JJ;Genetic disarray follows mutant KLF1-E325K expression in a congenital dyserythropoietic anemia patientHaematologica30872368no new patient material was obtained for the present study. Mononuclear cells from the peripheral blood (PBMC) had been isolated and cryopreserved as described.35 Non-patient PBMC were purchased from AllCells (PB003F). Human erythroid massive amplifFull Paper
2019Sapienza, MR;Abate, F;Melle, F;Orecchioni, S;Fuligni, F;Etebari, M;Tabanelli, V;Laginestra, MA;Pileri, A;Motta, G;Rossi, M;Agostinelli, C;Sabattini, E;Pimpinelli, N;Truni, M;Falini, B;Cerroni, L;Talarico, G;Piccioni, R;Amente, S;Indio, V;Tarantino, G;Brundu, F;Paulli, M;Berti, E;Facchetti, F;Dellino, GI;Bertolini, F;Tripodo, C;Rabadan, R;Pileri, SA;Blastic plasmacytoid dendritic cell neoplasm: genomics mark epigenetic dysregulation as a primary therapeutic targetHaematologica30381297RNA of 4 normal plasmacytoid dendritic cell (pDCs) samples was purchased from AllCells (Alameda, CA, US) and used for comparison. For details, see Online Supplementary Table S6 Save;BPDCN cryopreserved cutaneous biopsies, sufficient only for RNA seFull Paper
2019Yao, X;Liu, R;Liang, X;Ding, J;Critical Areas of Proliferation of Single Cells on Micropatterned Surfaces and Corresponding Cell Type DependenceACS applied materials & interfaces30964630Primary rat MSCs were purchased from Allcells Tech., Shanghai, People’s Republic of China; primary mouse embryo fibroblasts (EF) were purchased from Shanghai Gaining Biological Technology Co., Ltd.; human cervix epithelial carcinoma cells (Hela) andFull Paper
2019Deng, X;Chu, X;Wang, P;Ma, X;Wei, C;Sun, C;Yang, J;Li, Y;MicroRNA-29a-3p Reduces TNFα-Induced Endothelial Dysfunction by Targeting Tumor Necrosis Factor Receptor 1Molecular therapy. Nucleic acids31760375ina), and HEK293 cells (ATCC, Manassas, VA, USA) were maintained in DMEM (HyClone, South Logan, UT, USA) containing 10% fetal bovine serum (FBS; PAA Laboratories, Austria). pHUVECs were obtained from AllCells (China) and cultured incomplete medium (AFull Paper
2019Mandal, S;Prathipati, PK;Belshan, M;Destache, CJ;A potential long-acting bictegravir loaded nano-drug delivery system for HIV-1 infection: A proof-of-concept studyAntiviral research30991088TZM-bl cells were obtained from NIH AIDS reagent program (Kappes and Wu, 2018; Kappes et al., 2015). Peripheral blood mononuclear cells (PBMCs) were obtained from commercial vendor (AllCells Inc. Alameda, CA). TZM-bl cells were maintained in completeFull Paper
2019Bongen, E;Lucian, H;Khatri, A;Fragiadakis, GK;Bjornson, ZB;Nolan, GP;Utz, PJ;Khatri, P;Sex Differences in the Blood Transcriptome Identify Robust Changes in Immune Cell Proportions with Aging and Influenza InfectionCell reports31722210Sample preparation and CyTOF methods have been described previously (Fragiadakis et al., 2019). Briefly